Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
DEPARTMENT for ENVIRONMENT, FOOD and RURAL AFFAIRS Research and Development CSG 15 Final Project Report (Not to be used for LINK projects) Two hard copies of this form should be returned to: Research Policy and International Division, Final Reports Unit DEFRA, Area 301 Cromwell House, Dean Stanley Street, London, SW1P 3JH. An electronic version should be e-mailed to [email protected] Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Contractor organisation and location Horticulture Research International East Malling, West Malling KENT, ME19 6BJ Total DEFRA project costs Project start date £ 183,528 01/11/00 Project end date 31/03/04 Executive summary (maximum 2 sides A4) This strategic research focused on developing plastid and nuclear transformation technologies in strawberry, with an emphasis on improving safety aspects of the genetically modified (GM) crop. It aimed to address potential and perceived risks in relation to the consumer, non-target species and the environment. This was to be achieved through reducing the potential for foreign gene escape via pollen, avoiding the use of antibiotic resistance genes and targeting foreign gene expression to only those tissues where foreign gene products are required. The work centred on: i) Development of the novel use of a non-antibiotic selection system in plastid transformation based on carbohydrate metabolism. Plastid transformation achieves precise targeting of foreign DNA into the plastid genome, localisation of foreign gene products within plastids and offers a means of restricting foreign gene flow through pollen ii) Determination of the potential for strawberry tissue-specific promoters to direct foreign gene expression to specific tissues in GM plants generated by nuclear transformation iii) Investigation of the mode of plastid inheritance in strawberry to determine the degree of benefit afforded, in terms of foreign gene containment, through the use of plastid transformation to generate GM plants. Objective 1 Development of the xylose isomerase/xylose selection system for plastid transformation in strawberry To develop the plastid transformation system, it was first necessary to a) make a plasmid vector, which is the vehicle for delivery of the foreign DNA into the recipient plastid genome, and then b) optimise tissue culture regimes to enable regeneration of GM plants containing the foreign DNA. The vector constructed (called pFavXG) comprised the xylose isomerase (xylA) gene, whose protein product allows metabolism of the carbohydrate xylose that is otherwise not utilisable by strawberry and the green fluorescent protein (GFP) gene, whose protein product fluoresces under UV illumination allowing visualisation of genetically modified tissues. These genes were joined by a linking DNA sequence (adaptor), surrounded by strawberry gene CSG 15 (Rev. 6/02) 1 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF regulatory sequences, that control when, and how stably the genes are expressed, and this resulting expression cassette in turn is surrounded by sequences isolated from the plastid genome, so-called ‘flanking sequences’. The flanking sequences direct integration of the expression cassette into the recipient plastid genome at a specific site by a process of homologous recombination, which occurs when like sequences come into close vicinity. In tissue culture, of the total 30 g/l carbohydrate supplied, a level of 96.6% xylose / 3.4% glucose in the regeneration growth medium was determined as optimal for minimising growth of nontransformed material and was used as the selection level in subsequent transformation experiments. Using biolistics to introduce plasmid pFavXG into target leaf material, five experiments, totalling 450 shot leaves, were carried out. A total of 110 putative GM lines were generated that were able to survive the optimised selection regime. Molecular analyses confirmed that two of the lines were plastid transformed. Additionally, GFP fluorescence was observed in plastids of a relatively small number of leaf cells in both lines. However, it was not possible to achieve pure stable lines through tissue culture, even with culture on 100% xylose. Lines maintained a very low transformed/non-transformed plastid genome ratio. Objective 2 Tissue culture of plastid transformed lines towards obtaining stable, homoplasmic lines for future inheritance studies The intention was to use a plastid transformed line with mixed populations of transformed and nontransformed plastid genomes, previously produced in MAFF project G01001. This line was to be tissue cultured in the presence of antibiotics to generate a pure, stable line in which all plastid genome copies were transformed. Progeny derived from this line crossed with a non-transformed plant as the other parent would subsequently be screened for presence of the foreign introduced genes to determine whether plastids were inherited from the maternal or paternal parent. However, attempts to achieve stability in the line, transformed with plasmid pSGA16, containing uidA (GUS) and aadA (confers resistance to spectinomycin and streptomycin) genes, were unsuccessful. After repeated cycles of tissue culture the line was unable to grow in the presence of the two antibiotics and the uidA and aadA genes were no longer detectable by PCR. Instability of the line was speculated to have been due to recombination between the rrn16 promoter sequence used to control expression of the aadA gene and the identical sequence found in the flanking plastid genome sequence. Eighteen further putative plastid transformed lines were generated from 297 leaves shot with plasmid pSGA2, which contains the aadA and uidA genes in the opposite orientation to their position in plasmid pSGA16, to circumvent problems with recombination between the two rrn16 gene promoters. Of these, one line was confirmed as being plastid transformed. This tested PCR-positive for the aadA and uidA genes and GUS protein was observed in plastids of a small proportion its leaf cells. However, attempts to increase the proportion of transformed plastid genomes through tissue culture with repeat cycles of shoot regeneration failed. Hence, using either vector it was not possible to generate stable plastid transformed lines using the aadA gene and selection with spectinomycin and streptomycin antibiotics. In the absence of pure, stable plastid transformed lines for use in studying plastid inheritance in strawberry, an alternative approach was devised using non-GM plants (Objectives 5 and 6). Objective 3 Production of strawberry nuclear transformed transgenic plants containing plasmid constructs with floral organ and root-specific promoters fused to the uidA (GUS) gene A total of 47 putative floral organ-specific (FavAP3) and 32 putative root-specific promoter (FavRB7) GUS fusion containing GM strawberry lines were generated. Control, transgenic lines were also produced that contained the GUS gene fused to a constitutive promoter (CaMV35S), which should be active in all tissues. Molecular analyses confirmed presence of the introduced foreign genes and promoters in all lines. Twenty two of the FavAP3 promoter-containing lines contained the introduced foreign DNA integrated at a single site within the plant nuclear genome. Whilst 15 lines contained integrations at two or three sites and two lines at four sites. Eight lines died prematurely, preventing complete analysis. Twenty of the FavRB7 promotercontaining lines contained single site integrations of the foreign DNA within the plant nuclear genome. Whilst nine lines contained integrations at two sites and one line each at four, five and seven sites. Two of the CaMV35S promoter lines contained single site insertions whilst a third line contained insertions at two sites. Objective 4 Analysis of promoter activity in flowering populations of the transgenic plants transformed with putative tissue-specific promoter constructs To determine whether the introduced FavAP3 and FavRB7 promoters could direct tissue-specific expression in the nuclear transformed GM lines, promoter activity was measured in a range of tissues. Since the promoters controlled expression of GUS, the level of promoter activity was extrapolated from GUS activity, measured using fluorimetric and histochemical assays. Twenty of the FavAP3 promoter lines, all FavRB7 promoter lines CSG 15 (Rev. 6/02) 2 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF and the three CaMV35S promoter lines were analysed for promoter activity. The CaMV35S promoter was shown to be active in all tissues, as expected. The FavAP3 promoter was similarly shown to be active in all tissues except roots, though the general level of activity was an order of magnitude less than the CaMV35S promoter. Therefore unpredictably, it was shown not to be floral tissue specific, but constitutive. Promoter activity in the FavRB7 promoter lines was observed almost exclusively in root tissue, with low-moderate activity in petioles and it could therefore be considered a near root-specific promoter. Objective 5 Identification of plastid genome sequence markers in strawberry parental genotypes using PCR-RFLP and PCR-SSCP To assist in plastid inheritance studies, it was necessary to firstly identify sequence differences/polymorphisms, termed markers, between the plastid genomes of different strawberry genotypes. Eight non-coding regions of the plastid genome within thirteen cultivated Fragaria ananassa and two wild, F. virginiana and F. chiloensis, strawberry genotypes were investigated for sequence variation. Isolation of the regions by PCR and comparison of sequences between genotypes revealed a total of seven markers, occurring within five non-coding intergenic regions. Six of the markers represented nucleotide substitutions and one as an insertion/deletion. Two of the markers were detected using polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP) and three by PCR-single strand conformation polymorphism (PCR-SSCP). Using these techniques to detect specific markers within their plastid genomes it was possible to differentiate between the strawberry genotypes. Distinction could be made not only at the interspecific level, between cultivated and wild genotypes, but also intraspecifically within cultivated genotypes. Objective 6 Determination of whether plastids are transmitted through pollen in strawberry using plastid genome sequence markers Five families totalling 648 progeny, in which markers distinguished the parents, were screened using either PCR-RFLP or PCR-SSCP to determine whether plastids were inherited from the male or female parent. Two offspring, one each from inter- and intra-specific controlled crosses, were shown to have exclusively inherited paternal plastids; all other progeny had exclusively inherited plastids from their maternal parent. It is concluded that plastids are not exclusively maternally inherited in strawberry and that the mode of inheritance, whether within cultivated genotypes or between cultivated and wild genotypes, can be bi-parental, albeit at low incidence. CSG 15 (Rev. 6/02) 3 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Scientific report (maximum 20 sides A4) 1. INTRODUCTION Plastid transformation enables targeting of foreign DNA to a precise region within the plastid genome. This is achieved since incorporation of foreign DNA carrying the genes of interest, into the plastid genome during transformation occurs via homologous recombination between sequences in the recipient plastid genome and the donor DNA in the plasmid vector used for transformation. Precise targeting precludes problems such as genetic instability and gene silencing, as sometimes observed with nuclear transformation, associated with random, multiple copy insertion of foreign DNA. A typical leaf mesophyll cell contains hundreds of plastids and these in turn can each contain hundreds of plastid genome copies (6). As a consequence, in a stably plastid transformed line, where all plastid genome copies are transformed, high, non-variable levels of foreign gene expression can be achieved. Biolistics is commonly used to introduce the donor DNA into target tissue. Introduced foreign DNA usually comprises the gene(s) of interest and a selectable marker gene, cloned between plastid gene promoter and terminator sequences, which together make up the expression cassette. This in turn is flanked by sequence from the target plastome, termed flanking sequence, which is involved in the homologous recombination process. The most routinely used selectable marker gene has been the aminoglycoside 3’adenyltransferase (aadA) gene (Svab and Maliga, 1993), which confers resistance to the antibiotics spectinomycin and streptomycin. Since there are multiple copies of the plastid genome within the cell, antibiotic selection is maintained post-bombardment throughout shoot regeneration to achieve selection and replication of transformed plastid genome copies and subsequent generation of uniformly transformed pure lines, termed homoplasmic lines (Maliga, 1993)). Lines containing mixed populations of transformed and nontransformed plastid genomes are termed heteroplasmic and are unstable. In higher plants, stable plastid transformation has successfully been accomplished in only tobacco (Svab et al., 1990), Arabidopsis thaliana (Sikdar et al., 1998), potato (Sidorov et al., 1999) and tomato (Ruf et al., 2001). Heteroplasmic lines have been produced in rice (Khan and Maliga, 1999), Lesquerella fendleri (Skarjinskaia et al. 2003) and oilseed rape (Hou et al., 2003). Selection systems based on carbohydrate metabolism have been developed for nuclear transformation. Examples are the use of phosphomannose isomerase or xylose isomerase genes, of bacterial origin, that have been used successfully to recover sugar beet, potato, tobacco and tomato nuclear transformed plants (Joersbo et al., 1998; Haldrup et al., 1998a,b). This study aimed to develop a xylose isomerase selection system for use in plastid transformation. Since the onset of this study, using tobacco, the species that has most routinely been plastid transformed, other methods have been developed for avoiding the presence of antibiotic resistance genes in the generated plant. These have either involved the excision of the antibiotic marker gene following insertion and primary selection, by using the Cre/lox recombinase system (Corneille et al., 2001; Hajdukiewicz et al., 2001) or by using short direct homologous DNA repeats to surround the aadA gene (Iamtham and Day, 2000), or by development of an alternative selection system using betaine aldehyde dehydrogenase (Daniell et al., 2001). It has been reported that in most angiosperm species, plastids are inherited maternally. The major impact of this is that where a species that exhibits maternal plastid inheritance is plastid transformed, foreign genes and their products would not be transmitted via pollen. Containment of transgenes by this means avoids potential introduction of new environmental allergens through pollen, deleterious effects on beneficial insect species and also foreign gene transfer by cross-pollination of non-GM crops and weedy relatives. However, large-scale investigations of plastid inheritance, have extrapolated the mode of inheritance from cytological studies using DNA staining and fluorescence microscopy to detect plastid DNA in generative or sperm cells (Corriveau and Coleman 1988; Zhang et al. 2003). The number of angiosperm genera for which mode of inheritance has been investigated in such studies is relatively few and the proportion characterised using more conclusive genetic studies, even smaller. Transmission of plastids during sexual reproduction can be investigated using plastid-transformed plants. Whereby progenies arising from controlled crosses, using a transformed plant as one of the parents, can be screened for the introduced foreign genes. Alternatively, plastid inheritance can also be studied using non-transformed plants and exploiting plastid genome DNA sequence polymorphisms (Chen et al. 2002; Panda et al., 2003). Techniques such as polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP)(Guillon and Raquin, 2000) and PCR-single strand conformation polymorphism (PCRSSCP)(Chen et al., 2002) have been used to detect sequence differences in plastid DNA between parents and CSG 15 (Rev. 6/02) 4 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF hence to determine contribution of plastids to the progenies. The former technique involves PCR of specific plastid genome regions, usually non-coding, and restriction enzyme digestion of the PCR products. Sequence differences can result in either loss or gain of a restriction enzyme recognition sequence, which results in different fragment lengths being produced upon digestion. The latter utilises PCR in a similar way, however the PCR products are denatured and the single strands electrophoresed on gels. Here as little as single base differences within the whole PCR strand can cause differences in mobility, which can be detected. This study aimed to use these techniques for detection of genetic differences to enable determination of how plastids are inherited in strawberry. Success would not only reveal the level of sequence conservation within regions of the strawberry plastid genome but it would also determine the merit of using plastid transformation in strawberry for containing foreign gene flow in pollen. Constitutive promoters, such as the CaMV 35S RNA promoter (Lawton et al., 1987), have been used extensively in GM plants. Their mode of action ensures foreign gene expression throughout the plant, which has raised concerns over potential harmful effects on non-target organisms. Revelations on the presence of recombinogenic hotspots within the CaMV 35S RNA promoter sequence (Kohli et al., 1999) have caused alarm as to the potential for viral recombination of foreign genes and spread to other species. In addition, it has been shown that transgenic plants susceptible to infection by cauliflower mosaic virus that carry the uidA (GUS) gene under the control of the CaMV 35S RNA promoter experience foreign gene silencing upon viral infection (Al-Kaff et al., 1998). These shortcomings highlight the necessity to isolate and use promoters of plant origin that target foreign gene expression to only those tissues where foreign gene products are required. Targeted foreign gene expression not only reduces unnecessary use of cellular resources in production of foreign proteins throughout the plant but it also targets expression of genes, for example those conferring pest and disease resistance, to specific tissues. This is likely to reduce the impact on non-target species. In this study, strawberry promoters were analysed, that could potentially target foreign gene expression to ephemeral floral tissue or to roots. Hence if proven tissue-specific, foreign gene expression would be absent in the consumed product, the fruit. This work was an extension of MAFF project G01001, in which plastid transformation was first demonstrated in strawberry and a heteroplasmic line, containing mixed populations of transformed and non-transformed plastid genomes, was generated. Putative floral organ and root-specific promoters were also isolated from strawberry in the same project. 2. PROJECT OBJECTIVES 1. Development of the xylose isomerase/xylose selection system for plastid transformation in strawberry 2. Tissue culture of plastid transformed lines towards obtaining stable, homoplasmic lines for future inheritance studies 3. Production of strawberry nuclear transformed transgenic plants containing plasmid constructs with floral organ and root-specific promoters fused to the uidA (GUS) gene 4. Analysis of promoter activity in flowering populations of the transgenic plants transformed with tissuespecific promoter constructs 5. Identification of plastid genome sequence markers in strawberry parental genotypes using PCR-RFLP and PCR-SSCP 6. Determination of whether plastids are transmitted through pollen in strawberry using plastid genome sequence markers 3. RESULTS AND DISCUSSION 3.1 Development of the xylose isomerase/xylose selection system for plastid transformation in strawberry (OBJECTIVE 1) In strawberry tissue culture, sucrose or glucose are commonly used as carbohydrate sources to sustain growth. To develop a plastid transformation system based on carbohydrate metabolism, the approach was to transform the plastids of strawberry with a plasmid vector containing the xylA gene that would allow GM cultures to regenerate on media containing xylose, which they would not ordinarily be able to utilise. The xylA gene product, xylose isomerase converts xylose to xylulose, which can be metabolised. The procedure required construction of a vector containing the xylA gene, in addition to a scorable marker gene that could be CSG 15 (1/00) 5 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF visualised within the plastid transformed plants, optimisation of the selection regime and plastid transformation using the vector to regenerate plastid transformed GM plants. Construction of vector pFavXG The majority of the individual components required to make up plasmid vector pFavXG (Fig. 1) for plastid transformation were isolated using PCR and primers (Appendix 1) used were designed to contain restriction enzyme recognition sequences to aid cloning. Sources of the genetic materials used were i) plasmid vector pBSplast4.5, generated in MAFF project G01001, containing a 4.5 kb fragment of the plastid genome from the 16S rRNA (rrn16) gene through to the ribosomal protein S7 (rps7) gene, ii) strawberry genomic DNA for the flanking sequence, the rrn16 promoter (P) and the photosystem II core protein (psbA) gene terminator (T) and iii) plasmids pVicxylAH (Haldrup et al., 1998) and psmGFP (Davis and Vierstra, 1998) for the xylA and GFP genes respectively. The RuBisCo large subunit (rbcL) gene 5’ untranslated region (UTR) and the adapter used to join the xylA and GFP genes were generated by designing synthetic oligonucleotides. Construction of the vector entailed PCR isolation of the rrn16 promoter (primers RRN16 KPNSGF and RRN16 SSP), psbA gene terminator (primers PSBABGL and PSBAECOSGF) and xylA (primers XYLAPAG1 and XYLAXHO1) and GFP genes (primers AADA/XYLA:SMGFP and SMGFP BGLAPA). The AADA/XYLA:SMGFP primer constituted the joining adapter sequence. The rbcL 5’UTR was generated by annealing oligonucleotides RBCLc and RBCLd and through a series of ligations and cloning steps all components were linked to produce the expression cassette. The final cloning step involved release of a 3.179 kb plastid genome fragment from pBSplast4.5 using restriction enzymes Stu I and Psi I, cloning the fragment into pBluescript and ligation of the expression cassette at a unique internal Bst 1107I site within the plastid genome fragment, which would serve as flanking sequence, to generate vector pFavXG (Fig. 1). Fig 1. pFavXG plastid transformation vector Transformation of vector pFavXG into E. coli and exposure to UV illumination resulted in fluorescence of the liquid suspension culture, whilst E. coli lacking the plasmid did not fluoresce (Fig. 2). Fluorescence was due to the presence of GFP, produced from the GFP gene in vector FavXG harboured by the bacteria. This confirmed that the vector was constructed correctly and that the plastid regulatory elements (rrn16 promoter, rbcL 5’UTR and psbA terminator), of prokaryotic origin, were functional and were recognised by the bacterial transcription/translation apparatus resulting in gene expression and protein production. Fig 2. GFP fluorescence in E. coli liquid culture harbouring vector pFavXG illuminated with UV light CONTROL pFavXG Determination of the optimal xylose levels as selection agent in plastid transformation The concentration of xylose to be used as selective agent for strawberry cultures transformed with vector pFavXG was determined empirically through a series of regeneration experiments using non-transformed tissue. These involved culture of 0.5 cm3 in vitro generated cut leaf pieces on ZN102 regeneration medium (Murashige and Skoog (MS) medium including vitamins, 1 mg/l TDZ, 0.2 mg/l NAA, solidified with 2.5 g/l Gelrite, at pH 5.7), supplemented with varying levels of xylose as a percentage of the total 30 g/l carbohydrate supplied. Glucose was used to make up the remaining carbohydrate. Initially, duplicate experiments were carried out where xylose percentages assessed were 100, 83, 66, 50, 34, 17 and 0% and cultures were grown under a 16 hr photoperiod at 22 ºC. The ability of 100 explants CSG 15 (1/00) 6 Tissue and plastid targeted transgene expression in a perennial crop, strawberry Project title DEFRA project code HH1031SSF cultured at each xylose concentration to produce callus and regenerate shoots was analysed. In these experiments culture with pure xylose was too stringent and callus and shoot production were both severely restricted. At all other concentrations of xylose there was variation between replicates and no correlation observed between percentage of xylose and ability to form callus and regenerate shoots. Additionally, shoot regeneration was generally high, which was likely due to residual photosynthetic capability of the cultures. The experiment was modified to include culture in the dark to circumvent this. The third experiment thus assessed growth of cultures in the dark with xylose at 100, 98.3, 96.6, 91.6, 83.3, 75, 66.6 and 0% in the regeneration medium (Fig. 3) Fig 3. Sensitivity of strawberry callus (white bars) and shoot (black bars) regeneration to D-xylose under dark growth conditions 100 % r e g e n e r a ti o n 90 80 70 60 50 40 30 20 100 100 9 8 .3 9 6 .6 98.3 96.6 0 0 8 3 .3 0 1 00 Plastid transformation of strawberry using vector pFavXG The BioRad Biolistic PDS-1000/He system particle gun was used to bombard five leaflets per Petri dish, either abaxial or adaxial side up, at 1100 psi with 0.6 µm gold particles coated with approximately 1.7 µg vector pFavXG. Prior to bombardment, leaves were cultured on ZN102 medium for one or two days and two distances of donor material from the firing platform were used. In one experiment, half the tissues were subjected to an osmotic treatment with mannitol to reduce the impact of the bombardment. Post bombardment leaf tissue was cut into 0.5 cm2 pieces and regenerated on ZN102 medium containing 96.6% xylose under low-level light. After six-weekly subculture on the same medium, regenerated shoots were removed from the original explant and transferred to SMI shoot proliferation medium (MS medium including vitamins, 0.224 mg/l BAP, 0.1 mg/l GA3, 0.104 mg/l IBA, solidified with 7.5 g/l Agar, at pH 5.7) containing 30 g/l xylose as the sole carbohydrate source. Cultures were maintained on this medium, with subculture at sixweekly intervals and cutting back the material to single crowns each round to encourage selection and replication of transformed plastid genomes. Five experiments were carried out as detailed in Table 1. Table 1 Summary of pFavXG plastid transformation experiments No. plates bombarded Preculture time FavXG 1 18 1d ZN102 FavXG 2 18 2d ZN102 FavXG 3 18 1d ZN102 Experiment number CSG 15 (1/00) Pre-culture medium Orientation and position of donor material Replicated either adaxial or abaxial side up, 7.5 cm or 11 cm below firing platform. Replicated either adaxial or abaxial side up, 7.5 cm or 11 cm below firing platform. Replicated either adaxial or 7 No. explants generated No. lines regenerated 540 55 540 7 540 10 5 9 6 .6 B N 2 2 0 5 Maximal callus production was only affected at xylose percentages greater that 96.6%, with ability to produce any shoots also affected at this concentration. Shoot regeneration was inversely proportional to the amount of xylose in the medium. However, only 40% shoot regeneration was observed when grown on pure glucose, which is in contrast to the 100% shoot regeneration routinely observed when cultures are grown on pure glucose in the light. On the basis of these results and also since shoots grown in the dark were etiolated and vitrified, it was decided to culture plastid transformation experiments under low level light (1-3 µmol m-2 s-1) and with 96.6 % xylose in the medium. N 2 9 8 .3 D - x y l o s e a s a p e r c e n t a g e o f t o ta l c a r b o h y d r a te s u p p li e d B N B N B 0 0 5 0 2 6 6 .6 2 0 2 2 N B N 2 0 2 75 B N 2 0 2 8 3 .3 B N 2 0 2 9 1 .6 B N 2 0 2 9 6 .6 B N B N B 9 8 .3 2 0 2 0 2 1 00 2 0 5 2 N B N 1 0 5 6 6 .6 Z N 1 0 5 75 Z N 1 0 5 9 1 .6 Z N 1 0 5 9 6 .6 Z Z N 1 0 5 0 5 1 Z Z 9 8 .3 N 1 0 5 100 D-xylose as percentage of total carbohydrate supplied N 1 0 2 N Z N 1 0 2 0 6 6 .6 66.6 Z N 1 75 75 Z N Z N Z 8 3 .3 83.8 1 0 2 2 0 2 9 1 .6 91.6 1 0 2 N 1 0 Z N 1 0 1 Z N Z Z N 1 0 2 0 2 10 91. Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code abaxial side up, 7.5 cm or 11 cm below firing platform. Replicated either adaxial or abaxial side up. All 11 cm below firing platform. FavXG 4 18 2d ZN102 FavXG 5 18 1d ZN102, half plates substituted with 0.2M mannitol All adaxial side up all 5 cm below firing platform. HH1031SSF 540 35 540 3 All 110 putative plastid transformed regenerated lines were screened for GFP fluorescence under UV illumination using a stereomicroscope. This level of screen was unreliable since background fluorescence was high in stressed or necrotic tissue. Therefore, all lines were analysed by PCR to determine whether they contained the inserted foreign genes. Analyses confirmed the presence of the xylA gene and its linkage to the GFP gene in only two of these lines. Far more non-transformed lines survived selection than were anticipated from the results of the xylose sensitivity experiments carried out on non-transformed material. The two PCRpositive lines, named Sx1 and Sx2, originated from experiment FavXG1 and grew well on pure xylose (Fig. 4A). PCR carried out to span the plastome insertion site revealed that a very high proportion of nontransformed plastomes remained in these lines and a fragment indicating the transformed plastomes could not be detected under the conditions used. However, using high power microscopy, it was possible to confirm presence of the foreign genes in the plastome since GFP fluorescence could be detected in plastids of some cells of both lines. An example is shown for line Sx2 in Fig. 4B. Fig 4. (A) Plastid transformed Sx1 and Sx2 lines on SMI shoot proliferation medium containing 100% xylose as the carbohydrate source. (B) Bright field (1), autofluorescence (2), UV GFP (3) and GFP fluorescence (4) filter set images of leaf cells of line Sx2, obtained using a Zeiss Axiophot microscope equipped with Neofluar lenses A B Sx1 SX1 Line Sx2 Sx2 SX2 1 2 3 4 Red autofluorescence of plastids was observed in all cells, whilst generally GFP fluorescence in plastids was observed in a relatively very small proportion of cells. This indicated that although, plastid transformed, the level of transformed plastid genomes was very low in each line, which confirmed the PCR data. Repeated cycles of tissue culture on SMI medium containing 100% xylose did not increase the extent to which the cultures were transformed. Attempts to regenerate callus and shoots from transformed cells in leaves of these primary transformants cultured on ZN102 medium containing xylose were also unsuccessful. The persistence of heteroplasmic lines could have been due to poor selection pressure. Whereby perhaps either the xylose was being broken down over the course of tissue culture into metabolites that could sustain growth or strawberry may potentially have an endogenous xylose isomerase activity. In fact, a xylose isomerase gene has been isolated from barley (Kristo et al., 1996) and there have been reports of other plant species expressing the enzyme weakly (Haldrup et al., 1998a,b). A similar vector to pFavXG was made, pNtXG, in which the strawberry flanking sequences were substituted for the corresponding sequences from the tobacco plastid genome. Similar to the pFavXG vector, when transformed in E. coli, pNtXG worked efficiently and large amounts of GFP protein were produced. However, plastid transformed plants were not generated when this vector was used to plastid transform tobacco. A recent report by Magee et al. (2004), which shows that expression levels from plastid transformation vectors in E. coli may not be reflected in vivo in the plant, may be of significance to this study. In strawberry (and tobacco), expression of the xylA gene may CSG 15 (1/00) 8 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF have been low, which in addition to the postulated afore mentioned contributory factors, could have caused the problems in achieving homoplasmy. Conclusion The plastid transformation system developed, based on xylose selection, was inefficient since only two plastidtransformed lines were generated from 450 shot leaves and selection regimes were unable to produce pure lines where all plastid genomes were transformed. 3.2 Tissue culture of plastid transformed lines towards obtaining stable, homoplasmic lines for future inheritance studies (OBJECTIVE 2) The aim of this objective was to produce a pure plastid transformed strawberry line, through tissue culture, that could subsequently be used to determine the mode of plastid inheritance in strawberry. Presence of foreign genes within plant plastids would facilitate inheritance studies since they would provide a means of distinguishing between plastids of plant parents that could be used in a controlled cross. Progeny raised from a cross between plastid transformed and non-transformed parents could easily be screened for presence of the foreign genes and the parent responsible for transmitting plastids determined. It was intended to use a plastid-transformed line previously generated in MAFF project G01001, that was transformed with vector pSGA16 (Fig. 5) that in addition to the uidA gene, contained the aadA gene. Less than 5% of the plastid genome copies within this line were transformed (as indicated by Southern analysis) and tissue culture regimes were carried out over a period of two years, to try to increase these levels so that all copies were transformed. Whether shoot proliferation cultures were maintained on media containing 500 mg/l spectinomycin, on more stringent selection of 1000 mg/l spectinomycin, or on a mixture of 200 mg/l spectinomycin and 200 mg/l streptomycin, over the course of time, the foreign genes were no longer detectable and all clones subsequently produced bleached leaves. This was indicative that they were no longer resistant to the antibiotics and hence confirmed that they did not contain the aadA gene that afforded the protection. Attempts to initiate shoot proliferating cultures from meristems isolated from shoot tips of earlier clones that had been proven to contain the foreign genes by PCR failed, as did regeneration of new shoot cultures from leaves of confirmed transformed clones. It was postulated that loss of the foreign genes was due to recombination between the rrn16 gene promoter used to control expression of the aadA gene in the transformation vector and the same promoter, controlling the 16S gene, nearby in the flanking sequence surrounding the insertion site. This would cause excision of the aadA gene and eventual loss of the uidA gene since it would no longer be under selective pressure. It was decided to initiate new transformations to obtain a stable, pure plastid transformed line. These utilised vector pSGA2 (Fig. 5), which contained the expression cassette in opposing orientation to the one in pSGA16, to circumvent problems with recombination between the two rrn16 promoters. Fig 5. pSGA16 and pSGA2 plastid transformation vectors. Strawberry flanking sequences are shown as black boxes. P and T denote promoters and terminators respectively. Arrows show the direction of the rrn16 promoters within the expression cassettes and flanking sequences pSGA16 16S /trnV TrbcL aadA Prrn16 TpsbA uidA PpsbA 3’rps12 / rps7 16S /trnV PpsbA uidA aadA TrbcL 3’rps12 / rps7 pSGA2 TpsbA Prrn16 A total of 297 leaves were bombarded with vector pSGA2 and after culture on ZN102 regeneration medium containing 20 mg/l spectinomycin, for six subculture rounds of six weeks each, eighteen putative plastid transformed shoots were regenerated. These original regenerated lines were called the RI generation. Sixteen of these shoots were PCR-negative for the foreign genes and were presumed spectinomycin resistant mutants. Shoot proliferation cultures, on SMI media containing 50 mg/l spectinomycin, were initiated from the two RI generation shoots in which the uidA and aadA genes could be detected by PCR. One line, named CSG 15 (1/00) 9 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF P6d, only produced bleached shoots, which were PCR-negative for the foreign genes. It is likely that the PCR result for the original regenerated shoot was a false positive, resulting from cross-contamination. The second transformed lined, named P18b, grew well and produced green shoots when cultured on SMI shoot proliferation media with spectinomycin levels increased to 1000 mg/l. Leaves were taken from this RI regenerant and cultured on ZN102 regeneration medium containing 500 mg/l spectinomycin to produce new shoots, which were termed the RII generation. This procedure of regenerating shoots and taking leaves from these to regenerate new shoots was continued until the RVI generation was produced, which took approximately 18 months. This was carried out to encourage selective shoot regeneration from cells of a leaf containing transformed plastid genomes to enable enrichment of the transformed plastid genomes in the cultures and subsequent generation of a pure line. All cultures generated were clones of the original P18b line. Shoot proliferation cultures were initiated from clones of each generation and maintained on SMI medium containing 1000 mg/l spectinomycin. Selected clones from the generations were confirmed PCR positive for the aadA and uidA genes. Resistance to spectinomycin in these clones was proved to be due to the presence of the aadA gene since green shoots regenerated on ZN102 medium containing 200 mg/l of both spectinomycin and streptomycin. Regeneration of bleached shoots would have indicated that shoots were spectinomycin resistant mutants. Leaves of these clones were subjected to GUS histochemical assay, by incubation in 5-bromo-4-chloro-3-indolyl--D-glucuronic acid (X-Gluc) substrate at 37˚C overnight, to detect presence of GUS protein. GUS expression in a leaf of one of the clones of line P18b is shown in Fig. 6. Of 27 leaves screened from this clone, this was the leaf in which highest GUS expression was observed. Fig 6. GUS expression observed in leaves of an RVI regenerant of plastid-transformed line P18b. Tissue was incubated in XGluc substrate and chlorophyll cleared by washing in 70% ethanol. (A) Whole leaf viewed under the stereomicroscope at 10X magnification and (B) High power magnification (400X) of mesophyll cells in an unsectioned leaf A B A Though all of the original 18 putative plastid-transformed lines were screened by GUS histochemical assay, line P18b was the only one to exhibit GUS staining. GUS expression was still maintained in the RVI generation after 18 months in tissue culture. However, expression was not always detected in all leaves of a clone and where it was detected, it was not present throughout the leaf. Comparison of expression in RIII through to RVI regenerants did not reveal an increase in the extent of GUS expression in the tissues. This suggested that the proportion of transformed plastomes was not being increased with each repeat regeneration cycle. Even though the line was repeat regenerated through to the sixth generation, it was hence not possible to generate a stable, pure line. The level of selection used here was higher than has been used in plastid transformation of other species, which range between 40 – 500 mg/ml spectinomycin (Svab et al., 1990; Sikdar et al., 1998; Sidorov et al., 1999; Ruf et al., 2001). Positive selection, using aadA may provide cross protection to non-transformed plastid genomes in a heteroplasmic population, thus reducing the selection stringency and slowing progression towards homoplasmy (Dix and Kavanagh, 1995). It is worth noting that achieving homoplasmy in plastid transformed tomato using the aadA gene and spectinomycin selection took almost two years (Ruf et al., 2001) and in rice and oilseed rape, it was not possible to achieve homoplasmic lines (Hou et al., 2003; Khan and Maliga, 1999). Therefore, the results reported here for strawberry are not without precedent. CSG 15 (1/00) 10 Tissue and plastid targeted transgene expression in a perennial crop, strawberry Project title DEFRA project code HH1031SSF Conclusion Attempts to generate a stable plastid transformed line with all copies of its plastid genome transformed, through tissue culture with antibiotic selection, were unsuccessful. Consequently, in the absence of a stable pure plastid transformed line for use in inheritance studies, it was necessary to adopt an alternative approach to study plastid inheritance in strawberry. This is covered in sections 3.5 and 3.6 3.3 Production of strawberry nuclear transformed transgenic plants containing plasmid constructs with floral organ and root-specific promoters fused to the uidA (GUS) gene (OBJECTIVE 3) The aim of this objective was to generate transgenic strawberry plants containing putative strawberry floral organ (FavAP3) and root-specific (FavRB7) promoters fused to the uidA (GUS) gene. Subsequent analysis of these plants, for distribution of GUS expression, would determine the extent to which the promoters were able to direct tissue specific expression. Nuclear transformation of strawberry with promoter-GUS fusion constructs Vectors pSCVFavAP3 and pSCVFavRB7, in addition to pSCV1.6 that contains the constitutive CaMV 35S promoter used as a control (Fig. 7), were transformed into Agrobacterium tumefaciens strain EHA 101. Fig 7. Schematics of promoter-GUS fusion vectors used in strawberry nuclear transformation. (A) pSCVFavAP3, containing the FavAP3 promoter (FavAP3 P), (B) pSCVFavRB7, containing the FavRB7 promoter (FavRB7 P) and (C) pSCV1.6, containing the CaMV 35S constitutive promoter (35S P). T represents the terminator regions, RB and LB, right and left borders respectively and the intron within the uidA gene is chequered. OD represents an overdrive T-DNA enhancer and a scale size bar is given. A B LB LB FavAP3 P FavRB7 P LB 35S P uidA 35S T 35S P uidA 35S T 35S P uidA 35S T 35S P npt II nos T RB npt II nos T RB npt II nos T RB C OD OD OD 1 kb To achieve nuclear transformation, the transformed Agrobacteria were used to infect strawberry leaf discs in two experiments. Experiment 1 involved transformation of Fragaria vesca with pSCVFavAP3 and regeneration of transformed shoots on ZD102 medium (MS including vitamins, 30 g/l sucrose, 1 mg/l TDZ, 0.2 mg/l 2,4-D, solidified with 7.5 g/l Oxoid Agar No. 3, pH 5.7) containing 25 mg/l kanamycin. Experiment 2 involved transformation of F. ananassa cv Calypso with pSCVRB7 and regeneration of transformed shoots on ZN102 medium containing 50 mg/l kanamycin. Controls were included in both experiments, where discs were transformed with pSCV1.6 and transformed shoots recovered on selective medium and non-transformed shoots recovered on medium lacking kanamycin. All shoots surviving selection and negative controls were weaned onto soil and all established plants were phenotypically normal. Molecular analysis of transgenic lines PCR to detect the promoter, uidA and nptII genes confirmed presence of all three in all transformed lines and a total of 47 FavAP3, 32 FavRB7 and 3 CaMV35S promoter transgenic lines were generated. pSCV1.6 3 and pSCV1.6 D CaMV35S promoter lines were generated in experiment 1 and the pSCV1.6 CaMV35S promoter line generated in experiment 2. The foreign genes were not detected in the three negative control lines generated for each experiment. Southern analysis was carried out on all lines to determine the number of foreign gene integration sites. Genomic DNA extracted from leaf tissue of each line was digested with Kpn I, to determine integration of uidA and nptII genes in FavAP3 and CaMV 35S promoter lines. DNA was digested with Kpn I and Sma I to determine integration of nptII and uidA genes respectively, in FavRB7 promoter lines. Digestion products were electrophoresed on agarose gels, transferred to nylon membranes and probed with nptII and uidA-specific Digoxigenin-11-dUTP (DIG)-labelled probes. Southern data obtained for those plants taken forward for promoter activity studies are shown in Table 2. CSG 15 (1/00) 11 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Table 2 Summary of foreign gene integration sites in promoter-GUS fusion transgenic lines FavAP3 promoter line Fav 5A Fav 5D Fav 9 Fav 15B Fav 16 Fav 23 Fav 40 Fav 41 Fav 42A Fav 47A Fav 48C Fav 70 Fav 75B Fav76F Fav 82C Fav 86 Fav 94A Fav 95A Fav 115 Fav 168 CaMV35S promoter line pSCV1.6 3 pSCV1.6 D uidA nptII 1 3 4 1 2 1 2 3 1 1 1 3 1 1 3 1 1 1 1 2 1 2 2 1 2 1 2 3 1 1 1 2 1 1 3 1 1 1 1 2 uidA nptII 1 1 1 2 FavRB7 promoter line 1 5b 5c 6 13 14 37 38 39 41 42 43 44 46 48 49 53a 53b 55 58b CaMV35S promoter line PSCV1.6 uidA nptII 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 4 3 1 1 2 2 1 1 1 1 1 1 1 7 2 1 1 1 2 1 5 4 2 2 uidA nptII 1 2 FavRB7 promoter line 61 64 65 66 67 71 72 75 76 77 78 102 uidA nptII 1 1 1 1 2 1 2 1 1 1 2 2 1 1 1 1 1 1 2 1 1 1 2 2 The majority of the transgenic lines contained simple integrations at one or two sites. In some lines, integrations were more complex with incomplete integration of the T-DNA region of the vector as indicated by unequal integrations of uidA and nptII genes. However, good populations of FavAP3 and FavRB7 promotercontaining lines were generated for further analysis. 3.4 Analysis of promoter activity in flowering populations of transgenic plants transformed with tissuespecific promoter constructs (OBJECTIVE 4) Assessment of GUS activity as a measure of promoter activity in different tissues of transgenic plants Since the promoters regulate expression of the uidA gene to produce GUS enzyme, promoter activity was extrapolated from the amount of GUS enzyme activity in different tissues of the transgenic plants. GUS enzyme activity was assessed quantitatively by fluorometric assay, which measures the amount of 4methylumbelliferone (4-MU) fluorescent product produced as a result of cleavage of methylumbelliferyl glucuronide (MUG) substrate by GUS enzyme. Fluorometric assays to detect GUS activity (Jefferson, 1987), were carried out as described in Gittins et al. (2000), with the modifications that 10 mM -mercaptoethanol and 20% (v/v) methanol were added to the extraction buffer. One plant of each line generated in experiment 1 was sampled for analysis. Duplicate plants were generated, from runner populations, for each line generated in experiment 2 and both were sampled for analysis. From each line, for each tissue type, material was taken from six individual organs or was dissected from six individual flowers, ground under liquid nitrogen and 10 – 100 mg used per assay. Fluorescence was quantified using a FLUOstar Galaxy multiwell plate reader with excitation and emission filters set at 360 nm and 460 nm respectively. Protein concentrations were determined by BioRad assay and GUS specific activity expressed as pmol 4-MU produced per mg total soluble protein per minute. Analysis of GUS activity in 12 different vegetative and floral tissue types of the lines generated in experiment 1 revealed that both FavAP3 and CaMV35S promoters exhibited constitutive expression; no activity was detected in the negative control lines as expected. In the CaMV35S promoter lines, average GUS activities for each tissue type were 140,374 (leaves), 84,912 (petioles), 10,375 (roots), 95,514 (pedicels and peduncles), 45,861 (floral buds), 88,608 (sepals), 42,151 (petals), 28,110 (stamens), 30,274 (carpels), 6,411 (receptacles), 15,399 (green fruit) and 15,726 (red fruit) pmol 4-MU per mg protein per minute. Though variation in the level of activity was observed between tissues, the CaMV35S promoter exhibited strong, constitutive expression. The constitutive nature of the FavAP3 promoter is illustrated in Fig. 8, which shows a CSG 15 (1/00) 12 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Box-and-Whisker plot of GUS specific activity data, grouped by tissue type, obtained from the 20 independent FavAP3 promoter transgenic lines. Fig 8. GUS specific activity data, from different tissue types of 20 independent FavAP3 promoter transgenics, represented by Box-and-Whisker plot. Tissues tested were Le, leaves; Pt, petioles; Ro, roots; P/P, pedicels and peduncles; B, floral buds; Se, sepals; Pe, petals; St, stamen; Ca, carpels; Re, receptacles Gf, green fruit and Rf, red fruit. All 20 lines are represented by the data for each tissue type except red fruit, where fruit from only 14 lines were analysed. The box spans the interquartile range of the GUS activity values, the horizontal line indicates the median and the whiskers extend to the minimum and maximum values. Outliers are plotted with a closed circle with the representing individual transgenic line numbers indicated, whilst far-outliers are plotted with a closed triangle. 20000 FavAP3P pmol 4-MU (mg protein)-1 min-1 17500 15000 12500 5D 168 115 76F 5D 10000 76F 7500 5000 2500 5D 5D 15B 5D 23 5A 0 Le Pt R P/P B Se Pe St Ca Re Gf Rf Highest GUS activity, and hence FavAP3 promoter activity, was observed in petals and carpels, with relatively moderate activity in green fruit, floral buds and receptacles and lower but considerable activity in leaves, sepals, pedicels and peduncles. Activity in petioles, stamens and red fruit was relatively weak and the lowest activity was observed in roots. Promoter activity in lines Fav 9, Fav 16 and Fav 95A was negligible in all tissues. Generally, the FavAP3 gene promoter was found weaker, by approximately one order of magnitude, than the CaMV 35S RNA promoter. Additionally, RT-PCR was carried out to detect presence of FavAP3 mRNA transcripts in the different tissues, which would give an indication of endogenous FavAP3 gene promoter activity. Transcripts were detected in all tissues. FavAP3 is a homologue of the Arabidopsis gene AP3, a floral organ homeotic gene that is specifically expressed in petals and stamens (Jack et al., 1994). Unlike AP3 and homologues from other species that exhibit similar floral organ specificity (Irish, 2003), FavAP3 is expressed in all tissues and may have an additional role(s) to determining floral organ identity in strawberry. GUS specific activity in leaf, whole flowers, petioles and roots of lines generated in experiment 2 were analysed and results are represented graphically in Fig. 9. Fig 9. GUS specific activity in different tissues of FavRB7 and CaMV35S promoter transgenics. CSG 15 (1/00) 13 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF pmol 4-MU -1 -1 mg protein min 160 000 140 000 120 000 100 000 80 000 60 000 40 000 20 000 0 35S - 71 66 75 6 5 102 49 72 53b 67 39 5c 44 13 46 48 61 37 76 58b 6 14 64 4 2 5b 78 1 41 38 4 3 77 53 a 5 5 leaf root petiole flowers Line GUS was shown to be constitutively expressed in the CaMV35S promoter line (35S) whilst in the FavRB7 promoter lines (represented by numbers), expression was predominantly in roots. In many lines, the FavRB7 promoter was stronger in root tissue than the CaMV35S promoter. Using median GUS specific activity values from the 32 FavRB7 promoter lines analysed, root:petiole, root:leaf and root:floral ratios were 1:0.3, 1:0.04 and 1:0.009 respectively. GUS activity was also analysed in mature fruit of FavRB7 promoter lines and it was shown to be negligible. FavRB7 is a homologue of the tobacco gene TobRB7, which is a root-specific tonoplast intrinsic protein that similarly exhibits root-specific expression in tobacco (Conkling et al., 1990; Yamamoto et al., 1990). Worthy of mention in this report is the finding, in parallel research to this study, that the strawberry FavRB7 promoter was constitutive when transformed into tobacco and used to drive expression of GUS. This suggests that there are nuclear factors present in strawberry that are involved in the regulation of root-specific promoter activity which are absent in tobacco. This highlights the importance of not making assumptions that promoters will behave in heterologous species as they do in the species from which they are isolated. Tissue samples from negative control and FavAP3, FavRB7 and CaMV35S promoter strawberry lines were also subjected to qualitative GUS histochemical analysis. Whereby tissues were incubated in X-Gluc substrate, which is converted to a blue product by GUS activity. Observations of blue staining in tissues, which represented GUS activity and hence promoter activity, reflected the data obtained from GUS fluorometric analysis. Detection of GUS mRNA by reverse transcription-polymerase chain reaction (RT-PCR) as an indication of promoter activity Non-quantitative RT-PCR was carried out to detect presence of nptII and uidA mRNA in different tissues of six FavAP3 and FavRB7 promoter transgenic lines containing single integrations of the foreign DNA. CaMV35S promoter and negative control lines were also analysed. Presence of transcripts are an indicator of promoter activity. Total RNA was extracted from each tissue type using an RNeasy® Plant Mini kit (Qiagen), from which mRNA was extracted using an OligotexTM mRNA kit (Qiagen). The mRNA was reverse transcribed to cDNA using an oligo(dT)22 primer with OmniscriptTM reverse transcriptase (Qiagen). Using the cDNA as template multiplex PCR was carried out using Taq DNA polymerase (Invitrogen) with Npt II A/Npt II B and Gus 27/Gus 392 primer pairs (Appendix 1). Amplification products were electrophoresed on 0.8% (w/v) agarose gels and visualised by UV illumination after staining with ethidium bromide. Messenger RNA transcripts for both genes were detected in all tissues of CaMV35S promoter transgenic lines, where both genes were controlled by the constitutive CaMV35S promoter and were absent from the negative control lines. Npt II and uidA mRNAs were detected in all tissues of the FavAP3 promoter lines tested (Fig. 10). Fig 10. Detection of npt II (700 bp) and uidA (366 bp) partial cDNAs in different tissues of a representative FavAP3 promoter transgenic line, line Fav76F. The upper and lower fragments (arrowed) represent npt II and uidA respectively. Tissues tested are Le, leaves; Pt, petioles; Ro, roots; P/P, pedicels and peduncles; Gf, green fruit; Rf, red fruit; B, floral buds; Se, sepals; Pe, petals; St, stamen; Ca, carpels and Re, receptacles. H, depicts water negative control, P, plasmid pSCV1.6 positive control and M, molecular size standards. CSG 15 (1/00) 14 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry Le Pt Ro P/P Gf Rf B Se Pe St Ca Re H DEFRA project code HH1031SSF P M kb - 0.85 - 0.65 - 0.5 - 0.4 Fav76f F In FavAP3 promoter lines the npt II gene is controlled by the constitutive CaMV35S promoter and the uidA gene by the FavAP3 promoter. Detection of mRNA for the uidA gene in all tissues indicated that the promoter was active in all tissues, which corroborated the GUS activity data. In the FavRB7 promoter lines, npt II was detected in all tissues, whilst uidA was shown to be present in only root and petiole tissues. This was also as expected from the biochemical data. Conclusion Biochemical and molecular analyses of strawberry transgenic lines containing FavAP3 promoter::uidA and FavRB7 promoter::uidA constructs show that the FavAP3 promoter is a constitutive, weak-moderate promoter and that the FavRB7 promoter is a moderate-strong promoter exhibiting near root-specific regulation. 3.5 Identification of plastid genome sequence markers in strawberry parental genotypes using PCRRFLP and PCR-SSCP (OBJECTIVE 5) The aim of this objective was to determine whether there were any sequence differences, known as polymorphisms, within specific regions of the plastid genomes of different octoploid strawberry genotypes and to use PCR-RFLP and PCR-SSCP analyses to detect these. This would enable differentiation between the different genotypes on the basis of their plastid genomes, which could be exploited subsequently for determination of the mode of plastid inheritance in strawberry. The fifteen strawberry genotypes analysed included 10 Fragaria ananassa cultivars, three F. ananassa breeding lines and two wild accessions are shown in Table 3. The 13 cultivated genotypes were selected due to their diverse genetic backgrounds. Table 3 Octoploid strawberry genotypes screened for plastid genome sequence polymorphisms Reference number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Genotype F. ananassa cv. Alice F. ananassa cv. Bolero F. ananassa cv. Ciflorette F. ananassa cv. Diamante F. ananassa cv. Everest F. ananassa cv. Florence F. ananassa cv. Mara Des Bois F. ananassa cv. Nida F. ananassa cv. Onda F. ananassa cv. Symphony F. ananassa breeding line EM0965 F. ananassa breeding line EM0980 F. ananassa breeding line EMR154 F. chiloensis F. virginiana Isolation of plastid genome regions and detection of sequence polymorphisms Eight plastid genome non-coding regions were targeted and amplified from each genotype using PCR. Intergenic and intron regions were chosen since these are under less evolutionary constraint than gene coding sequences and were thus more likely to have incurred sequence changes. Sequences of newly synthesised primers are listed in Appendix 1 or where published primers were used, references are cited. Total genomic DNA was extracted from young leaf tissue and used as template in PCR reactions using KOD HotStart DNA polymerase. Primers used to amplify trnT – trnL (5GR/5GF) and trnL – trnF (6IR/6IF) intergenic regions and the trnL intron (5HF/5HR) were as designed by Taberlet et al. (1991). To amplify trnH – CSG 15 (1/00) 15 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF psbA (2CF/2CR), trnS – trnG (3DF/3DR) and rpl20 – 5’rps12 (7JF/7JR) intergenic regions primers were as designed by Hamilton (1999), with the exception of the primer designed to anneal in the psbA gene. Due to sequence divergence between strawberry and tobacco psbA gene sequences, the psbA (2CR) primer was redesigned. Primers 1AF/1AR and 3EF/3ER were newly designed to amplify rpl2 and trnG introns respectively. To obtain sequence information for a proportion of the amplified fragments, selected PCR products were cloned into the plasmid pCR®-Blunt II-TOPO and sequenced using dye-terminator cycle sequencing. Sequencing of fragments representing each region, from a random selection of eight genotypes for each, indicated that no sequence polymorphisms were present within trnG, rpl2 and trnL gene introns, of lengths 764, 757 and 494 bp respectively. For each trnH – psbA and trnS – trnG intergenic regions, of lengths 350 bp and 680 bp respectively, a single nucleotide insertion/deletion (IN/DEL) was observed in one of the eight genotypes studied. These polymorphisms were not investigated further. Five polymorphic loci, nominated marker one through to marker five, that could be exploited in PCR-RFLP and PCR-SSCP analyses, were shown to be present within the three remaining intergenic regions (Fig. 11). Fig 11. Schematic representation of PCR-amplified plastid genome regions characterised for polymorphisms. A, B and C represent the three different regions studied. Horizontal lines depict intergenic regions where the nucleotide sequence is identical in all genotypes and surrounding genes are illustrated by hatched boxes. Sites within the intergenic region displaying polymorphism are indicated in their relative positions as markers (M), with the sequence differences observed at these positions shown. Primers used to amplify specific fragments are represented by arrows. PCR fragments are shown as dashed lines and lengths indicated. A 5GF G179F 1005 bp 181 bp G179R M1 trnT M2 A/C A/C trnL C B 6IF 5GR 498 bp 6IR 7JF 837 bp M3 trnL 7JR J2XF 180 bp J2XR M4 M5 C/T trnF A/T A8/A9 rpl20 5’rps12 Markers one and two, within the trnT – trnL intergenic region at 179 and 423 bp from the 5’ end of the PCR fragment respectively, were both shown to be nucleotide substitutions. At marker one, genotypes Bolero, Florence, Nida, Symphony and EM0980 are represented by an A, whist all other genotypes by a C. At marker two, Bolero, Florence, Nida, Symphony, EM0980 and EM0965 genotypes have an A, whilst all others have a C. When an A is present, a Psi I restriction enzyme recognition sequence is created, allowing distinction of marker two by RFLP analysis. Marker three, a nucleotide substitution within the trnL – trnF region at 423 bp from the 5’ end of the PCR fragment, similarly enables detection by RFLP. Presence of a C, as seen with Bolero, Florence, Nida, Symphony, EM0980 and EM0965, creates an EclHK I recognition sequence and when a T is present, as with the remaining genotypes, a Bse GI recognition sequence is created. Within the rpl20 – 5’rps12 region markers four and five, at loci 551 bp and starting at 552 bp from the 5’ end of the fragment respectively, were shown not to result in creation or destruction of a restriction enzyme recognition sequence, and like marker one, could be exploited by SSCP analysis. At the marker four locus Alice, Ciflorette, Diamante, Everest, Mara Des Bois, Onda and EMR154 are represented by a T whilst all other genotypes have an A. The marker five locus consists of an IN/DEL where F. chiloensis has a run of nine As, whilst all other genotypes have a run of eight. Detection of plastid genome sequence polymorphisms using PCR-RFLP PCR products from each genotype, representing trnT --- trnL and trnL --- trnF intergenic regions, were digested at 37 ˚C for 20 hours with Psi I and EclHK I restriction enzymes respectively. Restriction fragments CSG 15 (1/00) 16 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF were separated on 1.5 % (w/v) agarose gels and stained with ethidium bromide. The results of the PCR-RFLP analysis are shown in Figure 12. Fig 12. PCR-RFLP analysis of octoploid strawberry genotypes. Genotypes are numbered according to the key shown in Table 3. Restriction fragment analysis of PCR amplified trnT --- trnL and trnL --- trnF intergenic regions from each genotype, containing markers M2 and M3 respectiviely and digested with restriction enzymes Psi I and EclHK I respectively. Markers are shown with surrounding sequence. Marker M2: TTA/CTAA 1 2 3 4 5 6 7 8 9101112131415 Marker M3: GAC/TGGTGCGTC M bp 1 2 3 4 5 6 7 8 9 101112131415 M bp 850 650 500 400 300 200 850 650 500 400 300 200 100 Using PCR-RFLP, it was possible to detect each marker. All genotypes contain a Psi I recognition sequence located 276 bp from the 3’ end of the trnT – trnL fragment. For detection of marker 2, in genotypes where there was an A at the locus, the fragment was further cleaved by Psi I to produce three fragments in total. For detection of marker 3, the trnL – trnF fragment was cleaved by EclHK I to liberate two fragments only in those genotypes that possessed a C at the locus; those with a T remained uncut. The trnL – trnF fragments were also digested with restriction enzyme Bse GI and the opposite results were observed for detection of marker 3. Detection of plastid genome sequence polymorphisms using PCR_SSCP Since resolution of single nucleotide differences by PCR-SSCP is more optimal when shorter PCR products are analysed, PCR fragments of 181 bp and 180 bp were generated within the trnT --- trnL and rpl20 --- 5’ rps12 intergenic regions respectively. Primers designed and used to amplify an internal fragment of each region were G179F/G179R and J2XF/J2XR respectively (Fig. 11, Appendix 1). PCR products from each region for each genotype were denatured in denaturation solution (deionised formamide containing 1 M NaOH and a few grains bromophenol blue). The sample mixture was heated at 95 ˚C for 5 min and immediately placed on ice for 3 min. Gel electrophoresis of samples was carried out on Gene Mutation Analysis (GMA TM) gels (Elchrom Scientific). Different temperatures, voltages and run times were tested to achieve optimal resolution of DNA sequence polymorphisms. For optimal separation, electrophoresis was carried out at 72V at 7 ˚C for 12 hours using Elchrom’s SEA 2000® gel apparatus. Post-electrophoresis, gels were stained with SYBR® Gold (Molecular Probes Inc.). The results of the PCR-SSCP analysis are shown in Figure 13. Fig 13. PCR-SSCP analysis of octoploid strawberry genotypes. Genotypes are numbered according to the key shown in Table 3. SSCP analysis of trnT --- trnL intergenic region, containing marker M1, and rpl20 --- 5’ rps12 intergenic region, containing markers M4 and M5, PCR amplified fragments from each genotype, denatured and electrophoresed on GMA TM gels. Markers are shown with surrounding sequence. Marker M1: AATA/CTCA 1 2 3 4 5 6 7 8 9 10 1112131415 Markers M4 & M5: TTTA/TA8/A9TTTC 1 2 3 4 5 6 7 8 9 101112131415 Following optimisation of the electrophoresis conditions, it was possible to reproducibly resolve differences in single-stranded DNA of the fragments according to nucleotide composition at each marker. Marker one was shown to give rise to two different SSCP profiles, determined by whether genotypes harboured an A or C at position 179. Three different profiles were observed for genotypes for the rpl20 – 5’rps12 region that contains two markers. All cultivated genotypes and the wild accession F. chiloensis exhibited profiles according to whether marker 4 is an A or T. The profile for the wild accession F. virginiana differed further since at marker 5 it contains an extra A compared to all the other genotypes. Both PCR-RFLP and PCR-SSCP analyses enabled sequence attributes at each marker to be distinguished and each also confirmed the sequence data. CSG 15 (1/00) 17 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Conclusion Seven sequence polymorphisms, markers, were shown to be present within five plastid genome intergenic regions of 13 octoploid strawberry genotypes, which could be detected by PCR-RFLP and PCR-SSCP analyses. The data show that Fragaria genotypes are distinguishable by plastid genome markers at both intra- and inter-specific levels. 3.6 Determination of whether plastids are transmitted through pollen in strawberry using plastid genome sequence markers (OBJECTIVE 6) The aim of this objective was to screen progenies from controlled crosses, derived from parents with distinguishable plastid genome markers, to determine which markers were present on their plastid genomes. This would reveal whether plastid genomes, and hence plastids, had been inherited from the paternal or maternal parent and would hence allow the mode of plastid inheritance in strawberry to be determined. Progenies from both intra-specific and inter-specific crosses were investigated. Raising of progenies from controlled crosses Progenies raised from controlled crosses between cultivated genotypes, grown in the field, were kindly provided by Dr David Simpson, leader of the strawberry breeding programme at Horticulture Research International, East Malling, UK. Progenies from the cross between cultivated and wild genotypes were raised from a cross between F. ananassa cv. Everest and F. virginiana plants. A day prior to pollination sepals, petals and stamens, from flowers with closed petals on F. virginiana plants, were removed. Recently opened flowers were removed from F. ananassa cv. Everest plants, the petals removed and the flowers incubated at 30 ºC for 7-8 hr until the anthers dehisced. Pollen from the anthers was brushed against receptive stigmas of F. virginiana plants to facilitate pollination and fruit subsequently allowed to mature. Seeds from fruit were removed, surface sterilised and plated on 0.75 % (w/v) agar plates containing 3 % (w/v) sucrose and Murashige and Skoog medium including vitamins at pH 5.7. Seedlings were grown at 22 ºC under a 16 hr photoperiod and once established with 6 – 8 leaves, weaned onto compost and grown under the same growth conditions in a growth room. Five families totalling 648 progeny, in which markers distinguished the parents, were investigated (Table 4). Table 4 Families used to determine plastid inheritance in strabwerry intra- and inter-specific crosses Family ID Paternal parent x maternal parent No. of progeny F. ananassa x F. ananassa 104 Alice x EM0965 163 Bolero x Diamante 199 Alice x Bolero 102 EM0980 x EM0965 56 147 75 237 F. ananassa x F. virginiana CW Everest x F. virginiana 133 Determination of the mode of plastid inheritance in strawberry Genomic DNA was extracted from leaf tissue of parents and progenies from each family and was subjected to either PCR-RFLP or PCR-SSCP analysis to detect specific markers. Analysis of family 199, using PCR-RFLP to detect marker 2, revealed that all bar one of the progeny exhibited identical restriction fragments to Bolero the female parent. Individual number 19 was shown to have inherited plastids from Alice, the paternal parent (Fig. 14). Fig 14. PCR-RFLP analysis of progeny raised from a controlled cross between cultivated strawberry (F. ananassa) genotypes. PCR fragments representing the trnT --- trnL intergenic region containing marker M2, generated from progeny (labeled 1 – 75) and digested with restriction enzyme Psi I are shown alongside similarly produced fragments from the male, Alice (M), and female, Bolero (F), parental genotypes used in the cross. CSG 15 (1/00) 18 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry 1 27 28 54 55 DEFRA project code 75 M F HH1031SSF kb 850 650 500 400 300 200 All progeny from families 104 and 163 totalling 203 individuals, were shown to have contained plastid genome DNA derived from the maternal parent using PCR-RFLP to detect markers 2 and 3 respectively. Analysis of family 102 using PCR-SSCP to detect marker one, the largest family studied with 237 progeny, also revealed exclusive maternal plastid inheritance. Paternal chloroplast inheritance was also detected in progeny derived from the cross between wild and cultivated genotypes. PCR-SSCP profiles for 23 of the 133 progeny screened, to detect markers four and five, are shown in Figure 15. Offspring number 105 was the sole sibling, from the total 133 screened, to have exhibited an identical PCR-SSCP profile to the male parent Everest. Fig 15. PCR-SSCP analysis of progeny raised from a controlled cross between cultivated and wild strawberry genotypes. PCR fragments within the rpl20 – 5’rps12 intergenic region containing markers M4 and M5, generated from progeny (labeled 93 – 115) and the male, F. ananassa cv. Everest (M), and female, F. virginiana (F), parental genotypes used in the cross, denatured and electrophoresed on a GMATM gel. 93 115 M F Strawberry is not unique in displaying incomplete maternal inheritance of plastids. Paternal plastid transmission has also been observed in other angiosperm species, such as tobacco (Medgyesy et al., 1986). Similarly, in gymnosperms, which generally exhibit a paternal mode of plastid inheritance, a low frequency of maternal transmission has been observed (Shiraishi et al., 2001). Conclusion Two offspring, one each from inter- and intra-specific controlled crosses, were shown to have exclusively inherited paternal plastids; all other progeny inherited plastids from the maternal parent. It is concluded that plastids are not exclusively maternally inherited in strawberry and that the mode of inheritance, whether within cultivated genotypes or between cultivated and wild genotypes, can be bi-parental, albeit at low incidence. 4. MAIN IMPLICATIONS OF FINDINGS Utilising strawberry and focusing on safety and precision, this strategic research aimed to develop plastid and nuclear transformation technologies for the production of GM plants. A parallel study was conducted to elucidate the mode of plastid inheritance in strawberry. This would enable the potential for the use of plastid transformation to engineer GM strawberry as a means of eliminating gene flow through pollen to be determined. Whilst plastid transformed plants were successfully generated utilising selection with the carbohydrate xylose, production of stable lines, where all plastid genome copies were transformed, proved problematic. The same difficulty was experienced with a plastid-transformed line that was subjected to selection with the antibiotic spectinomycin. Selection of tissue cultures with antibiotics often promotes the generation of antibiotic resistant mutants, which survive the selection process along with plastid-transformed plants that are resistant since they carry an antibiotic resistance marker gene. It was hoped that developing a system that was based on carbohydrate metabolism, in addition to eliminating the use of antibiotic resistance genes in the system, would reduce the number of non-transformed regenerants that survived the selection process. However, the xylose selection system generated a large proportion of non-transformed lines, indicating the poor effectiveness of xylose as a selection agent under the growth conditions used. Even when cultured in the presence of solely xylose, the proportion of transformed plastid genomes in partially transformed lines could not be increased. It is clear that although strawberry plastid transformed plants have been generated using both antibiotic and non-antibiotic selection systems, both systems have their limitations, and further CSG 15 (1/00) 19 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF development is necessary to engineer stable strawberry plastid transformed lines. This is likely to involve consideration of alternative selection systems and construction of new improved plastid transformation vectors carrying regulatory elements that ensure efficient transcription and translation in planta. Study of the mode of plastid inheritance revealed bi-parental inheritance in strawberry. No previous studies on the mode of plastid inheritance in strawberry have been reported. The finding that there was a low frequency of paternal inheritance has implications on engineering the strawberry plastid genome for containment of foreign genes. Whilst foreign gene escape via pollen would be significantly reduced in strawberry plastid transformed plants, in comparison to those transformed in their nuclear genome, there may still be potential for a small degree of escape. There would be potential for paternal plastid transmission within octoploid strawberry at both intra-specific and inter-specific levels. It is worth noting that the data obtained from this work emanated from controlled crosses and the frequencies of paternal plastid transmission under natural hybridisation conditions may differ. The markers and techniques developed in this work could be used in further studies investigating inheritance in natural populations arising from open pollination. Additionally, since sequence polymorphisms occur at low frequency within the strawberry plastid genome, the ones identified in this study will be powerful tools for phylogenetic and population genetic studies. The finding that plastids can be paternally inherited is of significance for population genetic studies where strict maternal inheritance is often assumed. There have been limited studies investigating plastid genome sequence variation in Fragaria species and the markers detected in this work add to the current knowledge. The FavAP3 promoter was investigated for its ability to drive floral organ specific gene expression with the longer-term goal of using it to drive expression of anti-fungal protein genes. The target in strawberry being the fungus Botrytis cinerea, which enters the plant through floral tissue. Therefore gene expression could be specifically targeted to the tissues requiring the foreign protein, which would be absent in the consumed part of the plant, the fruit, where its presence was not necessary. Unfortunately, though FavAP3 promoter activity was highest in floral tissue, it was present throughout all plant tissues and could not be considered tissue specific. It therefore would offer little benefit for restricting foreign gene expression to particular tissues. The FavRB7 gene promoter was shown to be near root-specific and moderately strong. It could be used for near root-specific expression of genes that confer resistance to pests and diseases, such as Otorynchus sulcata (vine weevil) larvae, Verticillium dahliae (Verticillium wilt) and Phytophthora fragariae (red core) that attack the root. With very limited gene expression in the aerial parts of the GM plant, the potential risks to consumers and beneficial insects would be reduced. With the possible future use of GM technology to combat pests and diseases, this promoter will become increasing valuable for targeting anti-pest/fungal proteins to roots, especially with the gradual withdrawal of soil sterilants such as chloropicrin, which is currently used to combat soil-borne diseases. The finding, from work carried out in a parallel study, that the FavRB7 gene promoter, different to the situation in strawberry, directs constitutive expression in a heterologous host stresses the importance of not assuming that a promoter will behave the same way when placed in a heterologous host as it does in the species from which it has been isolated. 5. REFERENCES Al-Kaff NS, Covey SN, Kreike MM, Page AM, Pinder R, Dale PJ (1998) Transcriptional and posttranscriptional plant gene silencing in response to a pathogen. Science 279: 2113-2115 Chen J, Tauer CG, Huang Y (2002) Paternal chloroplast inheritance patterns in pine hybrids detected with trnL-trnF intergenic region polymorphism. Theor. Appl. Genet. 104:1307-1311 Conkling MA, Cheng CL, Yamamoto YT, Goodman HM (1990) Isolation of transcriptionally regulated root-specific genes from tobacco. Plant Physiol. 93:1203-1211 Corriveau JL, Coleman AW (1988) Rapid screening method to detect potential biparental inheritance of plastid DNA and results for over 200 angiosperm species. Amer J Bot 75:1443-1458 Cornielle S, Lutz K, Svab Z, Maliga P (2001) Efficient elimination of selectable marker genes from the plastid genome by the Cre-Lox site-specific recombination system. Plant J. 27:171-178 Daniell H, Mukthukumar B, Lee SB (2001) Marker free transgenic plants: engineering the plastid genome without the use of antibiotic selection. Curr. Genet. 39:109-116 Davis SJ, Vierstra RD (1998) Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants. Plant Mol. Biol. 36:521-528 Dix PJ , Kavanagh TA (1995) Transforming the plastome-genetic markers and DNA delivery systems. Euphytica 85:29-34 Dobes CH, Mitchell-Olds T, Koch MA (2004) Extensive chloroplast haplotype variation indicates Pleistocene hydridisation and radiation of North American Arabis drummondii, A. x divaricarpa, and A. holboellii (Brassicaceae). Mol Ecol 13:349-370 Gittins JR, Pellny TK, Hiles ER, Rosa C, Biricolti S, James DJ (2000) Transgene expression driven by heterologous ribulose-1,5bisphosphate carboxylase/oxygenase small-subunit gene promoters in the vegetative tissues of apple (Malus pumila Mill.). Planta 210:232-240 CSG 15 (1/00) 20 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Guillon J-C, Raquin C (2000) Maternal inheritance of chloroplasts in the horsetail Equisetum variegatum (Schleich). Curr. Genet. 37:5356 Hajdukiewicz PTJ, Gilbertson L, Staub JM (2001) Multiple pathways for Cre/lox-mediated recombination in plastids. Plant J. 27:161170 Haldrup A, Petersen SG, Okkels FT (1998a) Positive selection: a plant selection principle based on xylose isomerase, an enzyme used in the food industry. Plant Cell Rep. 18:76-81 Haldrup A, Petersen SG, Okkels FT (1998b) The xylose isomerase gene from Thermoanaerobacterium thermosulfurogenes allows effective selection of transgenic plant cells using D-xylose as the selection agent. Plant Mol. Biol. 37:287-296 Hamilton MB (1999) Four primer pairs for the amplification of chloroplast intergenic regions with intraspecific variation. Mol. Ecol. 8:513-525 Hou BK, Zhou YH, Wan LH, Zhang ZL, Shen GF, Chen ZH, Hu ZM (2003) Chloroplast transformation in oilseed rape. Transgenic Res. 12:111-114 Iamtham S and Day A (2000) Removal of antibiotic resistance genes from transgenic tobacco plastids. Nature Biotechnol. 18:11721176 Irish VF (2003) The evolution of floral homeotic gene function. BioEssays 25: 637-646 Jack T, Fox GL, Meyerowitz EM (1994) Arabidopsis homeotic gene APETALA3 ectopic expression: transcriptional and posttranscriptional regulation determine floral organ identity. Cell 76: 703-716 Jefferson R (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep. 5:387-405 Joersbo M, Donaldson I, Kriegberg J, Peterson SG, Brunstedt J, Okkels FT (1998) Analysis of mannose selection used for transformation of sugar beet. Mol. Breed. 4:111-117 Khan MS, Maliga P (1999) Fluorescent antibiotic resistance marker for tracking plastid transformation in higher plants. Nature Biotechnol. 17:910-915 Kohli A, Griffiths S, Palacios N, Twyman RM, Vain P, Laurie D, Christou P (1999) Molecular characterisation of transforming plasmid rearrangements in transgenic rice reveals a recombination hotspot in the CaMV 35S promoter and confirms the predominance of microhomology mediated recombination. Plant J. 17:591-601 Kristo P, Saarelained R, Gagerstrom R, Aho S, Korhola M (1996) Protein purification, cloning and characterisation of the cDNA and gene for xylose isomerase of barley. Eur. J. Biochem. 237:240-246 Lawton MA, Tierney MA, Nakamura I, Anderson E, Komeda Y, Dube P, Hoffman N, Fraley RT, Beachy RN (1987) Expression of a soybean beta-conclycinin gene under the control of the cauliflower mosaic virus 35S and 19S promoters in transformed petunia tissue. Plant Mol. Biol. 9:315-324 Magee AM, Horvath EM, Kavanagh TA (2004) Pre-screening plastid transgene expression cassettes in E. coli may be unreliable as a predictor of expression levels in chloroplast-transformed plants. Plant Sci. 166:1605-1611 Maliga P (1993) Towards plastid transformation in flowering plants. Trends Biotechnol. 11:101-107 Medgyesy P, Pay A, Marton L (1986) Transmission of paternal chloroplasts in Nicotiana. Mol. Gen. Genet. 204:195-198 Panda S, Martin JP, Aguinagalde I (2003) Chloroplast DNA study in sweet cherry cultivars (Prunus avium L.) using PCR-RFLP method. Genet. Res. Crop. Evol. 50:489-495 Ruf S, Hermann M, Berger IJ, Carrer H, Bock R (2001) Stable genetic transformation of tomato plastids and expression of a foreign protein in fruit. Nature Biotechnol. 19:870-875 Shiraishi S, Maeda H, Toda T, Seido K, Sasaki Y (2001) Incomplete paternal inheritance of chloroplast DNA recognised in Chamaecyparis obtuse using an intraspecific polymorphism of the trnD-trnY intergenic region. Theor. Appl. Genet. 102:935-941 Sidorov V, Kasten D, Pang S, Hajdukiewicz P, Staub J, Nehra, N (1999) Stable chloroplast transformation in potato: use of green fluorescent protein as a plastid marker. Plant J. 19:209-216 Sikdar SR, Serino G, Chaudhuri S, Maliga P (1998) Plastid transformation in Arabidopsis thaliana. Plant Cell Rep. 18:20-24 Skarjinskaia M, Svab Z, Maliga P (2003) Plastid transformation in Lesquerella fendleri, an oilseed Brassicacea. Transgenic Res. 12: 115-122 Svab Z, Hajdukiewicz P, Maliga P (1990) Stable transformation of plastids in higher plants. Proc. Natl. Acad. Sci. U.S.A. 87:8526 – 8530 Svab Z, Maliga P (1993) High frequency plastid transformation in tobacco by selection for a chimeric aadA gene. Proc. Natl. Acad. Sci. U.S.A. 90:913-917 Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol 17:1105-1109 Yamamoto YT, Cheng CL, Conkling MA (1990) Root-specific genes from Arabidopsis and tobacco homologous to an evolutionarily conserved family of membrane channel protein. Nucleic Acids Res. 18:7449-7449 Zhang Q, Liu Y, Sodmergen (2003) Examination of the cytoplasmic DNA in the male reproductive cells to determine the potential for cytoplasmic inheritance in 295 angiosperm species. Plant Cell Physiol 44:941-951 CSG 15 (1/00) 21 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF APPENDIX 1 PRIMERS Primers used in the contruction of pFavXG plastid transformation vector RRN16SSP 5’ AAATTAATATTCGCCTGGAGTTCGCT 3’ RRN16 KPNSGF 5’ ATTATGGTACCGCGATCGCTTTCCATTTTTATTTGC 3’ RBCLc 5’ CAGGCCTGTTGTAGGGAGGGACA 3’ RBCLd 5’ GTACACAGGGAGGGATGTTGTCCGGACCCGG 3’ PSBABGL 5’ ACTGCAGATCTCCATCTATCAATGGATAAGGCTT 3’ PSBAECOSGF 5’ TATAGAATTCGCGATCGATTACTTGTAAAAAAGAATACAACAT 3’ XYLAPAG1 5’TTAATCATGAATAAATATTTTGAGAACG 3’ XYLAXHO1 5’ ATTATCTCGAGTTATTCTGCAAACAAAT 3’ SMGFPBGLAPA 5’ TATAGGGCCCAGATCTTATTTGTATAGTTCATCCATG 3’ AADA/XYLA:SMGFP 5’ ATCTGCAGCTCGAGATGACTAATTAGAAGGGAGGGAATCATGAGTAAAGGAGAAGAACTTTTCACTG 3’ Primers used in RT-PCR to detect marker genes in transgenic lines Npt II A 5’ GAGGCTATTCGGCTATGACTG 3’ Npt II B 5’ ATCGGGAGCGGCGATACCGTA 3’ Gus 27 5’ CCTGTAGAAACCCCAACCCGTG 3’ Gus 392 5’ CCCGGCAATAACATACGGCGTG 3’ Primers used in the plastid inheritance study to amplify regions of the plastid genome 2CR 5’ TGAAGTTCCGTCTATCAATGG 3’ 1AF 5’ AAAATGGGAAATGCCCTACCT 3’ 1AR 5’ TTCCAAGTGTKATTTCTATGTT 3’ 3EF 5’ GCGGGTATAGTTTAGTGGTAA 3’ 3ER 5’ AGCGGGTAGCGGGAATCGAA 3’ G179F 5’ ATGATATAAATGTAGAAAAATTCAAC 3’ G179R 5’ ATATGTAATGTAATAGTCAAAAAATC 3’ J2XF 5’ CTGAGTAGCTGACCCTGTTAGT 3’ J2XR 5’ AAATGTATGGTTCCCGTTGGTG 3’ 6. APPENDIX 2 TECHNOLOGY/KNOWLEDGE TRANSFER ACTIVITIES Papers Massiah, A.J. (2004) Genetic modification of plants. Oxford Series, Oxford Companion to the Garden. Oxford University Press. In press Massiah, A.J., Baker, S.A., Theodoridou, S. and James, D.J. (2004) A Strawberry (Fragaria x ananassa Duch.) APETALA3 ortholog (FavAP3) regulates petal and stamen formation and is expressed during reproductive and vegetative plant development. Submitted to Journal of Experimental Botany Massiah, A.J., Baker, S.A and Passey, A.J.(2004) Incomplete maternal inheritance of chloroplasts in the genus Fragaria detected using inter- and intraspecific sequence polymorphisms of chloroplast DNA. In preparation. To submit to Molecular Genetics and Genomics journal (June 2004) CSG 15 (1/00) 22 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Vaughan, S.P., James, D.J, Lindsey, K. and Massiah, A.J. (2004) Isolation and characterisation of the gene and promoter of FavRB7, a tonoplast intrinsic protein homologue from strawberry (Fragaria x ananassa Duch.). In preparation, submission planned for August 2004 PhD Thesis: Simon Vaughan (2003) Tissue and organelle targeted transgene expression in plants. Student registered with University of Durham James, D. J. and Massiah, A. J. (2003) Genetic modification of temperate fruit crops – why we do it and why it’s necessary. Forum contribution towards topics 1. GM Food and Feed Safety and 2. Future Developments, UK Government GM Science Review. http://www.gmsciencedebate.org.uk/topics/forum/0029.htm James, D. J., Gittins, J. R., Pellny, T, K., Massiah, A. J., Hiles, E. R., Biricolti, S., Vaughan, S. P. and Passey, A. J. (2001) Using heterologous and homologous promoters to study tissue-specific transgene expression in fruit crops. Acta Horticulturae. No560: 55-62 Patents UK Patent Office Application in the name Horticulture Research International, number 0312449.2: Novel Promoters (FavRB7 promoter for root-specific expression in strawberry and constitutive expression in heterologous hosts). Inventors: Vaughan, S.P., Massiah, A.J. and James, D.J. Filed 30/05/03 GenBank DNA sequence accessions submitted AY429427 – Full length FavAP3 sequence AY429428 – Partial length FavAP3 sequence with 3’ UTR AY429429 – FavAP3 gene promoter sequence with 5’ end of gene attached Posters Vaughan, S. P., Massiah, A. J. and James, D. J. (2001) Plastid transformation in strawberry. Presented at Horticulture Research International Graduate Student Symposium 2001 Conference proceedings James, D., Massiah, A.J., Blakesley, D., Passey, A.J. and Bulley, S. (August 2002) Using Genetic Modification in apple and strawberry to improve fruit quality – benefits for the grower, the consumer and the environment. ISHS Conference 2002 – Toronto, Canada. Session: Biotechnology of Horticultural Crop Improvement: Achievements, Opportunities and Limitations James, D. and Massiah, A. (September 2001) Regulation and targeting of transgene expression in fruit crops. Presentation at the Greater London Molecular Plant Sciences Symposium James, D. and Massiah, A. (July 2001) Strawberry biotechnology for genetic improvement and healthcare. International RUBUS / RIBES Symposium 8 th James, D. and Massiah, A. (June 2001) Strawberry biotechnology programmes at East Malling. Presentation to Meiosis at the Soft Fruit Conference Day Oral presentations Vaughan, S.P., Massiah, A.J. and James, D. J. (June 2003) Strawberry GM research at HRI-EM. Oral presentation at East Malling Research Association – Soft Fruit Research Day. James, D. J. and Massiah, A. J. (September 2002) GM technology at East Malling. Oral presentation to invited VIPs for opening of East Malling Conference Centre and East Malling VIP Open Day Massiah, A. J., Passey, A. J., Vaughan, S. P., Baker, S. and James, D. J. (September 2002) Presentations: ‘GM technology, the public debate’ and ‘GM plants-how they are made’ East Malling Public Open Day CSG 15 (1/00) 23 Project title Tissue and plastid targeted transgene expression in a perennial crop, strawberry DEFRA project code HH1031SSF Massiah, A, Passey and A, Blakesley, D (March 2002) Production of foreign proteins in GM plants. Presentation to Enterprise Hub Directors Vaughan, S. P., James, D. J. and Massiah, A. J. (February 2002) Towards root specific transgene expression in strawberry. Presentation a HRI Annual Student Symposium (Vaughan awarded prize for best presented talk) Massiah, A., Passey, A. and Bulley, S. (February 2002) GM crop technologies. Presentation to the Parliamentary Fruit Group. Massiah, A.J. (October 2001) Plant biotechnology. Presentation for Team CI 5, Molecular Pharming and Gene Delivery, at Horticulture Research International Institute Assessment Exercise 2001 Massiah, A.J. (October 2001) Genetic modification of fruit crops. Presentation to Dr Emma Hennessey, DEFRA Massiah, A.J. (May 2001) Transgene expression. Presentation to Dr David Jones, DEFRA Massiah, A. (March 2001) Genetic engineering in fruit crops. Presentation to three members of the Ethical Investment Advisory Group to the Church of England Massiah, A. J., Vaughan, S. & James, D. J. (2001) Plastid transformation in the fruit crop strawberry. Invited speaker, Department of Biology, National University of Ireland, Maynooth, Ireland. Massiah, A. (February 2001) Tissue and plastid targeted transgene expression in strawberry. Horticulture Research International Soft Fruit Research Review meeting James, D. and Massiah, A. (February 2001) Regulation and targeting of transgene expression in fruit crops. Lecture to final year honours students, University of Greenwich James, D. and Massiah, A. (January 2001) Genetically Modified Fruit. Lecture to MSc students at JIC, Norwich James, D. and Massiah, A. (November 2000) Regulation and targeting of transgene expression in fruit crops. Presentation to Dr Seppo Sovari plus four other visitors from MTT Horticulture, Finland Technical reports Massiah, A.J., Vaughan, S.P. and James, D. J. (June 2003) Strawberry GM research at HRI-East Malling. East Malling Research Association – Soft Fruit Research Day report. Massiah, A. (2002) Production of GM plants using chloroplast transformation. Horticulture Research International Annual Report 2001-2002 Walden, R.M., James, D.J., Blaskesley, D. and Massiah, A. J. (2000) GM fruit workshop East Malling Research Association (EMRA) report CSG 15 (1/00) 24