Download embor7400773-sup-0001

Supplemental Material and Methods
Fly stocks and genetics.
Canton-S (CS), Oregon-R (OR) and yellow white (yw) strains were used as wild type. blanks
(bln1) was obtained from the Bloomington Stock Center, EP(2)2305 and EP(2)2049 from the
Szeged Drosophila Stock Centre. The Z2-1091 fly stock allele (a gift from Charles Zuker) was
generated from a EMS mutagenesis-induced male sterility screen (Wakimoto et al., 2004) and
characterized as a cyt-c-d allele. It carries a point mutation that generates a stop codon at position
62 (TGG>TGA) (Arama et al., 2006). The Ex-6C allele was generated through an imprecise
excision from strain EP(2)2305, using the transposase-producing ∆2-3 ‘jumpstart’ strain,
essentially as described (Torok et al., 1993). It created a deletion of about 1kb downstream of
EP(2)2305 in cyt-c-d gene (the breakpoints are 278;940-1260). The GMR-cyt-c-d transgenic line
was generated by digestion of the BDGP’s EST clone LP05614 with EcoRI and Ecl136II and
ligation of the fragment containing the cyt-c-d coding region into the EcoRI and StuI sites of the
pGMR vector (Hay et al., 1994). This plasmid, pGMR-cyt-c-d, was used to generate transgenic
flies using standard procedures.
FRT42D, arkL46 bears an amino acid substitution of a cysteine into a threonine residue at
position 346 and a premature stop codon at position 950. FRT42D, arkN5 is viable hypomorphic
allele that contains a glutamate instead of an aspartate residue at postion 977 (Srivastava et al.,
2006). drICE17 is a strong loss of function allele with few escapers (Xu et al., 2006). droncI29,
FRT80B contains an amino acid substitution at position 53 which inserts a premature stop codon
into the coding sequence (Xu et al., 2005). GMR-droncDN is a kind gift from Bruce Hay
(Hawkins et al., 2000). The dcp-1prev1 mutant is a viable null allele (Laundrie et al., 2003).
dreddD55 is a viable null allele (Leulier et al. 2000). Mosaic clones were generated by Flipasemediated mitotic recombination. eyflp; FRT42D, P{w+Ubi-GFP} and eyflp;; P{w+Ubi-GFP}
1
FRT80B were obtained from the Bloomington Stock Center (donated to Bloomington by David
Strutt and Bruce Edgar, respectively). For pupal dissections, white prepupae (0h) were collected
and maintained at 25C.
Immunochemistry and ATP assay
Third instar larval and staged pupal eyes were dissected and stained using standard
procedures. The antibodies and dilutions used were: mouse anti-Arm 1:10, rat anti-Elav 1:100
(Developmental Studies Hybridoma Bank), mouse anti-Boss 1:300 (a gift from H. Kramer),
guinea-pig anti-homothorax 1:2000 (gift from R. Mann) and rabbit anti-GFP 1:500 (Molecular
Probes). TUNEL staining was performed as described (Lin et al., 2004) using the Cell Death
detection kit (TMR red) from Roche Diagnostic. All fluorescent pictures were obtained from a
Zeiss LSM 510 confocal microscope.
ATP levels were measured in adult fly heads using a luciferase ATP determination kit
(Molecular Probes). Four one-day-old adult heads were homogenized in 1X Reporter lysis buffer
(Promega; 10µl per head) and quickly transferred to dry ice. The samples were boiled for 15
min. and centrifuged at 17800 g for 15 min at 4˚C. 5µl samples were added to 195µl of reaction
buffer from the luciferase ATP determination kit. Luminofluorescence was measured using a
Berthold Technologies LB9507 luminometer and the data were normalized to the protein
content.
RNA isolation and RT-PCR
Total RNA was extracted from ten pupal heads using the Micro-to-Midi Total RNA
Purification System (Invitrogen) according to the manufacturer’s recommendations. The samples
were collected into 1.5 ml Eppendorf tubes on ice and containing 300 µl of the Invitrogen kit’s
2
lysis buffer and 3 µl of 2-Mercapto-ethanol, homogenized using a Pellet Pestle Motor (Kontes),
and subsequently purified using the same kit. The RNA was immediately utilized for RT-PCR
reactions using the SuperScript™ III One-Step RT-PCR System with Platinum Taq DNA
polymerase (Invitrogen). The Mastercycler Gradient PCR machine (Eppendorf) was
programmed as follows: 50˚C for 30 min for the RT step followed by 94˚C for 2 min, and the
amplification steps of 94˚C for 30 sec, 60˚C for 30 sec, 68˚C for 1 min. 35 cycles were
preformed. The cyt-c-d forward primer GAACAGAATCGGCAGCGGGA and reverse primer
TCTGGATAGCATGGTGGCCG amplified a 543 bp fragment which excludes genomic
contamination since the primers surround a ~3Kbp intron (Arama et al., 2006).
Interommatidial cell counts
1, 2 and 3 pigment cells (bristles excluded) were counted from retinas stained with antiArm antibodies. Cells contained within a hexagonal array surrounding a single ommatidium and
delimited by the center of the six surrounding ommmatidia were counted (Wolff and Ready,
1991). Standard error of measurement was calculated using the formula for interval estimates of
the difference between two independent population means with a 95% confidence interval.
3
Supplemental figure legends
Figure S1: The process of IOC elimination during pupation.
The final step of pattern formation of the pupal retina is the elimination of the excess IOCs
and the differentiation of the remaining cells into lattice cells that include secondary (2º) and
tertiary pigment cells (3º) (Cagan and Ready, 1989; Wolff and Ready, 1991). Maximal apoptosis
occurs during the first third of pupal life (Cagan and Ready, 1989; Wolff and Ready, 1991).
About one third of the IOCs disappears by apoptosis. (A-C) Staged wild-type pupal retina
stained against Arm to outline the cellular membrane. (A’-C’) panels show the corresponding
schematic ommatidium containing four cone cells (orange cells labeled “c”), two primary
pigment (yellow cell labeled “1”), three bristle cells (small dark yellow cells labeled “b”) and
several IOCs (purple cells). The eight-photoreceptor cells located underneath the IOC layer are
not visualized. IOC elimination occurs in two stages that can be visualized by comparing IOC
organization and number at specific pupal stages: (A to B) the early stage of death in which
about 1.8 IOCs/ommatidium die by apoptosis (Cordero et al., 2004), and the process of IOC
sorting simultaneously occurs (18h-24h) (Reiter et al., 1996); (B-C) the late stage of death (26h36h) during which another 1.7 IOC/ommatidium are eliminated and the remaining IOCs
differentiate as 2º and 3º cells. B’) one of the two IOCs between each pair of bristle cells
surrounding the ommatidial cluster (marked with an asterisk) will be eliminated. C’) By 42h
APF, the elimination of IOCs is complete and each ommatidium is surrounded by six 2, three 3
and three bristle cells.
4
Figure S2: Genomic organization of the cyt-c locus.
Schematic representation of the cyt-c locus based on the information available on Flybase
(http://flybase.bio.indiana.edu/). Black lines and boxed sections represent gene introns and
exons, respectively. The relative locations of cyt-c-d, cyt-c-p, and other genes in the region are
indicated, as annotated by the Berkeley Genome Project, as of June 2006. The P{PZ} bln1 is
inserted 2 bp upstream of the last nucleotide of exon-1, while the EP2305 and EP2049 insertions
are 83 bp and 77 bp upstream of the last nucleotide of exon-1 of cyt-c-d gene, respectively. Ex6C allele corresponds to a deletion of about 1kb downstream of the EP2305 insertion. Z2-1091
bears a point mutation, which introduces a stop codon in the cyt-c-d coding region at position 62
(TGG>TGA).
Figure S3: IOCs express normally hth and arm in cyt-c-d mutant retina during pupal
development.
IOCs are visualized by staining with anti-Arm and anti-Hth antibodies in wild-type and cytc-d Z2-1091-/- retinas at 24h, 27h and 30h APF. Starting at 24h APF, it is possible to identify IOCs
by Arm staining (apical part of the retina A-F) and verify that their respective nuclei express Hth
(bottom part of the retina A’-F’). Yellow arrows help to position and follow particular IOCs in
two different focal plans. In both wild type (A, C, E) and cyt-c-d z2-1091 mutant (B, D, F) retinas,
we observed that all IOC express both Arm and Hth. Note that few non-marked Arm positive
cells might not show a positive Hth nuclei as they might be out of the focal plane represented in
the panel.
5
Figure S4: IOC sorting and maturation occurs normally in cyt-c-d mutant retinas
IOCs are visualized by staining with anti-Arm antibody in wild-type and cyt-c-d
Z2-1091-/-
retinas at 20h, 24h and 27h APF. At 20h APF, IOC subtypes are indistinguishable and cell
borders are straight (Compare panels A and D). By 24h APF, as differentiation proceeds and
unwanted IOCs are eliminated, the remaining IOCs take their final position and acquire a more
spherical shape (Compare panels B and E). Then, 2º and 3º cells become distinguishable (27h
APF): 2 elongate, while 3º remain small (Compare panels C and F).
Figure S5: cyt-c-d and dronc synergistically interact for the elimination of extra IOCs.
Pupal retinas were stained against Arm protein to visualize retinal cell membranes in staged
42h APF animals. (A) wild type and (B) cyt-c-d
z2-1091-/+
retinas do not exhibit extra IOC. Extra
IOCs are marked red in (C) GMR-droncDN and (D) GMR-droncDN cyt-c-d
z2-1091-/+
retinas.
There is a synergistic increase of the number of extra IOCs in D compared to C and B.
Figure S6: Retinal differentiation is normal in ark and dronc mutant clones
arkL46 and droncI29 mutant clones were generated and visualized by the absence of GFP as in
Figure 3. (A, B) Posterior is to the right. Third instar eye disc stained with Boss (red) and Elav
(blue) antibodies are identical in arkL46 (A), droncI29 (B) mutant clones and in the non-mutant
tissue (green). This indicates that photoreceptor cell differentiation occurs normally in arkL46 and
droncI29 mutants. In addition, the correct number of photoreceptor cells was observed in ark and
dronc clones in larval eye and in adult retinal sections (data not shown). A’ and B’ panels are the
corresponding arkL46 and droncI29 mutant clones, respectively, without the GFP staining. The
white line indicates the boundary of the clone. arkL46 and droncI29 mutant clones were generated
6
and stained with Arm (apical view; C and E) and the 2º and 3º marker, Hth (basal view; and F),
in two distinct focal plans of the 42h APF retina. In arkL46 and droncI29 mutant clones, extra 2º or
3º cells are visualized with Arm staining and their nuclei express Hth (yellow arrows). In both
mutant and non-mutant tissues, Hth is expressed in all 2º and 3º pigment cells, below the Arm
focal section. These results demonstrate that 2º and 3º cells develop normally in ark and dronc
mutant pupal tissues.
Table S1: Statistical analysis of the extra bristle phenotype on cyt-c-d, ark, dcp-1, drICE
and dredd mutant flies.
All cyt-c-d mutant allele fly stocks had a significant amount of flies with an extra bristle.
Extra bristles were also observed in arkN5 and dcp-1prev1 mutant flies. A minimum of 100 flies
(N) for each genotype were scored for at least one extra posterior scutellar bristle.
7