Download June Review Enriched Term 3 Topic 1

June Review Enriched Term 3
Topic 1- Heat, potential, kinetic and mechanical energy, forces, motion and
work
1. Define the following:
Heat energy
Kinetic energy
Potential energy
2. Give the formulas and units for the following:
Heat energy
Kinetic energy
Potential energy
Mechanical energy
3. How do you convert the following:
m to km
g to kg
km/h to m/s
kWh to J
4. What are the formulas for initial and final temperature?
5. What was the mass of water if it absorbed 3 007 J of heat with an original temperature of
40.0°C and a final temperature of 54°C?
6. What is vinegar’s specific heat if 30.0 g was heated for 18 minutes and had a temperature
change of 26°C to produce 50 500 J of heat?
7. There was 20.0 g of water with an initial temperature of 1.0°C. The water had absorbed
2 100 J of energy. What was the water’s final temperature?
8. Syrup absorbed 5 500 J of heat with a specific heat of 1.3 g/J°C. What was the syrup’s
initial temperature if 210 g of had a final temperature of 55°C.
9. A bow and arrow weighing 3.0 kg is raised 9.0 m. What is its potential energy?
10. A rock weighs 9.0 kg and has a potential energy of 1 200 J. What height is it found at?
11. A ball is raised 5.0 m off the ground and weighs 750 g. What is its potential energy?
12. A truck weighing 17 000 kg has 9 005 J of kinetic energy. What is the speed it is
travelling at?
13. A camp has a waterslide that is 5.0 meters high. Debra, a 55 kg camper, is sliding down
the waterslide from rest. See Figure 6 below.
How fast will Debra be travelling when she reaches the water? Neglect air and friction.
14. Define the following terms:
Motion
Forces
Work
Effective force
15. What is earth’s and the moon’s gravitational force equal to?
16. What is the formula for work with its units?
17. How much work does the gravitational force acting on a skier represent if the skier has a
mass of 55 kg and travels 4.0 km down a hill with a 40.0° angle?
18. What is the work done if a skier with a mass of 70.0 kg skis down a hill at a 40.0° angle
for 30.0 m?
19. Explain if each person will be able to lift their luggage weighing 25 kg off the floor if
they both are lifting the luggage at a 25°, but person 1 is using 300 N of force and person
2 is using 500.0 N of force.
20. A person is pulling a box along the floor with a force of 60.0 N at an angle of 60.0° to the
horizontal. What is the effective force?
21. How much work was done when a man pulled his luggage at the airport for 305 m with a
force of 85 N at a 35° angle?
22. If each of the carts illustrated below travels a distance of 4 m, in which situation will the
energy gained by the cart be greater? Show your calculations.
a)
b)
23. A grocer has received guidelines from the Workplace Health and Safety Board on the
prevention of injuries at work. These guidelines state that his employees should not be
required to apply a force of more than 85 N when pulling the cart.
The grocer has collected some data on the carts his employees use and how they use them in
order to help him determine if the guidelines are respected.
Cart Handle
40°
Horizontal
Distance = 4.5 m



The handle is at an angle of 40.0° to the horizontal
The cart is pulled for 4.5 m
The effective force is 40.0 N
Assume that the floor is frictionless.
a- Determine whether or not the store’s use of the cart respects the guidelines of a maximum
applied force of 85 N.
b- Calculate how much work is done when the cart is used as described above.
Topic 2- Ecosystems
1. Explain eutrophication and the phosphorus cycle.
2. Define the following terms
Ecological footprints
Toxicity threshold
Ecotoxicology
Contaminants
3. What can you do to decrease your ecological footprint?
4. What 3 things does toxicity depend on?
5. Explain bioaccumulation and bioconcentration.
6. In a food chain, which organism will have the most contaminant in it and why?
Topic 3- Genetics
1. Give a brief description of the following terms:
Chromosomes
Genes
DNA
Nitrogen bases
Ribosome
Transcription
Translation
mRNA
tRNA
Amino acids
Protein
2. Explain the process of how proteins are made.
3. Below is a section of a DNA strand that will code for a protein.
TACATGAGACCTTTTGTTGTGCGGGGCATT
A- What is the mRNA strand corresponding to the above DNA strand?
B- What are the tRNA anticodons associated with this mRNA strand?
C- Give the amino acid sequence produced.
Use the following table to complete question 4
Trait
Stem
length
Seed
shape
Seed
colour
Seed coat
colour
Pod shape
Pod
colour
Dominant
tall
round
yellow
coloured
inflated
green
Recessive
short
wrinkled
green
white
constricted
yellow
4. Give all the possible alleles which could represent the following:
Tall plant
Wrinkled
Yellow
White coat Inflated
Green pod
seed
pod
Yellow pod
5. In guinea pigs, a black coat is dominant over a brown coat. What are the genotypes and
phenotype percentages?
6. Huntington’s is a fatal dominant disease. If a heterozygous man
who has Huntington’s marries a normal female, what are the chances that
their child will have Huntington’s?
7. Colour blindness is a sex-linked trait. What are the outcomes for the children is a non
colour blind man mates with a carrier female?
8. In summer squash, white fruit color is dominant over yellow fruit color and disk-shaped
fruit is dominant over sphere-shaped fruit. If a squash plant true- breeding for white, diskshaped fruit is crossed with a plant heterozygous plant for both traits, what will the
phenotypes and genotypes be?
Topic 3- Mole and stoichiometry
1. What is Avogadro’s number equal to?
2. What is mole of zinc equal to?
3. What is the molar mass of nitrogen?
4. What is the mass of:
1.00 mol CO2
2.0 mol of C6H12O6
0.03 mol of NaCl
0.55 moles of PCl3
5. What mass of solute is required to prepare 350 mL of NaOH at a concentration of 0.75 mol/L?
6. What is the molar concentration of the water in an aquarium that contains 100.0 L of salt water
prepared with 2.8 kg of sodium chloride (NaCl)?
7. Explain the lab procedure involved in preparing 250 mL of a 3.0 mol/L solution of CaCO3.
8. What is the molarity of a 10.0 L solution of HCl that contains 0.36 g of solute?
9. Iron rusts according to the following equation:
4 Fe + 3 O2 → 2 Fe2O3
By how much will the mass of 10.0 g of iron increase the mass of Fe2O3?
10. Consider the following unbalanced equation:
C2H4 + O2 → CO2 + H2O
a- How many moles of carbon dioxide will react with 5.0 moles of oxygen?
b- How many moles of oxygen are needed to form 20.0 g of water?
c- What mass of carbon dioxide will be produced if 100.0 mL of water is formed?
11. Aspirin (C9H8O4) is produce from salicylic acid (C7H6O3) according to the equation below:
2 C7H6O3
+ C4H6O3
→ 2 C9H8O4
What mass of water forms at the same time as 540 g of aspirin?
+ H2O
12. A student prepared 1 250 mL of solution by using 17.0 g of aluminum sulfate, Al2(SO4)3 . What is
the molar concentration of the solution?
13. How many grams of solute are there in 350.0 mL of a solution of NH4OH with a concentration of
0.65 mol/L
14. You must prepare 500.0 mL of an aqueous solution of sodium nitrate (NaNO3) that will have a
concentration of 0.40 mol/L. What mass of NaNO3 is required?
15. Iron oxide, Fe2O3, reacts with carbon, C, to produce iron, Fe, according to the following balanced
equation:
Fe2O3 + 3 C → 2 Fe + 3 CO
What mass of carbon is required for every 6.00 moles of Fe2O3 used?
16. What is the difference between an exothermic and an endothermic reaction?