Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download internal medicine journal
Document related concepts
Transcript
Volume 45, Issue 5, May 2015, Pages 471–596 INTERNAL MEDICINE JOURNAL Volume 45 Issue 5 May 2015 ISSN 1444-0903 INTERNAL MEDICINE JOURNAL Chronic obstructive pulmonary disease Familial colorectal cancer Colonoscopy in young women SNAPSHOT acute coronary syndrome audit Infection prevention practices in aged-care facilities 5/5/2015 5:16:42 PM 002-imj-v45-i5-ifc.indd 2 5/5/2015 3:15:57 PM bs_bs_banner Honorary Advisory Board Editor-in-Chief Jeff Szer, Melbourne Continuing Education Deputy Editor-in-Chief Deputy Editor-in-Chief Zoltan Endre, Sydney Paul Bridgman, Christchurch Subspecialty Editors Cardiology (General) Paul Bridgman, Christchurch Infectious Diseases David Gordon, Adelaide Cardiology (Arrhythmias) Andrew McGavigan, Adelaide Intensive Care Michael O’Leary, Sydney Clinical Genetics Les Sheffield, Melbourne Internal Medicine Ian Scott, Brisbane Clinical Pharmacology Jenny Martin, Newcastle Yvonne Bonomo, Melbourne (Addiction Medicine) Nephrology Zoltan Endre, Sydney Continuing Education (Clinical Perspectives) Christopher Pokorny, Sydney Emergency Medicine Paul Middleton, Sydney Endocrinology Morton Burt, Adelaide Anthony Russell, Brisbane Ethics Paul Komesaroff, Melbourne Gastroenterology David M. Russell, Melbourne Geriatric Medicine Leon Flicker, Perth Haematology (General) Peter Browett, Auckland Peter Doherty, Melbourne Kar Neng Lai, Hong Kong Richard Larkins, Melbourne Sir Gustav Nossal, Melbourne Lawrie W. Powell, Brisbane Nicholas Saunders, Newcastle John Shine, Sydney Chorh Chuan Tan, Singapore Sir David Weatherall, Oxford Judith Whitworth, Canberra Editorial Ombudsman Graham Macdonald, Sydney Manager Virginia Savickis, Sydney Neurology David Blacker, Perth Nuclear Medicine Frederick A. Khafagi, Brisbane Occupational and Environmental Medicine; Health Economics; Editorials Editor Des Gorman, Auckland Oncology Damien Thomson, Brisbane Palliative Medicine Janet Hardy, Brisbane Editorial Assistant Louise Young-Wilson, Sydney Previous Editors-in-Chief Internal Medicine Journal Edward Byrne (1999–2004) The Australian and New Zealand Journal of Medicine Graham Macdonald (1989–1999) Michael O'Rourke (1981–1989) Akos Z. Gyory (1975–1981) Charles Kerr (1970–1975) The Australasian Annals of Medicine Ronald Winton (1957–1970) Mervyn Archdall (1952–1956) Public Health Medicine Mark Ferson, Sydney Respiratory Medicine Matthew Naughton, Melbourne Haemostasis/Thrombosis Claire McLintock, Auckland Rheumatology Peter Youssef, Sydney Immunology and Allergy Marianne Empson, Auckland Sexual Health Medicine Darren Russell, Cairns IMJ.JEBDec14 101-imj-v45-i5-jeb.indd fm_i 5/5/2015 3:16:38 PM Up to 1.0FTE Permanent Staff Specialist – Centre for Infectious Diseases and Microbiology PUSH BOUNDARIES Classification: Staff Specialist Location: Westmead Employment Status: Permanent Full-Time Enquiries: Professor Jon Iredell (02) 9845 6012 or (02) 8627 3410 Email: [email protected] Reference Number: 12758 Closing Date: 31 May 2015 It is essential for all applicants to contact the Specialist Medical and Dental Recruitment Unit on (02) 8838 2094 or email [email protected] for an application package. All selection criteria must be addressed in your application. Applications must be received by 5pm on this date. All applications are to be forwarded to the SMADR Unit, Locked Bag 7118, Parramatta, BC NSW 2124. Access this journal and thousands of other essential resources. Z02813 Please apply online by visiting: nswhealth.erecruit.com.au WILEY ONLINE LIBRARY Featuring a clean and easy-to-use interface, this online service delivers intuitive navigation, enhanced discoverability, expanded functionalities, and a range of personalization and alerting options. Sign up for content alerts and RSS feeds, access full-text, learn more about the journal, find related content, export citations, and click through to references. NSW Health Service: employer of choice wileyonlinelibrary.com Save Time and Let the Research Come to You 9 Be the first to read Early View articles 9 Get notified of Accepted Articles when they appear online 9 Receive table of contents details each time a new issue is published 9 Never miss another issue! wileyonlinelibrary.com Follow these 3 easy steps to register for alerts online: 1 2 3 Log into Wiley Online Library. If you are not already a registered user, you can create your profile for free. Select “Get New Content Alerts” from Journal Tools on the top left menu on any journal page or visit the Publications page to view all titles. Submit your preferences and you are done. You will now receive an email when a new issue of the journal publishes. 12 - 4 6 0 6 0 Sign up for new content ntent alerts aler for all of your favorite journals: bs_bs_banner aims and scope The Internal Medicine Journal, formerly known as the Australian and New Zealand Journal of Medicine, is the official journal of the Adult Medicine Division of The Royal Australasian College of Physicians (RACP). Its purpose is to publish high-quality internationally competitive peer-reviewed original medical research, both laboratory and clinical, relating to the study and research of human disease. Papers will be considered from all areas of medical practice and science. The Journal also has a major role in continuing medical education and publishes review articles relevant to physician education. Except where otherwise stated, articles are peer reviewed. abstracting and indexing This journal is indexed by Abstracts on Hygiene and Communicable Diseases, AgBiotech News and Information, AIDS Abstracts, Australian Medical Index, BIOBASE, Biological Abstracts (BIOSIS), Biomedical Reference (EBSCO), Cambridge Scientific Abstracts, Chemical Abstracts Service, Current Contents/Clinical Medicine (an ISI product), Derwent Biotechnology Abstracts, EMBASE/Excerpta Medica, Environmental Sciences and Pollution Management, Health and Safety Science Abstracts (Online version), Helminthological Abstracts, InPharma Weekly, International Pharmaceutical Abstracts (IPA), Journals @ Ovid, MEDLINE, Nutrition Abstracts and Reviews, Pharmacoeoconomics and Outcomes News, Reactions Weekly, Science Citation Index, SCOPUS, Tropical Diseases Bulletin, Vitis-Viticulture and Oenology Abstracts (Online Edition), World Agricultural Economics and Rural Sociology Abstracts, and CINAHL. address for editorial correspondence Editor-in-Chief, Internal Medicine Journal, The Royal Australasian College of Physicians, 145 Macquarie Street, Sydney, NSW 2000, Australia (tel: +61 2 9256 5431; fax: +61 2 9252 3310). For enquiries regarding ScholarOne Manuscripts (formerly known as ManuscriptCentral) submissions please email [email protected] (e.g. IMJ-0000-2014). General enquiries should be directed to Virginia Savickis, the Editorial Office, Internal Medicine Journal, using imj@ racp.edu.au Comments on published papers are welcomed. Authors are offered right of reply (no more than 500 words) at the discretion of the Editor and discussion will not be entered into. Given the current pressures on editorial space, however, invited comments are restricted to one reply. disclaimer The Publisher, RACP and Editors cannot be held responsible for errors or any consequences arising from the use of information contained in this journal; the views and opinions expressed do not necessarily reflect those of the Publisher, RACP and Editors, neither does the publication of advertisements constitute any endorsement by the Publisher, RACP and Editors of the products advertised. Copyright © 2015 Royal Australasian College of Physicians. For submission instructions, subscription and all other information visit www.wileyonlinelibrary.com/journal/imj This journal is available online at Wiley Online Library. Visit www.onlinelibrary.wiley.com to search the articles and register for table of contents and email alerts. Wiley’s Corporate Citizenship initiative seeks to address the environmental, social, economic, and ethical challenges faced in our business and which are important to our diverse stakeholder groups. We have made a long-term commitment to standardise and improve our efforts around the world to reduce our carbon footprint. Follow our progress at www.wiley.com/go/citizenship Access to this journal is available free online within institutions in the developing world through the HINARI initiative with the WHO. For information, visit www.healthinternetwork.org ISSN 1444-0903 (Print) ISSN 1445-5994 (Online) IMJ.JEBDec14 103-imj-v45-i5-jeb.indd fm_iii 5/5/2015 3:16:40 PM Share your wealth of knowledge Submit your manuscript today Internal Medicine Journal The Official Journal of the Adult Medicine Division of The Royal Australasian College of Physicians (RACP) Internal Medicine Journal actively recruits influential and topical material in all areas of medical practice and science for their upcoming publications. You are invited to submit your original medical research, whether it be laboratory and clinical, for consideration today. To view author guidelines visit the Journal homepage at www.wileyonlinelibrary.com/journal/imj Edited by: Jeff Szer Print ISSN: 1444-0903 Online ISSN: 1445-5994 Frequency: Monthly Impact Factor (2009): 1.786 Submit your manuscript online at: http://mc.manuscriptcentral.com/imj bs_bs_banner May 2015, Volume 45, Issue 5 Editorial 471 510 Domestic violence: it is time for the medical profession to play its part L. Piterman, P. A. Komesaroff, H. Piterman and K. J. Jones Review 474 C. Susanto and P. S. Thomas 517 Physical activity and sedentary behaviour: applying lessons to chronic obstructive pulmonary disease 482 527 Familial colorectal cancer M. S. Lung, A. H. Trainer, I. Campbell and L. Lipton Clinical triage for colonoscopy is useful in young women K. D. Williamson, K. Steveling, G. Holtmann, M. Schoeman and J. M. Andrews 497 Comparison of the management and in-hospital outcomes of acute coronary syndrome patients in Australia and New Zealand: results from the binational SNAPSHOT acute coronary syndrome 2012 audit C. Ellis, C. Hammett, I. Ranasinghe, J. French, T. Briffa, G. Devlin, J. Elliott, J. Lefkovitz, B. Aliprandi-Costa, C. Astley, J. Redfern, T. Howell, B. Carr, K. Lintern, S. Bloomer, A. Farshid, P. Matsis, A. Hamer, M. Williams, R. Troughton, M. Horsfall, K. Hyun, G. Gamble, H. White, D. Brieger and D. Chew, on behalf of Bi-National Acute Coronary Syndromes (ACS) ‘SNAPSHOT’ Audit Group 105-imj-v45-i5-toc.indd fm_v Efficacy of non-invasive mechanical ventilation in the general ward in patients with chronic obstructive pulmonary disease admitted for hypercapnic acute respiratory failure and pH < 7.35: a feasibility pilot study S. Fiorino, L. Bacchi-Reggiani, E. Detotto, M. Battilana, E. Borghi, C. Denitto, C. Dickmans, B. Facchini, R. Moretti, S. Parini, M. Testi, A. Zamboni, A. Cuppini, L. Pisani and S. Nava Original Articles 492 Obvious emphysema on computed tomography during an acute exacerbation of chronic obstructive pulmonary disease predicts a poor prognosis T. Cheng, H. Y. Wan, Q. J. Cheng, Y. Guo, Y. R. Qian, L. Fan, Y. Feng, Y. Y. Song, M. Zhou, Q. Y. Li, G. C. Shi and S. G. Huang K. Hill, P. A. Gardiner, V. Cavalheri, S. C. Jenkins and G. N. Healy Clinical Perspectives Assessing the use of initial oxygen therapy in chronic obstructive pulmonary disease patients: a retrospective audit of prehospital and hospital emergency management 537 Prevalence and significance of CYP2C19*2 and CYP2C191*7 alleles in a New Zealand acute coronary syndrome population P. D. Larsen, L. R. Johnston, A. Holley, A. C. La Flamme, L. Smyth, E. W. Chua, M. A. Kennedy and S. A. Harding 546 Safety of coadministration of ezetimibe and statins in patients with hypercholesterolaemia: a meta-analysis L. Luo, X. Yuan, W. Huang, F. Ren, H. Zhu, Y. Zheng and L. Tang 557 Crescentic glomerulonephritis: data from the Spanish Glomerulonephritis Registry B. Quiroga, A. Vega, F. Rivera and J. M. López-Gómez, on behalf of all members of the Spanish Registry of Glomerulonephritis 5/5/2015 5:18:25 PM WE MAKE YOUR RESEARCH EASY. NOW WE MAKE JOB HUNTING EASY. Let your partners in research energize your career. Drawing on our expertise and relationships in the healthcare industry, Wiley-Blackwell invites you to join Wiley Healthcare Jobs, the definitive job site for healthcare professionals. đƫ premium jobs from the most respected names in healthcare đƫ hundreds of healthcare-industry recruiters and employers đƫ job alerts that match your criteria đƫ expert career advice and candidate resources Register and upload your resume/CV now to begin your job search! Part of wileyhealthcarejobs.com bs_bs_banner May 2015, Volume 45, Issue 5 Position Paper 563 Consensus guidelines for the investigation and management of encephalitis in adults and children in Australia and New Zealand P. N. Britton, K. Eastwood, B. Paterson, D. N. Durrheim, R. C. Dale, A. C. Cheng, C. Kenedi, B. J. Brew, J. Burrow, Y. Nagree, P. Leman, D. W. Smith, K. Read, R. Booy and C. A. Jones, on behalf of the Australasian Society of Infectious Diseases (ASID), Australasian College of Emergency Medicine (ACEM), Australian and New Zealand Association of Neurologists (ANZAN) and the Public Health Association of Australia (PHAA) Brief Communications 576 Survey of infection control and antimicrobial stewardship practices in Australian residential aged-care facilities R. L. Stuart, C. Marshall, E. Orr, N. Bennett, E. Athan, D. Friedman and M. Reilly, on behalf of Members of RACRIG (Residential Aged Care Research Interest Group) 580 Long-term follow up of paediatric liver transplant recipients: outcomes following transfer to adult healthcare in New Zealand R. Harry, C. Fraser-Irwin, S. Mouat, E. Gane, S. Munn and H. M. Evans 583 588 S. K. Mallipattu, J. Ling and J. Uribarri General correspondence 589 589 586 Author reply M. Brown and D. Campbell 590 Leprosy and Australia C. R. Boughton 590 Not only monoclonal antibodies … J. C. Nossent 591 Author reply R. J. Commons, R. Hannah and B. J. Currie 592 Redesign versus resources: continuity lost C. P. Denaro 593 Author reply R. Toomath, N. Szecket and P. Poole 594 The true prevalence of diabetes in hospital patients and its implications G. Somarajah, H. Karunajeewa, P. S. Hamblin, E. Karahalios and E. Janus 595 Author reply J. E. Cromarty, S. Parikh, T. J. Jackson, W. K. Lim and S. Acharya Letters to the Editor Clinical-scientific notes Audit of inpatient referrals G. Simpson Primary central nervous system posttransplantation lymphoproliferative disorder after heart and lung transplantation G. Gifford, K. Fay, A. Jabbour and D. D. Ma Serum creatinine is not the end-all, be-all of renal impairment Bilateral cordotomy post-failure of intrathecal analgesia in a palliative care setting Systemic lupus erythematosus patients and tertiary specialist care – simple considerations dropping through the cracks: osteoporosis monitoring as an example S. P. M. Hosking, M. E. Franco, P. Poon and L. William M. Hew, E. J. McKinnon, B. Kirwin, O. P. Martinez and M. Lucas 107-imj-v45-i5-toc.indd fm_vii 596 5/5/2015 5:18:26 PM WE MAKE YOUR RESEARCH EASY. NOW WE MAKE JOB HUNTING EASY. Let your partners in research energize your career. Drawing on our expertise and relationships across the research and business communities, Wiley-Blackwell invites you to join Wiley Job Network, the definitive job site for professionals in the sciences, technology, business, finance, healthcare and the arts. đƫ premium jobs from the most respected names in your industry đƫ hundreds of recruiters and employers in your field đƫ job alerts that match your criteria đƫ expert career advice and candidate resources Register and upload your resume/CV now to begin your job search! wileyjobnetwork.com Internal Medicine Journal 45 (2015) E D I TO R I A L Domestic violence: it is time for the medical profession to play its part Ignored for a long time, domestic violence is now recognised as one of the major public health issues in Australia. The financial cost of the problem to the community, estimated at $14.7 billion in 2013, is similar to that of obesity and far in excess of diabetes.1 However, beyond the monetary cost the personal and social damage associated with domestic violence is regarded by many as sufficient to constitute a national emergency. Intensifying public interest in the problem is reflected in the appointment as the 2015 Australian of the Year of Rosie Batty, a courageous victim of a tragic case of domestic violence, together with the establishment of a special Domestic Violence Task Force in Queensland and a Royal Commission in Victoria. While these initiatives are most welcome, they will not on their own provide a solution. What is needed is a national strategy that brings together diverse groups and individuals from the community around a multidisciplinary programme that includes information, support, education and research. Such a programme will require support and resources from government as well as active participation from the medical profession. Despite their potential influence and importance, medical professionals, with rare exceptions, have been strangely silent in this area. The Australian Medical Association has had an admirable policy on its books for 10 years and the Royal Australian College of General Practitioners has developed guidelines for family doctors.2 However, many other Colleges – including the Royal Australasian College of Physicians – appear not even to have developed policies on the subject, let alone effective action strategies. It is time that the wider medical profession contributed actively to addressing this scourge on Australian society.3 Any coordinated strategy on domestic violence will need to be informed by accurate and reliable data. Unfortunately, such data are, at the present time relatively limited. It is known that domestic violence extends to a vast array of abusive settings, covering physical, sexual, emotional and financial abuse among intimate partners, same sex couples, elders and children. It crosses all socioeconomic, cultural, ethnic and religious boundaries. The vast majority of victims are women, with 17% of all Australian women aged more than 18 years having experienced violence from a partner at some time, com- pared with 5.3% for men,4 and that domestic violence is especially marked in pregnancy, during which up to 36% of all violence occurs,5 and when up to 20% of women experience it for the first time.6 More than 65 000 cases of domestic incidents are reported to police in Victoria each year,7 and nearly 35 000 intervention orders related to family violence are issued, both of these numbers are rapidly increasing.8 Sadly, even death is a not infrequent outcome, with 185 domestic homicides having been reported across Australia in the 3 years to 2010.9 It is known that, despite its frequent occurrence, domestic violence is recognised only rarely by medical practitioners. Indeed, the Bettering the Evaluation and Care of Health (BEACH) study,10 which monitors patterns of consultations in general practice, reported that in more than 95 000 consultations examined in 2013–2014, domestic violence was never cited as a reason for encounters by patients or a problem managed by general practitioners (GP). Similarly, an Irish study of women attending general practices showed that while 39% had experienced violent behaviour from their partner, only 12% were questioned about it by their doctors.11 There is much, however, that remains to be explained. In particular, it is not clear why doctors are doing so badly. Contributing factors no doubt include a reluctance of many patients themselves to volunteer that they have been abused. However, a lack of awareness by practitioners is also important. Sufferers of violence frequently make contact with GP, emergency medicine physicians, obstetricians, psychiatrists, specialist physicians or in other clinical settings. Indeed, full time GP may see up to five women per week who have experienced partner violence, of which two are severe.12 Patients may present with unexplained physical injury, bruising, chronic fatigue, anxiety, depression, insomnia or undifferentiated somatic symptoms.13 Although each of these should raise the possibility of domestic violence, very frequently the warning signs are missed. Nor is it well understood why victims are so reluctant to report abuse and seek help. Power differences within relationships, especially those between men and women, and an associated sense of shame among the victims are likely to be relevant here, perhaps leading women to believe that the attacks on them were provoked by their © 2015 Royal Australasian College of Physicians 471 Editorial own failures as mothers and wives.14 Victims may also feel that help is hard to obtain, based on the common perception, that police officers are reluctant to become involved in domestic violence, seeing the problem as one of interpersonal conflict outside their legitimate responsibilities.15 The courts have contributed to this sense of a lack of support by the application until recently of the so-called ‘doctrine of provocation’ as a formal basis for excusing violence against women.16 Doctors, frequently lacking training, skills, confidence and practical resources to enable them to respond effectively, are all too often caught up in this sad labyrinth of unconscious collusion. The final result of all these factors is that doctors mostly don’t ask and women mostly don’t tell. It is not known what social and psychological forces drive some people to commit acts of violence against the people who are closest to them and who trust them most. And most importantly of all, evidence is lacking about what interventions are effective for responding to domestic violence and for preventing its occurrence in the first place.17 Up until now, attempts by the medical profession to respond to the problem have largely focused on guidelines to assist in the detection, management and referral of patients experiencing domestic violence.2,18 It is apparent that more than broad guidelines are needed. Also required are society-wide approaches that mobilise individuals and groups within the community and draw on a wide range of resources. The response must incorporate support for victims to become empowered to speak out and accept help, and understanding and management of the underlying problems of those committing the violence. Here, a move away from the traditional approach based on shame, recrimination and blame to a recognition that domestic violence is usually a symptom of deep underlying social and psychological pathologies is more likely than existing strategies to bear fruit. It is clear from this formulation that there are many ways in which doctors can help. They can provide safe trusted spaces in which both the victims and their assailants can express their pain and explore options for change. They can play a key part in detection, intervention and provision of specialised treatment of the References 1 KPMG. Cost of Violence against women and children. White ribbon international conference. Sydney Australia 13–15 May 2013. 2 The Royal Australian College of General Practitioners. Abuse and Violence: physical, mental and emotional damage caused by domestic violence. They can provide support and, where appropriate, active treatment for the direct victims of the violence as well as for all those harmed by being drawn into its fatal web; this includes the child witnesses of the violence, who often carry the damaging effects into their own subsequent relationships. However, they cannot do all this without a well coordinated, locally driven multidisciplinary team-based approach. Doctors can participate in much-needed research into the emotional and social roots of domestic violence, and development and testing of intervention programmes for both offenders and victims. The methodologies required for such research are often complex, but the experience gained from the study of other major public health problems, such as obesity, will provide a fecund resource. Above all, they can help – along with many others – in action to prevent the violence occurring in the first place. This will involve work to change prevailing assumptions that narrowly stereotype women and impose unrealistic demands on all the parties in a relationship. Preventive work must start early, involve both boys and girls, and continue throughout school years. The media could play a positive and ongoing role in promoting awareness of the nature of the problem . The contribution of domestic violence to both physical and mental health problems should be included in undergraduate and postgraduate educational programmes, including continuing professional development, to enhance the possibility of effective responses. Doctors can play an important role in developing and implementing major changes in the social response to the problem of domestic violence. It is time this was recognised and it is time they started doing so. Received 28 February 2015; accepted 8 March 2015. doi:10.1111/imj.12738 1 2 L. Piterman, P. A. Komesaroff, H. Piterman3 and K. J. Jones4 1 Berwick and Peninsula Campuses, Monash University, 2Medicine, Monash University, 3School of Primary Health Care, Monash University, and 4Office of the Pro-Vice Chancellor, Peninsula Campus, Monash University, Melbourne, Victoria, Australia Working with our Patients in General Practice. 4th edn. Melbourne: RACGP; 2014 [cited 2015 Feb 22]. Available from URL: www.racgp.org.au/your -practice/guidelines/whitebook 3 WHO. Responding to intimate partner violence and sexual violence against women: WHO clinical and policy guidelines. Geneva WHO. 2013 [cited 2015 Feb 22]. Available from URL: http://apps.who.int/iris/bitstream/ 10665/85240/1/9789241548595_eng .pdf?ua=1 4 Australian Bureau of Statistics. Personal Safety, Australia, 2012. Cat No. 4906. Canberra: ABS. © 2015 Royal Australasian College of Physicians 472 Editorial 5 ABS. Personal Safety Survey, 2006. ABS Cat. No. 4906.0. Canberra: Australian Bureau of Statistics. 6 Walsh D. The hidden experience of violence during pregnancy: a study of 400 pregnant Australian women. Aust J Prim Health 2008; 14: 97–105. 7 Victoria Police. Family Incident Reports, Victoria Police Crime Statistics 2013–2014; 2015. 8 Magistrate’s Court of Victoria. Annual Report 2012/2013, 2013 [cited 2013 Dec 18]. Available from URL: http://www .magistratescourt.vic.gov.au/sites/ default/files/Default/MCV_Annual _Report_2012-13.pdf 9 Chan A, Payne J. Homicide in Australia: 2008–2009 to 2009–2010. National Monitoring Homicide Program annual report. Canberra. Australian Government, Australian Institute of Criminology, 2013. 10 Britt H, Miller GC, Charles J, Henderson J, Bayram C, Pan Y et al. General Practice activity in Australia 2013–2014. 11 12 13 14 15 General practice series no. 36. Cat. no. GEP 36.Canberra: AIHW, 2014. Bradley F, Smith M, Long J, O’Dowd T. Reported frequency of domestic violence: cross sectional survey of women attending general practice. BMJ 2002; 324: 271–8. Hegarty K. What is intimate partner abuse and how common is it? In: Roberts G, Hegarty K, Feder G, eds. Intimate Partner Abuse and Health Professionals: New Approaches to Domestic Violence. London: Elsevier; 2006; 19–40. Hegarty K, Gunn J, Chrondos P, Small R. Association between depression and abuse by partners of women attending general practice: descriptive cross sectional survey. BMJ 2004; 328: 612–24. Australian Institute of Family Studies. The many facets of shame in intimate partner sexual violence. 2014 [cited 2014 Nov 24]. Available from URL: http://www.aifs.gov.au/acssa/pubs/ researchsummary/ressum1/rs1a.html Fagan J. The Criminalisation of Domestic Violence: Promises and Limits. National Institute of Justice Research Report. Washington, DC: National Institute of Justice; 1996. 16 The Law Institute of Victoria. Under the Crimes (Homicide) Act 2005 provocation as a defence to murder has been abolished and a new defence, ‘defensive homicide’, has been created. 2010 [cited 2015 Feb 22]. Available from URL: http://www.lawreform.vic.gov.au/all -projects/defences-homicide#sthash .moy7bzwe.dpuf 17 Breckenridge J, Hamer J. Traversing the maze of ‘evidence’ and ‘best practice’ in domestic and family violence service provision in Australia. Australian Domestic and Family Violence Clearinghouse; 2014. 18 National Institute for Health and Care Excellence (NICE). Domestic violence and abuse: how services can respond effectively. 2014 [cited 2015 Feb 22]. Available from URL: www.nice.org .uk/guidance/ph50/chapter/ recommendations © 2015 Royal Australasian College of Physicians 473 Internal Medicine Journal 45 (2015) REVIEW Physical activity and sedentary behaviour: applying lessons to chronic obstructive pulmonary disease K. Hill,1–3 P. A. Gardiner,4,5 V. Cavalheri,1,2 S. C. Jenkins1,2,6 and G. N. Healy1,4,7 1 School of Physiotherapy and Exercise Science, Faculty of Health Science, Curtin University, 2Lung Institute of Western Australia and Centre for Asthma, Allergy and Respiratory Research, University of Western Australia, 3Physiotherapy Department, Royal Perth Hospital, 6Physiotherapy Department, Sir Charles Gairdner Hospital, Perth, Western Australia, 4School of Population Health, The University of Queensland, 5Mater Research Institute, The University of Queensland, Brisbane, Queensland, and 7Heart and Diabetes Institute, Baker IDI, Melbourne, Victoria, Australia Key words physical activity, sedentary behaviour, chronic obstructive pulmonary disease. Correspondence Kylie Hill, School of Physiotherapy and Exercise Science, Curtin University, GPO Box U1987, Perth, WA 6845, Australia. Email: [email protected] Received 17 June 2014; accepted 20 August 2014. doi:10.1111/imj.12570 Abstract In health and disease, the benefits of regular participation in moderate to vigorous intensity physical activity are well documented. However, individuals with chronic conditions, such as those with chronic obstructive pulmonary disease (COPD), typically do very little activity at a moderate or vigorous intensity. Much of their day is instead spent in sedentary behaviour, such as sitting or reclining, which requires very little energy expenditure. This high level of time spent in sedentary behaviour can have serious health consequences, including increased risk of diabetes, cardiovascular disease and premature mortality. There is emerging evidence to suggest that participation in light intensity physical activities (e.g. standing or slow walking) may have benefits for cardio-metabolic health. Given the low aerobic capacity of individuals with moderate to severe COPD, increasing light intensity activity (through reducing sedentary time) may be a feasible additional strategy to improve health in this population, alongside traditional recommendations to increase the time spent in moderate to vigorous intensity physical activity. This review provides an overview of physical activity and sedentary behaviour, with a particular emphasis on these behaviours for people with COPD. It provides suggestions for the measurement of these behaviours within the clinical setting, as well as for interventions that may be effective at increasing physical activity and reducing sedentary behaviour in this population. Introduction The widespread benefits of regular participation in moderate to vigorous intensity physical activity are well established.1 However, consistent with international data, the Funding: G. N. Healy was supported by a Heart Foundation [PH 12B 7054] Fellowship and by a NHMRC Centre for Research Excellence Grant in the Translational Science of Sedentary Behaviour (APP1041056). P. A. Gardiner was supported by a NHMRC Center for Research Excellence Grant in Women’s Health in the 21st Century (APP1000986). Conflict of interest: All authors presented at the Airways annual conference in 2013. Travel and accommodation expenses and an honorarium were provided. G. N. Healy presented at an OERC (Office Ergonomics Research Committee) meeting in 2013. OERC covered travel and accommodation expenses and also provided an honorarium. G. N. Healy also presented at the 2013 ‘Juststand Wellness Summit’, a conference organised by Ergotron. Ergotron covered travel and accommodation expenses. No further honoraria or imbursements were received. The funding bodies had no influence on the conduct or the findings of the study. majority of Australian adults fail to meet the recommended levels of physical activity to produce health benefits.2 This high level of inactivity contributes significantly to healthcare costs.3 Recently, there has been a focus on sedentary behaviour, or too much sitting. Specifically, there is growing evidence that excessive sedentary time, in particular time accumulated in uninterrupted bouts of sedentary behaviour, is associated with adverse health outcomes.4,5 Individuals with chronic obstructive pulmonary disease (COPD) typically engage in very little physical activity due to exertional dyspnoea and fatigue. Although pulmonary rehabilitation, which has a focus on exercise training, has strong evidence for reducing symptoms, improving exercise tolerance and quality of life,6 and reducing healthcare utilisation7 in this patient population, there is limited evidence that pulmonary rehabilitation increases daily levels of physical activity and reduces sedentary time. This review provides an overview of the health benefits of physical activity across the spectrum, from light intensity through to moderate and vigorous intensity, as well © 2014 Royal Australasian College of Physicians 474 Activity and sitting: lessons for COPD Figure 1 An integrated and comprehensive view of activity and inactivity. Adapted from http://www.sedentarybehaviour.org/what-issedentary-behaviour.8 as the adverse health effects of too much time spent in sedentary behaviour. It includes a summary of the methods used to measure physical activity and sedentary behaviour in research and clinical settings. Estimates of time spent in physical activity and sedentary behaviour by people with COPD are described as well as some direct and ‘stealth’ interventions that aim to increase physical activity and reduce sedentary behaviour. Physical activity: definition and measurement Physical activity is defined as any bodily movement generated by skeletal muscle that results in energy expenditure.1 It is often classified as light, moderate or vigorous intensity, according to the level of energy expenditure required (Fig. 1).9 Multiple different behaviours fall under these intensity classifications. For example, light intensity physical activity would include activities, such as showering and ironing.10 In contrast, vigorous intensity physical activity would include activities, such as running and walking up hills.10 Physical activity may also be classified as activities undertaken as part of daily living, such as domestic and occupational tasks, or as exercise, which is a form of physical activity that is planned, structured and undertaken regularly with the goal of improving or maintaining fitness (Table 1).1 Obtaining accurate and detailed measures of physical activity are useful when designing and evaluating interventions to optimise activity levels. Measures of physical activity can broadly be grouped into subjective (i.e. selfreport) and objective. Subjective measures rely on an individual’s recall of their activity levels. Although data obtained through subjective measures, such as questionnaires, may lack precision,11 detailed questioning over recent time periods has been shown to improve the reliability of the data obtained.12 Subjective measures also offer the opportunity to obtain detailed information regarding the type of activities undertaken during daily life, which allows clinicians to establish targets and goals regarding participation in physical activity, based on individual preferences. The low cost associated with selfreport measures of physical activity has resulted in their widespread use in clinical practice and epidemiological research. Objective measures involve using a device, commonly a motion sensor, to capture physical activity. Devices range in complexity and price. The most basic option is a pedometer, which records the number of steps taken. More sophisticated devices may use accelerometry to measure movement and/or non-invasive physiological sensors to estimate energy expenditure. The measurement properties of these devices and their output vary Table 1 Definition of key terms9 Term Physical activity Light physical activity Moderate to vigorous physical activity MET Definition Any bodily movement produced by skeletal muscles that results in energy expenditure above resting levels. Physical activity broadly encompasses exercise, sports and physical activities done as part of daily living, occupation, leisure and active transportation. Activity with a relative intensity of 20% to <40% of VO2max. For the general population, it has been defined as activities that have an energy expenditure of >1.5 to 3 MET. It includes activities, such as showering and ironing. Activity with a relative intensity of 40% to <60% (moderate) or ≥60% (vigorous) of VO2max. For the general population, it has been defined as activities that have an energy expenditure ≥ 3 MET. It includes activities, such as brisk walk, cycling, walking uphill, rowing and running. An index of energy expenditure. One MET is equal to an oxygen uptake of 3.5 mL/kg/min, which is the rate of energy expenditure while sitting at rest. MET, metabolic equivalent of tasks; VO2max, maximum rate of oxygen uptake. © 2014 Royal Australasian College of Physicians 475 Hill et al. considerably. Most devices require technical expertise to collect, download and interpret the data. Nevertheless, technology in this area is advancing quickly, and it is likely that the collection of robust physical activity data through objective methods will be feasible for clinicians in the near future. Further information on the measurement of physical activity is available elsewhere.13,14 Health effects of moderate to vigorous physical activity In adults, the benefits of regular participation in moderate to vigorous intensity physical activity have been well established and include a reduction in the risk of cardiovascular disease as well as all-cause mortality.1 These effects are likely to be mediated by several mechanisms, including production, expression and release of myokines by the skeletal muscle, improvement in endothelial function, cardiovascular fitness and insulin sensitivity, maintenance of a healthy body weight, preservation of fat-free mass and a reduction in circulating systemic inflammatory biomarkers.1,15 Evidence of health benefits has resulted in a range of public health messages designed to promote participation in daily physical activity, with current guidelines from the United States recommending that adults perform a minimum of 150 min of moderate intensity physical activity or 75 min of vigorous intensity physical activity each week.1 However, despite the obvious health benefits of an active lifestyle, 31% of adults worldwide do not meet these guidelines and are considered physically inactive.16 This high level of inactivity has serious public health and economic consequences, with low levels of physical activity increasing the risk of developing conditions, such as obesity and type II diabetes.1 Further, there is evidence to suggest that low levels of physical activity also play a part in the development of some cancers, dementia and mood disturbances, such as depression.1 Overall, low levels of physical activity have been estimated to account for 9% of premature mortality, or more than 5.3 million deaths worldwide each year.17 What about time spent in activity other than moderate to vigorous physical activity? To date, much of the public health research and resources have been targeted towards increasing population levels of moderate to vigorous intensity activity. However, on average, adults spend more than 90% of their waking day in activities other than those classified as moderate or vigorous intensity.3 Even if an individual was to undertake the minimum of 30 min/day of moderate to vigorous intensity activity specified in public health guidelines,1 time in this activity intensity would still constitute less than 5% of a typical 16-h waking day. Accordingly, a more comprehensive view of inactivity has increasingly penetrated research, policy and practice. This approach considers activities across a spectrum from sedentary, to light intensity activity to moderate and vigorous, with a focus on understanding the distribution and health effects across this range of physical activity (Fig. 1). Sedentary behaviour: definition and measurement On average, the majority (46–59%) of adults spend their waking hours at the low end of the spectrum, that is, in sedentary behaviour.3 Sedentary behaviours are defined both by low energy expenditure (<1.5 metabolic equivalent of tasks) and a sitting or reclining posture.18 They occur throughout the waking day (i.e. sleep is not considered a sedentary behaviour), and across work, leisure, domestic and transport domains. Common behaviours that occur while sedentary include television viewing, reading, driving, using a computer and playing cards. Importantly, an individual can be both physically active (i.e. meet the physical activity guidelines)1 and highly sedentary; a concept coined ‘the active couch potato’.19 As outlined later, time spent in both physical activity and sedentary behaviour contributes to health outcomes. As is the case for physical activity, both subjective and objective measures can be used to measure sedentary time. In addition to measuring the total time spent in sedentary behaviours, measures can also be used to assess behaviours within individuals and groups, in the context of the domains in which they occur. To date, self-report measures of time spent in sedentary behaviour have typically being used, with generally good reliability, but poorto-modest validity.20 More recently, methods, such as past day recall show improved validity over previous recall periods, and may be useful for large-scale implementation.21 However, even a simple question, such as ‘in the last week, how much time per day would you typically spend sitting down?’ could be useful in a clinical setting to provide tailored advice and monitor changes over time. Objective measures, such as those derived from accelerometers and inclinometers, have also been used to measure sedentary time. Importantly, these devices provide date and time stamped data, which enable analysis of not only the total amount of time spent in sedentary behaviours, but also how and when the sedentary time was accumulated. Ideally, such measures derive sedentary time not only from low energy expenditure, © 2014 Royal Australasian College of Physicians 476 Activity and sitting: lessons for COPD but also posture in order to distinguish time spent sedentary (low energy, sitting or reclining posture) from time spent standing (low energy, upright posture). Postural-based measures, such as the activPAL monitor (PAL Technologies, Glasgow, UK), have been shown to be highly accurate compared to direct observation,22 and their use is becoming more widespread within both intervention and observation research. However, these objective measures do not capture domain or behaviourspecific information; contextual information that is useful for the development of intervention targets aimed at individuals and public health messages on how to reduce sedentary time. Therefore, it is recommended that a combination of both self-report and objective measures is used.20 Health impacts of too much sitting The last decade has seen rapid advances in our understanding of the relationship between time spent in sedentary behaviours and health outcomes. A recent review reported that those categorised in the most sedentary group, regardless of how it was measured, had on average, twice the risk of developing type II diabetes or cardiovascular disease, or of dying from cardiovascular disease, and 1.5 times the risk of dying prematurely compared to those in the group who were the least sedentary.5 Detrimental associations with excessive sedentary time have also been observed with weight gain, depressive symptoms, biomarkers of chronic disease risk (including triglycerides, HDL cholesterol and insulin), musculoskeletal symptoms, poor quality of life and chronic kidney disease.23 Notably, although those who are both inactive and have high sedentary time are at the highest risk, even in those who met physical activity guidelines (i.e. are ‘active’), detrimental associations with sedentary time have been observed.19 This highlights the need to measure both sedentary time and physical activity within lifestyle assessments. Mechanisms proposed for the associations observed include the minimal muscular contractions in the large postural muscles occurring during sitting,24 together with the lower energy expenditure compared to non-sedentary behaviours.25 Importantly, it is not just total sedentary time that appears to be relevant for health, but also the manner in which it is accumulated. Regularly interrupting sedentary time, with either light or moderate intensity activity, has been beneficially associated with biomarkers of chronic disease.26 Conversely, long, unbroken periods of sitting have been associated with increased insulin resistance and poor glycaemic control.4,27 This evidence has informed the development of national and international recommendations to minimise the amount of time spent in prolonged sitting and to break up sitting as often as possible.1,28 Although sufficient robust evidence regarding ‘how often should we get up?’ is not yet available, a practical message may be to ‘sit less throughout the day, and stand up at least every 30 minutes’. If not sedentary, then what? The strong negative correlations observed between sedentary time and light intensity physical activity29 suggests that if we are not sedentary, we are typically undertaking light intensity activities. This highly heterogenous group of behaviours includes standing, incidental movement and slow walking; activities that are difficult to quantify through self-report measurement tools. Correspondingly, despite being high volume (on average, 37% to 46% of adults’ waking hours),3 little is known about the health effects of behaviours that fall within the light intensity physical activity spectrum. Nevertheless, associations observed with light intensity physical activity tend to be opposite to those demonstrated with sedentary time.30 Of note, there is preliminary evidence to suggest that there are cardio-metabolic benefits for those who have a positive light-sedentary balance (i.e. more time is spent in light intensity physical activity than sedentary), even if recommended levels of moderate to vigorous intensity physical activity are not achieved.30 Though it is ideal if adults have both low sedentary time, and high moderate to vigorous intensity physical activity time,30 these findings collectively suggest that there may also be benefit from shifting sedentary time to light intensity activities; a potentially more feasible and acceptable target for change especially for those with chronic conditions, such as COPD. How are physical activity and sedentary time affected in people with COPD? Dyspnoea and fatigue during daily activities are frequently reported by people with COPD and appear to contribute to the low levels of physical activity undertaken in this population.31 Specifically, there are now robust data showing that people with COPD participate in less physical activity when compared with healthy people of a similar age. One of the first studies reporting this difference using an objective measure of physical activity showed that people with COPD spent less time standing and walking when compared with healthy adults of a similar age and gender proportion (Fig. 2).32 A review of 11 studies that measured physical activity levels in people with COPD and healthy controls revealed that the proportion of time people with COPD spent participating in © 2014 Royal Australasian College of Physicians 477 Hill et al. Figure 2 Physical activity and sedentary behaviour of people with chronic obstructive pulmonary disease (COPD). Adapted from Pitta et al. 2005.32 physical activity, relative to the healthy controls, was 57%.33 The level of physical activity of people with COPD decreases with increased disease severity and in response to an acute exacerbation.34,35 Besides engaging in lower levels of physical activity, people with COPD spend a large proportion of their waking hours sitting and lying down.32 That is, compared to healthy controls, during waking hours, people with COPD spend nearly 25% more time sitting and 200% more time lying down (Fig. 2).32 In contrast to data on physical activity, sedentary time does not seem to differ across severities of COPD.36 Of note, it appears that sitting time in this population is associated with lower exercise capacity, lower motivation to exercise and higher number of exacerbations in the past year.36 physical activity by individuals with a chronic health condition is likely to have additional health consequences to those described in the general population. That is, in addition to the impairments imposed by the disease process itself, deconditioning of both the cardiovascular system and muscles of locomotion resulting from participation in low levels of physical activity often contributes to their decline in functional status.40 This has led to an interest in the role of rehabilitative strategies that aim to optimise participation in physical activity in people with a chronic health condition. Health benefits of physical activity and consequences of low levels of physical activity in people with COPD There are broadly two approaches to increasing physical activity; direct and ‘stealth’ interventions. Direct interventions use strategies to influence directly physical activity, while ‘stealth’ interventions may target other values and beliefs that extend beyond health to increase physical activity. Data pertaining to interventions that may improve sedentary behaviour in people with COPD are scarce. Regarding physical activity, one direct intervention that has received attention in people with COPD is the use of exercise training, within the framework of pulmonary rehabilitation. Despite achieving strong evidence for reducing symptoms of dyspnoea and fatigue, increasing exercise capacity, improving quality of life6 and reducing hospitalisations related to acute exacerbations of COPD,7 the effects of exercise training on physical activity appear to be limited. A systematic review and The benefits of participating in regular physical activity are not limited to the general population. Specifically, in people with COPD, regular participation in physical activity has been shown to reduce the risk of hospitalisation and lower all-cause mortality.37 Higher levels of physical activity in those with COPD also appear to minimise extrapulmonary manifestations of the disease, such as systemic inflammation and cardiac dysfunction.38 The benefits of physical activity appear to be present prior to the development of COPD as current smokers who participate in regular physical activity have a reduced rate of decline in lung function.39 Participation in low levels of How can we change physical activity and sedentary behaviour in people with COPD? © 2014 Royal Australasian College of Physicians 478 Activity and sitting: lessons for COPD meta-analysis of seven studies (two randomised trials and five single-group interventional studies) examining the effect of exercise training on physical activity in a total of 472 people (419 males) with COPD demonstrated minimal change, with an overall effect size of 0.12 (P = 0.01),41 which was equivalent to an increase of approximately 5 min per day. This small change may be because pulmonary rehabilitation programmes lack an effective behavioural component that targets changes in physical activity outside of what people complete as part of their structured exercise. Examining the effects of embedding psychosocial interventions in pulmonary rehabilitation programs is a promising area for future research and may have real potential for changing physical activity and sedentary time in people with compromised lung function.42 A recent study in overweight and obese adults showed that combining a behavioural intervention with prescribed exercise increased physical activity more so than exercise prescription alone.43 This would suggest the utility of this approach in people with chronic conditions. The recent Lancet series on physical activity contained a comprehensive review of approaches for increasing physical activity within different population groups, and found strong evidence for behavioural and social approaches.44 Interventions within the primary care setting are successful at increasing the self-reported physical activity levels of inactive individuals at 12 months, with recent reviews of physical activity interventions in adults45 and older adults46 reporting that interventions containing behavioural strategies, such as goal setting, self-monitoring and feedback were most effective. Nevertheless, in people with COPD who are commencing a pulmonary rehabilitation programme, the timing of such interventions may be critical given that for many people, it may be too much to commence a regular exercise programme and at the same time undertake more physical activity in their daily life. An example of an evidence-based behavioural approach used in the primary care setting is the 5As approach. This has been used widely in smoking cessation47 and was adopted in the 2013 National Health and Medical Research Council clinical practice guidelines for the management of overweight and obesity in adults, adolescents and children in Australia as a useful framework for general practitioners to help obese patients manage their weight and is based on: Assess level of behaviour; Advise based on personal health risks; Agree on a realistic set of goals; Assist to anticipate barriers and develop a specific action plan; and, Arrange follow-up support. Figure 3 contains an example of how this approach may be used in clinical practice to influence sedentary behaviour. Figure 3 Example of using a ‘stealth’ behaviour to increase physical activity by reducing sedentary time. Rather than direct interventions to increase physical activity, it is possible that ‘stealth’ interventions, such as reducing time spent in sedentary behaviours (e.g. television viewing)48 in order to increase physical activity, may offer greater success in people with COPD. This fits nicely with the premise that sedentary behaviour is a new health behaviour change target in its own right. While most sedentary behaviour interventions have been conducted with children and adolescents, emerging evidence suggests the utility of this stealth approach in adults. Three studies (all in non-COPD populations) are worth noting here. TView evaluated a 3-week programme using an electronic television lock-out system with 36 overweight and obese participants aged 22–61 years.49 Stand Up For Your Health50 took a whole-of-day approach to reduce and interrupt prolonged sedentary time, targeting television time as well as other sedentary behaviours, such as sitting and reading, or engaging in computer use. This single-group feasibility study conducted over 2 weeks with 59 older adults (aged 60–92 years) used a face-to-face goal-setting consultation and one tailored mailing.50 The final single group feasibility study was conducted with 24 older adults (aged mean ± SD, 68 ± 6 years) and also used a face-to-face consultation and feedback on sedentary time as part of the intervention.51 All three interventions achieved around a 30 min per day reduction in sedentary time (24 to 37 min per day), of which approximately one third (7 to 13 min/day) of this time was reallocated to moderate to vigorous intensity physical activity. The findings from these studies suggest that changes in sedentary time are achievable and that increases in physical activity are likely. Environmental changes, such as devices to limit the amount of TV a person watches, may be difficult to implement; however, behavioural approaches produced similar changes in sedentary time. © 2014 Royal Australasian College of Physicians 479 Hill et al. The consultation sessions in the two feasibility studies49,50 used concepts from the 5As approach in that they: assessed participants’ level of sedentary time (using devices); advised participants of the pros and cons of reducing sedentary time; agreed on a set of goals (in conjunction with the participants); and assisted with overcoming barriers. No arrangements were made for follow-up support. These interventions took an average of 45 min50 and 30 min51 to deliver. The appeal of these approaches is that they are simple, achievable and unlikely to do any harm. However, randomised trials of longer term interventions are needed to evaluate intervention efficacy in a range of populations. While these studies were conducted in non-COPD populations, they were in overweight and obese and older adult populations with a range of chronic conditions. Earlier work has suggested that people with COPD utilise 58% of their aerobic capacity to complete usual activities of daily living.52 This is considerably more than individuals with normal aerobic capacity, who have been estimated to utilise 40% of their aerobic capacity during usual activities of daily living.53 Given the limited aerobic capacity of individuals with COPD, an intervention focussed on increasing light intensity physical activity References 1 Garber CE, Blissmer B, Deschenes MR, Franklin BA, Lamonte MJ, Lee IM et al. American College of Sports Medicine position stand. Quantity and quality of exercise for developing and maintaining cardiorespiratory, musculoskeletal, and neuromotor fitness in apparently healthy adults: guidance for prescribing exercise. Med Sci Sports Exerc 2011; 43: 1334–59. 2 Australian Bureau of Statistics. Let’s get physical: how do adult Australians measure up? Perspectives on Sport. 2013. [cited 2015 Apr 11]. Available from URL: http://www.abs.gov.au/ausstats/ [email protected]/Lookup/4156.0.55.001Main+ Features3Nov%202013 3 Owen N, Salmon J, Koohsari MJ, Turrell G, Giles-Corti B. Sedentary behaviour and health: mapping environmental and social contexts to underpin chronic disease prevention. Br J Sports Med 2014; 48: 174–7. 4 Dunstan DW, Kingwell BA, Larsen R, Healy GN, Cerin E, Hamilton MT et al. Breaking up prolonged sitting reduces postprandial glucose and insulin 5 6 7 8 9 and breaking up time spent in sedentary behaviour may be more appropriate in this population than one focussed primarily on increasing time spent in moderate to vigorous intensity physical activity. The development of such interventions – a key area for future research in individuals with COPD – should consider the approaches described above (i.e. the 5As; stealth interventions) in conjunction with evidence-based intervention strategies (e.g. motivational interviewing; self-monitoring) for behaviour change. Conclusion This paper has reviewed the benefits of physical activity and the adverse effects of sedentary behaviour. Exertional dyspnoea and fatigue pose additional challenges for people with COPD when attempting to undertake physical activity. Strategies are needed to assist both healthy individuals and those with chronic conditions, such as COPD to: (i) increase the time spent in physical activity (which includes activity across the intensity spectrum); (ii) reduce total time spent sitting; and (iii) break up any periods of prolonged sitting across the day. responses. Diabetes Care 2012; 35: 976–83. Wilmot EG, Edwardson CL, Achana FA, Davies MJ, Gorely T, Gray LJ et al. Sedentary time in adults and the association with diabetes, cardiovascular disease and death: systematic review and meta-analysis. Diabetologia 2012; 55: 2895–905. Lacasse Y, Goldstein R, Lasserson TJ, Martin S. Pulmonary rehabilitation for chronic obstructive pulmonary disease. Cochrane Database Syst Rev 2006; (4): CD003793. Griffiths TL, Burr ML, Campbell IA, Lewis-Jenkins V, Mullins J, Shiels K et al. Results at 1 year of outpatient multidisciplinary pulmonary rehabilitation: a randomised controlled trial. Lancet 2000; 355: 362–8. Sedentary Behaviour Research Network. What is sedentary behaviour? [cited 2014 Aug 14]. Available from URL: http://www.sedentarybehaviour .org/what-is-sedentary-behaviour/ Norton K, Norton L, Sadgrove D. Position statement on physical activity and exercise intensity terminology. J Sci Med Sport 2010; 13: 496–502. 10 Ainsworth BE, Haskell WL, Whitt MC, Irwin ML, Swartz AM, Strath SJ et al. Compendium of physical activities: an update of activity codes and MET intensities. Med Sci Sports Exerc 2000; 32(9 Suppl): S498–504. 11 Prince SA, Adamo KB, Hamel ME, Hardt J, Connor Gorber S, Tremblay M. A comparison of direct versus self-report measures for assessing physical activity in adults: a systematic review. Int J Behav Nutr Phys Act 2008; 5: 56. 12 Hunt T, Williams MT, Olds TS. Reliability and validity of the multimedia activity recall in children and adults (MARCA) in people with chronic obstructive pulmonary disease. PLoS ONE 2013; 8: e81274. 13 Murphy SL. Review of physical activity measurement using accelerometers in older adults: considerations for research design and conduct. Prev Med 2009; 48: 108–14. 14 van Poppel MN, Chinapaw MJ, Mokkink LB, van Mechelen W, Terwee CB. Physical activity questionnaires for adults: a systematic review of measurement properties. Sports Med 2010; 40: 565–600. © 2014 Royal Australasian College of Physicians 480 Activity and sitting: lessons for COPD 15 Pedersen BK, Febbraio MA. Muscles, exercise and obesity: skeletal muscle as a secretory organ. Nat Rev Endocrinol 2012; 8: 457–65. 16 Hallal PC, Andersen LB, Bull FC, Guthold R, Haskell W, Ekelund U et al. Global physical activity levels: surveillance progress, pitfalls, and prospects. Lancet 2012; 380: 247–57. 17 Lee IM, Shiroma EJ, Lobelo F, Puska P, Blair SN, Katzmarzyk PT et al. Effect of physical inactivity on major non-communicable diseases worldwide: an analysis of burden of disease and life expectancy. Lancet 2012; 380: 219–29. 18 Sedentary Behaviour Research Network. Letter to the editor: standardized use of the terms ‘sedentary’ and ‘sedentary behaviours’. Appl Physiol Nutr Metab 2012; 37: 540–2. 19 Healy GN, Dunstan DW, Salmon J, Shaw JE, Zimmet PZ, Owen N. Television time and continuous metabolic risk in physically active adults. Med Sci Sports Exerc 2008; 40: 639–45. 20 Healy GN, Clark BK, Winkler EA, Gardiner PA, Brown WJ, Matthews CE. Measurement of adults’ sedentary time in population-based studies. Am J Prev Med 2011; 41: 216–27. 21 Matthews CE, Keadle SK, Sampson J, Lyden K, Bowles HR, Moore SC et al. Validation of a previous-day recall measure of active and sedentary behaviors. Med Sci Sports Exerc 2013; 45: 1629–38. 22 Kozey-Keadle S, Libertine A, Lyden K, Staudenmayer J, Freedson PS. Validation of wearable monitors for assessing sedentary behavior. Med Sci Sports Exerc 2011; 43: 1561–7. 23 Tremblay MS, Colley RC, Saunders TJ, Healy GN, Owen N. Physiological and health implications of a sedentary lifestyle. Appl Physiol Nutr Metabol 2010; 35: 725–40. 24 Hamilton MT, Hamilton DG, Zderic TW. Role of low energy expenditure and sitting in obesity, metabolic syndrome, type 2 diabetes, and cardiovascular disease. Diabetes 2007; 56: 2655–67. 25 Levine JA, Miller JM. The energy expenditure of using a ‘walk-and-work’ desk for office workers with obesity. Br J Sports Med 2007; 41: 558–61. 26 Healy GN, Matthews CE, Dunstan DW, Winkler EA, Owen N. Sedentary time and cardio-metabolic biomarkers in US adults: NHANES 2003–06. Eur Heart J 2011; 32: 590–7. 27 Buckley JP, Mellor DD, Morris M, Joseph F. Standing-based office work shows encouraging signs of attenuating post-prandial glycaemic excursion. Occup Environ Med 2014; 71: 109–11. 28 Australian Government Department of Health. Australia’s Physical Activity and Sedentary Behaviour Guidelines. 2014. 29 Healy GN, Dunstan DW, Salmon J, Cerin E, Shaw JE, Zimmet PZ et al. Objectively measured light-intensity physical activity is independently associated with 2-h plasma glucose. Diabetes Care 2007; 30: 1384–9. 30 Loprinzi PD, Lee H, Cardinal BJ. Daily movement patterns and biological markers among adults in the United States. Prev Med 2014; 60: 128–30. 31 Vestbo J, Hurd SS, Agustí AG, Jones PW, Vogelmeier C, Anzueto A et al. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: GOLD executive summary. Am J Respir Crit Care Med 2013; 187: 347–65. 32 Pitta F, Troosters T, Spruit MA, Probst VS, Decramer M, Gosselink R. Characteristics of physical activities in daily life in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2005; 171: 972–7. 33 Vorrink SN, Kort HS, Troosters T, Lammers JW. Level of daily physical activity in individuals with COPD compared with healthy controls. Respir Res 2011; 12: 33. 34 Watz H, Waschki B, Meyer T, Magnussen H. Physical activity in patients with COPD. Eur Respir J 2009; 33: 262–72. 35 Pitta F, Troosters T, Probst VS, Spruit MA, Decramer M, Gosselink R. Physical activity and hospitalization for exacerbation of COPD. Chest 2006; 129: 536–44. 36 Hartman JE, Boezen HM, de Greef MH, Ten Hacken NH. Physical and psychosocial factors associated with physical activity in patients with chronic obstructive pulmonary disease. Arch Phys Med Rehabil 2013; 94: 2396–2402. 37 Garcia-Aymerich J, Lange P, Benet M, Schnohr P, Anto JM. Regular physical activity reduces hospital admission and mortality in chronic obstructive pulmonary disease: a population based cohort study. Thorax 2006; 61: 772–8. 38 Watz H, Waschki B, Beoehme C, Claussen M, Meyer T, Magnussen H. Extrapulmonary effects of chronic 39 40 41 42 43 44 45 46 47 48 49 obstructive pulmonary disease on physical activity. Am J Respir Crit Care Med 2008; 177: 743–51. Garcia-Aymerich J, Lange P, Benet M, Schnohr P, Anto JM. Regular physical activity modifies smoking-related lung function decline and reduces risk of chronic obstructive pulmonary disease: a population-based cohort study. Am J Respir Crit Care Med 2007; 175: 458–63. Maltais F, LeBlanc P, Whittom F, Simard C, Marquis K, Bélanger M et al. Oxidative enzyme activities of the vastus lateralis muscle and the functional status in patients with COPD. Thorax 2000; 55: 848–53. Cindy Ng LW, Mackney J, Jenkins S, Hill K. Does exercise training change physical activity in people with COPD? A systematic review and meta-analysis. Chron Respir Dis 2012; 9: 17–26. Troosters T, van der Molen T, Polkey M, Rabinovich RA, Vogiatzis I, Weisman I et al. Improving physical activity in COPD: towards a new paradigm. Respir Res 2013; 14: 115. Kozey-Keadle S, Staudenmayer J, Libertine A, Mavilia M, Lyden K, Braun B et al. Changes in sedentary time and physical activity in response to an exercise training and/or lifestyle intervention. J Phys Act Health 2014; 11: 1324–33. Heath GW, Parra DC, Sarmiento OL, Andersen LB, Owen N, Goenka S et al. Evidence-based intervention in physical activity: lessons from around the world. Lancet 2012; 380: 272–81. Michie S, Abraham C, Whittington C, McAteer J, Gupta S. Effective techniques in healthy eating and physical activity interventions: a meta-regression. Health Psychol 2009; 28: 690–701. King AC. Physical activity for an aging population. Public Health Rev 2010; 32: 401–26. Papadakis S, McDonald P, Mullen KA, Reid R, Skulsky K, Pipe A. Strategies to increase the delivery of smoking cessation treatments in primary care settings: a systematic review and meta-analysis. Prev Med 2010; 51: 199–213. Robinson T. Stealth Interventions for Obesity Prevention and Control: Motivating Behavior Change. Vol. 2010. New York, NY: Elsevier Inc; 2010. Otten JJ, Jones KE, Littenberg B, Harvey-Berino J. Effects of television viewing reduction on energy intake © 2014 Royal Australasian College of Physicians 481 and expenditure in overweight and obese adults: a randomized controlled trial. Arch Intern Med 2009; 169: 2109–15. 50 Gardiner PA, Eakin EG, Healy GN, Owen N. Feasibility of reducing older adults’ sedentary time. Am J Prev Med 2011; 41: 174–7. 51 Fitzsimons CF, Kirk A, Baker G, Michie F, Kane C, Mutrie N. Using an individualised consultation and activPAL feedback to reduce sedentary time in older Scottish adults: results of a feasibility and pilot study. Prev Med 2013; 57: 718–20. 52 Hill K, Dolmage TE, Woon L, Coutts D, Goldstein R, Brooks D. Defining the relationship between average daily energy expenditure and field-based walking tests and aerobic reserve in COPD. Chest 2012; 141: 406–12. 53 Wasserman K, Hansen J, Sue D, Whipp B. Principles of Exercise Testing and Interpretation.Philadelphia, PA: Lippincott, Williams and Wilkins; 2005. C L I N I C A L P E R S P E CT I V E S Familial colorectal cancer M. S. Lung,1 A. H. Trainer,1,2,3 I. Campbell1 and L. Lipton3 1 Research Division and 2Familial Cancer Centre, Peter MacCallum Cancer Centre and 3Familial Cancer Centre, Royal Melbourne Hospital, Melbourne, Victoria, Australia Key words colorectal neoplasm, adenomatous polyposis coli, hereditary nonpolyposis, neoplastic syndrome, hereditary. Correspondence Lara Lipton, Familial Cancer Clinic, Royal Melbourne Hospital, Parkville, Vic. 3050, Australia. Email: [email protected] Abstract Identifying individuals with a genetic predisposition to developing familial colorectal cancer (CRC) is crucial to the management of the affected individual and their family. In order to do so, the physician requires an understanding of the different gene mutations and clinical manifestations of familial CRC. This review summarises the genetics, clinical manifestations and management of the known familial CRC syndromes, specifically Lynch syndrome, familial adenomatous polyposis, MUTYH-associated neoplasia, juvenile polyposis syndrome and Peutz–Jeghers syndrome. An individual suspected of having a familial CRC with an underlying genetic predisposition should be referred to a familial cancer centre to enable pre-test counselling and appropriate follow up. Received 27 August 2014; accepted 24 February 2015. doi:10.1111/imj.12736 Introduction Australia and New Zealand have the highest incidence rate of colorectal cancer (CRC) in the world, with an Funding: M. S. Lung is funded by the Cancer Council of Victoria and The University of Melbourne. Conflict of interest: None. Abbreviations APC, adenomatous polyposis coli; CHRPE, congenital hypertrophy of the retinal pigment epithelium; CI, confidence interval; CRC, colorectal cancer; FAP, familial adenomatous polyposis; HHT, hereditary haemorrhagic telangiectasia; HR, hazard ratio; IHC, immunohistochemistry; JPS, juvenile polyposis syndrome; LS, Lynch syndrome; MMR, mismatch repair; MSI, microsatellite instability; OR, odds ratio; PJS, Peutz–Jeghers syndrome. age-adjusted rate of 46 per 100 000 men and 32 per 100 000 women in 2008.1 The risk of developing CRC by age 85 is 1 in 10 for men and 1 in 15 for women.2 Approximately 30% of the risk of sporadic CRC is thought to be due to inherited genetic factors.3 Conversely, hereditary CRC syndromes with a known highrisk genetic aetiology make up approximately 5% of CRC. Such disorders include Lynch syndrome (LS), familial adenomatous polyposis (FAP), MUTYH-associated neoplasia and the hamartoma syndromes (Table 1). Identification of individuals and families with these syndromes allows the implementation of effective surveillance strategies which result in a reduction in cancer incidence and death in many cases. Here we discuss the genetics, clinical manifestations and management of the known familial CRC syndromes, © 2015 Royal Australasian College of Physicians 482 Familial colorectal cancer Table 1 Summary of main familial colorectal cancer syndromes with associated genes and phenotypes Syndrome Associated gene(s) Lynch syndrome MLH1, MSH2, MSH6, PMS2, EPCAM APC Colonic phenotype Major extra-colonic associations Endometrial, ovarian, gastric, small bowel, urinary tract, brain, biliary cancers; sebaceous gland tumours; keratoacanthomas Gastric fundic polyps; duodenal adenomas; papillary thyroid cancer; medulloblastomas; desmoids; osteomas Duodenal polyposis; other associations not fully defined MUTYH-associated neoplasia Juvenile polyposis syndrome MUTYH SMAD4, BMPR1A CRC often R-sided; tends to be poorly-differentiated; mucinous/signet ring histology; lymphocytic infiltrate Multiple adenomatous polyps (10–1000 s) adenomatous polyps or CRC without adenomatous polyps Juvenile polyps Peutz–Jeghers syndrome STK11 Hamartomas Classical FAP and offer guidelines on whom to refer to a familial cancer clinic for risk assessment and potential genetic testing. Lynch syndrome LS (hereditary non-polyposis CRC, HNPCC) is the most common inherited CRC syndrome, accounting for approximately 3% of all CRC diagnoses.4 Genetics LS is an autosomal dominant syndrome caused by a mutation in one of four mismatch repair (MMR) genes (MLH1, MSH2, MSH6, PMS2) or the EPCAM gene, which is situated upstream of MSH2. Interestingly, EPCAM is not involved in MMR, but deletions in this gene indirectly cause abrogation of MSH2 function.5,6 Germline MLH1 and MSH2 mutations account for >80% of LS cases,7 MSH6 for up to 10%,7 PMS2 for 2–3% and EPCAM for 1–3%.8 It is likely that PMS2 mutations make a significant contribution to LS but the exact extent of this contribution is currently unclear because of difficulties in distinguishing genuine mutations in this gene from those present in numerous pseudogenes.9 The types of inactivating mutations in the MMR genes include frameshift, nonsense, splice site, missense/ in-frame deletions or genomic rearrangements which can occur throughout each gene.10,11 Amino acid altering missense mutations are more common in MLH1 than MSH2.12 Large deletions of the 3′ end of the EPCAM gene result in transcriptional read-through and epigenetic silencing of MSH2.5 Founder mutations have also been described such as an A→T transversion in the donor splice site of intron 5 of MSH2, which occurs in Newfoundland,13 but also occurs as a recurrent mutation worldwide and may account for up to 10% of LS cases.14 Juvenile polyps throughout gastrointestinal tract; increased risk of small bowel, stomach and pancreas cancers Hereditary haemorrhagic telangiectasia Mucocutaneous pigmentation Hamartomas throughout gastrointestinal tract; increased risk of breast, stomach, pancreatic and gynaecological cancers LS tumours arise when the wild type copy of the gene is lost in the tumour, resulting in inactivation of the MMR pathway in the tumour. This causes an accumulation of errors in long repetitive stretches of DNA called microsatellites, resulting in alleles of differing lengths or ‘microsatellite instability’ (MSI).15,16 Genes with microsatellites in their coding region often undergo frameshift mutations in MSI tumours and include genes involved in cell proliferation, apoptosis and DNA repair such as TCF4, ILGFR-2, TGFBR2, AXIN2, BAX, PTEN, CHK1, MLH3, MSH3 and MSH6.17 In LS, cancers may harbour somatic mutations in KRAS and adenomatous polyposis coli (APC) but rarely BRAF.18 Clinical features and genotype-phenotype correlations Individuals with LS are at risk of developing CRC at an earlier age (median age 45)4 than the general population (median age 71). They have a varying risk to age 70 years of developing CRC which depends upon the gene that is mutated (Table 2). The majority (∼70%) of CRC develop proximal to the splenic flexure.20 CRC in LS tends to be poorly differentiated, have mucinous or signet ring histology and have a marked lymphocytic infiltrate.4 Female carriers of a LS mutation carry a 12–54% lifetime risk of endometrial cancer depending on the gene mutated and a risk of ovarian cancer between 1% and 38% (Table 1).10 Other LS-associated cancers include gastric cancer, small bowel adenocarcinoma, transitional cell carcinoma of bladder, ureters or renal pelvis, biliary tract cancer, glioblastomas (previously known as Turcot variant) and sebaceous gland tumours and © 2015 Royal Australasian College of Physicians 483 Lung et al. Table 2 Cumulative cancer risk to age 70 years by mutation type in Lynch syndrome Mismatch repair gene mutation MLH110 MSH210 MSH610 PMS211 EPCAM19 CRC risk (%) 41 48 12 15–20 75 Endometrial cancer risk (%) Ovarian cancer risk (%) Gastric cancer risk (%) Small bowel cancer risk (%) Urinary tract cancer risk (%) Brain cancer risk (%) Biliary tract cancer risk (%) 54 21 16 15 12 20 38 1 6 0.2 0 0.4 1.1 0 0.2 2.2 0.7 ≤3 ≤3 ≤3 1.9 keratoacanthomas (previously known as Muir–Torre variant).4,21 The risk of these cancers varies with the specific gene mutated. Diagnosis of LS The revised Bethesda guidelines22 were developed to help clinicians decide on which CRC to test for MSI. These guidelines are highly sensitive but have poor specificity.23 The Amsterdam criteria24 have been used since prior to the discovery of MMR gene mutations to identify LS families.24 They remain highly specific for LS mutations (60–70%) but do not have the sensitivity to be used for population screening. Molecular testing of CRC using MSI or immunohistochemistry (IHC) for the four MMR proteins is used, where possible, to aid in choosing patients for Lynch syndrome genetic testing. The sensitivity of both methods is high and comparable.25 These tests are also useful in screening for LS in endometrial cancer.26 Certain caveats apply to IHC testing however. False negatives may occur if the protein is present but not functional, which can occur in the presence of germline pathogenic missense mutations.27 Also, 15% of sporadic CRC harbour somatic hypermethylation of the MLH1 promoter causing an MSI phenotype in the cancers with loss of MLH1 IHC and may therefore be mistaken for LS.28 These patients do not have LS and 40% of these CRC may harbour a V600E BRAF mutation that is very rare in LS.29 If a mutation is found in a MMR gene, predictive genetic testing can be offered to unaffected family members before the age at which screening should commence. Surveillance and management CRC surveillance in LS reduces CRC-related mortality,30,31 is estimated to increase life expectancy by 7 years32 and is cost-effective.32 There is non-randomised, controlled trial evidence that three yearly colonoscopies reduce incidence and mortality from CRC in LS33; however, level IIIC evidence favours 1–2-year intervals between colonoscopies due to the rapid adenoma to carcinoma development in LS and this is the standard practice in Australia.4,34–36 LS mutation carriers should start surveillance colonoscopy at the ages of 25 or 5 years prior to the earliest diagnosis of CRC in the family, whichever is younger.36 There is no recommended age at which surveillance colonoscopies should be stopped. Guidelines based on expert consensus regarding the management of LS34 suggest that screening for extracolonic cancers should ideally be done as part of a clinical trial as no direct evidence for reduction in mortality from screening is available. Prophylactic hysterectomy and bilateral salpingo-oopherectomy is recommended for female mutation carriers when they have completed their families and reached the age of 40 years34 as no effective surveillance exists for ovarian or endometrial cancer.37,38 For patients with a family history of gastric cancer or those from a high-risk background (Chinese, Korean, Japanese, Chilean), second yearly gastroscopy may be considered. Surgical management of CRC in LS When a LS mutation carrier develops CRC, several factors need to be considered when deciding between a partial colectomy and a subtotal colectomy. The risk of interval cancers on surveillance colonoscopies post partial colectomy is between 6% and 35%.34 However, no difference in 10-year survival was seen in a retrospective cohort study of 382 patients who underwent either extended colectomy or a segmental resection for their first CRC, despite a metachronous CRC rate of 0% in those who had an extended colectomy versus 22% for those who had a segmental resection.39 In a separate study, quality of life did not differ significantly between 23 patients who had a segmental operation compared with 27 patients who had extended surgery.40 Both the European Society of Medical Oncology 2013 familial CRC guidelines36 and the LS management guidelines by the Mallorca group34 recommend discussing the option of an extended colectomy with a © 2015 Royal Australasian College of Physicians 484 Familial colorectal cancer LS patient with CRC. Factors including patient wishes, family planning and likely adherence to close follow-up colonoscopic surveillance should be considered. Chemoprevention The Colorectal Adenoma/Carcinoma Prevention Program 2 trial randomised over 1000 individuals with known or suspected LS to 600 mg per day of aspirin for 2 years versus placebo.41 The study’s primary end-point was development of colorectal adenoma or carcinoma. There was no difference in the incidence of colorectal adenomas or carcinomas between the two groups at a mean follow-up time of 27 months. At a mean follow up of 55.7 months, the hazard ratio (HR) for developing CRC in the aspirin group was 0.63 (95% confidence interval (CI) 0.35–1.13, P = 0.12) on an intention-to-treat analysis. In the subgroup of patients who completed 2 years of 600 mg aspirin, the HR was 0.41 (95% CI 0.19–0.86, P = 0.02) compared with the placebo group. There was also a trend to a decrease in non-CRC LS cancers, with the group of patients who completed 2 years of aspirin having a HR of 0.47 (95% CI 0.21–1.06, P = 0.07). Adverse events did not differ while on treatment; however, data were not collected on post-intervention adverse effects. The ongoing Colorectal Adenoma/Carcinoma Prevention Program 3 trial is determining the optimal dose of aspirin. Constitutive MMR deficiency Constitutive mismatch repair deficiency, a rare autosomal recessive condition, has been described primarily in the paediatric population.42 The inheritance of biallelic MMR gene mutations results in lack of competent MMR in all tissues. Individuals develop haematological malignancies and rare brain tumours such as gliomas in childhood as well as LS-associated tumours and café au-lait spots.43 It can also present with colonic polyposis suggestive of attenuated FAP or MUTYH-associated neoplasia.44 This condition is diagnosed on IHC for MMR proteins, and demonstrates absent MMR staining in both tumour and surrounding normal tissue. Familial adenomatous polyposis Classical FAP results in the development of hundreds to thousands of polyps in the colon and/or rectum by the time of adolescence. Untreated, FAP results in CRC in ∼100% of cases by the fourth decade.45 Seventy to eighty per cent of these CRC are left sided.46 FAP occurs in 1 in 8000–10 000 individuals and accounts for <1% of cases of CRC. Genetics FAP is caused by germline mutations in the APC gene on chromosome 5q. Ninety-five per cent of APC mutations are protein truncating.47 While FAP is an autosomal dominant syndrome, it has been estimated that 25% of germline APC mutations occur de novo.45 APC is a tumour suppressor gene. It is thought of as a ‘gatekeeper’ gene as it inhibits cell growth by regulating signalling through the Wnt pathway. It also plays a role in other processes including cellular adhesion, cytoskeleton stabilisation and possibly cell cycle and apoptosis.47 The position of a germline mutation within the APC gene is associated with particular clinical features producing a phenotype/genotype correlation. Mutations between codons 1250 and 1464 are associated with a more severe form of the disease (>5000 polyps).48 Mutations in codon 1309 result in an earlier onset of CRC at a mean age of 35 years.49 Mutations at or beyond codon 1444 confer an 11-fold increase in risk of developing desmoids.50 Mutations between exons 9 and 15 (codons 311 to 1444) are associated with congenital hypertrophy of the retinal pigment epithelium (CHRPE), which is the commonest extra-intestinal manifestation of FAP.49 Once a pathogenic mutation in the APC gene is found, presymptomatic genetic screening can be offered to blood relatives. An attenuated form of FAP is associated with mutations in the 5′ end, exon 9 and 3′ ends of the APC gene.51–53 This group of patients generally has a delayed appearance of colonic adenomas and CRC by around 10–20 years.54 In clinically determined attenuated FAP, with 30–100 polyps, an APC mutation is found in 30% of cases.55 Extra-intestinal manifestations of FAP FAP is associated with gastric fundic gland polyps and duodenal adenomas, duodenal cancer, papillary thyroid cancer (rare), hepatoblastoma in childhood (rare) and central nervous system tumours (predominantly medulloblastoma). Non-malignant associations include desmoid tumours, CHRPE,56 epidermoid skin cysts and osteomas (Gardner syndrome), lipomas and adrenal tumours (very rarely malignant).56 CHRPE associated with FAP tends to manifest as multiple bilateral lesions with a depigmented halo.57 The main causes of death in FAP patients following colectomy are duodenal cancer and desmoid tumours.58 Desmoid tumours are locally aggressive connective tissue tumours that do not have metastatic potential. They usually occur in the abdominal wall or mesentery or in an abdominal surgical scar, and may cause morbidity and mortality due to small bowel obstruction, ischaemia or © 2015 Royal Australasian College of Physicians 485 Lung et al. perforation, intra-abdominal abscesses and fistulas, or ureteric obstruction.56 Surveillance and management Since the advent of molecular diagnosis and prophylactic surveillance and surgery, the mortality from CRC in FAP has decreased significantly.59 For known APC mutation carriers and at risk relatives from families where a clinical diagnosis has been made but in which mutation testing is not possible, two yearly flexible sigmoidoscopy should start at the age of 12–14 years of age.36 Yearly colonoscopy should be done when polyps are seen and continued until colectomy.36 Colectomy is usually performed in late adolescence or early adulthood. Surgical options are proctocolectomy with ileal pouch-anal anastomosis in individuals with a high rectal polyp burden or total colectomy with ileorectal anastomosis. Those with a retained rectum require annual endoscopy post-colectomy. For attenuated FAP cases, two yearly colonoscopy is recommended rather than sigmoidoscopy, starting at the age of 18–20 years,36 as adenomas are found throughout the colon. Screening for extra-intestinal manifestations of FAP should begin at diagnosis or at the age of 25–30 years, whichever is earlier.36 Upper gastrointestinal endoscopy using both front- and side-viewing endoscopy is performed every 5 years until the detection of adenomas. The frequency of upper endoscopies once adenomas are detected depends on the Spigelman stage of the polyps,60 which takes into account polyp number, size, histology and dysplasia. Symptomatic desmoid tumours may be treated with medical therapy including non-steroidal antiinflammatory drugs with tamoxifen or raloxifene61 and with chemotherapy.62 Surgical manipulation may result in disease progression and should only be undertaken by specialist surgeons after multidisciplinary consultation.36 Chemoprevention Small trials have suggested that ascorbate,63 sulindac64 and the COX-2 inhibitors65 may result in a reduction in adenoma burden of 10–40% while on treatment.66 Some patients had regression of their adenomas; however, the adenomas recurred when treatment was stopped. The Concerted Action Polyp Prevention 1 trial did not find any effect on polyp number with the use of aspirin or resistant starch. Aspirin is not currently used for chemoprevention of FAP. MUTYH-associated neoplasia MUTYH-associated polyposis (MAP) is an autosomal recessive syndrome that results in the development of several to hundreds of colorectal polyps and/or CRC67 and can present in a similar manner to FAP. MUTYH is an important differential diagnosis in individuals with presumed de novo FAP, and genetic testing is the only means to differentiate between these two conditions, which have significantly different clinical implications to relatives of the affected individual. While the association of MUTYH gene mutations with hereditary CRC was first defined in patients with colorectal polyposis,67,68 subsequent population-based CRC studies have found that up to one third of patients with biallelic MUTYH mutations develop CRC without additional polyps being identified at the time of diagnosis.69,70 Hence MUTYH-associated CRC is not invariably associated with colorectal polyposis and is a diagnosis that should be considered in young onset CRC irrespective of polyp status. Patients with biallelic mutations in MUTYH have a 93-fold increased risk of CRC although this figure is subject to ascertainment bias.71 MAP is associated with duodenal polyposis (<20%) and gastric fundic polyps (11%).72 Other extraintestinal manifestations have been observed in case reports, including ovarian cancer and sebaceous gland tumours but not desmoids.73 Genetics The MUTYH gene is critical in the base excision repair pathway. It is an adenine-specific DNA glycosylase responsible for removing mispaired adenines. Biallelic MUTYH mutations result in persistence of mispairing between an oxidatively modified form of deoxyguanine and adenine, leading to G:C→T:A transversion mutations.68 This is frequently seen in the APC and KRAS genes in tumours from MAP patients.74 There are two founder mutations in MUTYH in the Caucasian European population: p.Tyr179Cys and p.Gly396Asp, which account for approximately 73% of MUTYH mutations in these populations.75 Homozygosity for the p.Tyr179Cys mutation is associated with a more severe phenotype, with a significantly increased risk of CRC (56-fold vs 19-fold) and an earlier mean age of diagnosis (49.5 years vs 57.9 years) compared with homozygosity for p.Gly396Asp.76 The mean age of onset of the p.Gly396Asp/p.Tyr179Cys compound heterozygote is in between the two homozygous groups at 52.5 years.76 Other pathogenic MUTYH mutations have been identified in different ethnic groups. For example, the p.Val466Leu mutation was found to be homozygous in four apparently unrelated affected Indian patients77 © 2015 Royal Australasian College of Physicians 486 Familial colorectal cancer suggesting that this may be an important pathogenic variant in the Indian population. Under 1% of CRC is due to inherited biallelic mutations of the MUTYH gene.71,76 MUTYH heterozygotes Multiple studies have attempted to ascertain if carriers of one MUTYH gene mutation have an increased risk of CRC.69,71,78,79 A large meta-analysis found a small increase in CRC in monoallelic mutation carriers (odds ratio (OR) 1.15 (95% CI = 0.98–1.36)).80 Several smaller welldesigned studies suggest a modestly increased risk.71,78,79 In this context, it is reasonable to offer individuals with one MUTYH mutation population screening advice, or five yearly colonoscopy from the age of 50 if they have a family member affected with CRC before the age of 55 years.81 Surveillance and management for MAP There are no controlled clinical trials of surveillance in biallelic MUTYH mutation carriers to inform practice. The European Society for Medical Oncology guidelines36 suggest following the surveillance and management recommendations for attenuated FAP. Upper gastrointestinal endoscopy is reasonable but the optimal frequency is unknown. Hamartoma syndromes Hamartomas are benign tumours consisting of cells from the tissue of origin growing in a disorganised way. The hamartomatous polyposis syndromes juvenile polyposis syndrome (JPS) and Peutz–Jeghers syndrome (PJS) are associated with an increased risk of various malignancies. JPS is an autosomal dominant condition. The word ‘juvenile’ in juvenile polyposis refers to the polyp histology, not the patient age. The diagnosis of juvenile polyposis requires at least three juvenile polyps, a family history of juvenile polyposis or juvenile polyps throughout the entire digestive tract. The incidence of JPS is 1:15 000–1:50 000. Children with juvenile polyposis may present with rectal bleeding, anaemia, obstruction or abdominal pain between the ages of 4 and 14 years of age. Individuals with JPS have an increased risk of CRC (39–68%) and small bowel, stomach and pancreas cancers (21%).82,83 SMAD4 or BMPR1A gene mutations are seen in approximately 40–60% of JPS cases.84–86 Around 20% of SMAD4 mutation carriers have associated hereditary haemorrhagic telangiectasia (HHT),86 which manifests as recurrent epistaxis, mucocutaneous telangi- ectasia or pulmonary, cerebral or hepatic arteriovenous malformations. A suggested approach to surveillance in JPS is colonoscopy every 2 years from the age of 15 years and upper gastrointestinal endoscopy every 2 years from the age of 25 years.87 Upper and lower gastrointestinal scopes should occur yearly once polyps are seen.87 Consideration of HHT is required for all individuals carrying a SMAD4 mutation, and appropriate surveillance and management is required.87 PJS may present with typical mucocutaneous pigmentation in childhood and/or bowel intussusception, obstruction or bleeding. Hamartomatous polyps are found throughout the gastrointestinal tract, particularly in the jejunum. They can also be found in extra-intestinal sites such as the bladder and respiratory tract. The incidence of PJS is 1:50 000–1:200 000. There is an increased risk of CRC (39%),88 breast cancer (45%), pancreatic cancer (11%), stomach cancer (29%), gynaecological cancer (18%) and Sertoli cell tumours of the testis.83,88 Mutations in the STK11 gene are found in up to 70% of cases.88 It is inherited in an autosomal dominant fashion, although up to 40% may occur de novo.89 Surveillance for cancer in asymptomatic individuals with PJS should begin at age 30 years, and include gastroduodenoscopy, colonoscopy and video capsule endoscopy or barium follow through or magnetic resonance endoscopy at least three yearly.90 Recommendations for women with PJS include annual breast MRI and bilateral mammography ± ultrasound from the age of 30–50 years and annual mammography and clinical breast examination from the age of 50 years.90 Bilateral risk reducing mastectomy may be considered. Individuals with a family history of breast cancer under the age of 35 years may require modified screening plans. A pelvic examination, endoscopy and pap smear by a gynaecologist every 2 years from the age of 18 years is also recommended.90 Conclusion Cancer is, in essence, a genetic disease.91 There is an increasing focus on categorising cancers according to their molecular aetiology, rather than their clinical manifestation, or phenotype, as has been done in the past. Neither is sufficient on its own. We now know that the same clinical picture can come about as a result of inherited mutations in different genes.55 Conversely, a mutation in the same gene can give rise to different phenotypes, for example biallelic mutations in MUTYH can present with polyposis or CRC without polyposis.71 Classifying a cancer by its phenotype alone may put cancers with very different patterns of inheritance and natural histories in the same group. © 2015 Royal Australasian College of Physicians 487 Lung et al. This has implications for inherited CRC as the diagnostic algorithms are now more complex. Germline DNA tests should ideally be carried out at a familial cancer centre to enable appropriate pre-test counselling and follow up. The Cancer Council of New South Wales has published referral guidelines for clinicians to refer patients who may be at risk of familial CRC. These guidelines are available on the website www.eviq.org.au and are summarised in Table 3. Genetic counselling should be offered before a diagnostic genetic test is carried out. Genetic testing should begin with an affected family member36 as this will allow more focused genetic tests to be performed subsequently on other family members. In the event that a germline mutation is not identified, surveillance is still recommended and tailored to the individual and family. There has been significant progress in the understanding of the genetic mechanisms underlying familial CRC since the discovery of the APC gene in 1987.93 However, there remains a group of affected families for which a causative genetic mutation has yet to be identified. Further research is required to delineate the hereditary factors that may account for the increased risk of CRC in these families. Identification of the hereditary factors References 1 Jea F. GLOBOCAN 2008 v2.0, cancer incidence and mortality worldwide: IARC cancerbase No. 10 [Internet]. Lyon, France: International Agency for Research on Cancer. 2010. 2 Australian Institute of Health and Welfare. Cancer survival and prevalence in Australia: period estimates from 1982 to 2010. Cancer Series no. 69. Cat. no. CAN 65. Canberra: AIHW. 2012. 3 Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, Koskenvuo M et al. Environmental and heritable factors in the causation of cancer: analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med 2000; 343: 78–85. 4 Lynch HT, Lynch PM, Lanspa SJ, Snyder CL, Lynch JF, Boland CR. Review of the Lynch syndrome: history, molecular genetics, screening, differential diagnosis, and medicolegal ramifications. Clin Genet 2009; 76: 1–18. 5 Ligtenberg MJL, Kuiper RP, Chan TL, Goossens M, Hebeda KM, Voorendt M et al. Heritable somatic methylation and inactivation of MSH2 in families with Lynch syndrome due to deletion of the 6 7 8 9 10 11 Table 3 CRC and polyposis referral guidelines based on eviQ Cancer Treatment Online92 Individual characteristics Blood relative of a known mutation carrier Greater than 20 cumulative adenomatous polyps at any age Greater than 3 cumulative adenomatous polyps by 30 years of age Greater than 30 polyps of any type at any age Multiple Lynch or Peutz–Jeghers syndrome-related cancers in the same individual Isolated CRC before 50 years of age Family history characteristics Three Lynch syndrome-related cancer cases (CRC, small bowel, endometrial, ovarian, gastric, brain, urothelial transitional cell carcinoma) in 1st or 2nd-degree relatives of any age Two CRC cases in 1st or 2nd-degree relatives before the age of 50 years Tumour pathology characteristics Greater than 2 hamartomatous polyps at any age Greater than 2 juvenile polyps at any age Gastric fundic polyposis at any age MSI or abnormal MMR IHC on CRC before the age of 60 years responsible for this increased risk will lead to more streamlined counselling and management of these affected families. 3′ exons of TACSTD1. Nat Genet 2009; 41: 112–17. Kovacs ME, Papp J, Szentirmay Z, Otto S, Olah E. Deletions removing the last exon of TACSTD1 constitute a distinct class of mutations predisposing to Lynch syndrome. Hum Mutat 2009; 30: 197–203. Lynch HT, De la Chapelle A. Hereditary colorectal cancer. N Engl J Med 2003; 348: 919–32. Kuiper RP, Vissers LELM, Venkatachalam R, Bodmer D, Hoenselaar E, Goossens M et al. Recurrence and variability of germline EPCAM deletions in Lynch syndrome. Hum Mutat 2011; 32: 407–14. Vaughn CP, Robles J, Swensen JJ, Miller CE, Lyon E, Mao R et al. Clinical analysis of PMS2: mutation detection and avoidance of pseudogenes. Hum Mutat 2010; 31: 588–93. Bonadona V, Bonaïti B, Olschwang S, Grandjouan S, Huiart L, Longy M et al. Cancer risks associated with germline mutations in mlh1, msh2, and msh6 genes in Lynch syndrome. JAMA 2011; 305: 2304–10. Senter L, Clendenning M, Sotamaa K, Hampel H, Green J, Potter JD et al. The 12 13 14 15 clinical phenotype of Lynch syndrome due to germ-line PMS2 mutations. Gastroenterology 2008; 135: 419–28, e1. Peltomaki P, Vasen HFA, Bisgaard ML, Buerstedde JM, Friedl W, Grandjouan S et al. Mutations predisposing to hereditary nonpolyposis colorectal cancer: database and results of a collaborative study. Gastroenterology 1997; 113: 1146–58. Green J, O’Driscoll M, Barnes A, Maher E, Bridge P, Shields K et al. Impact of gender and parent of origin on the phenotypic expression of hereditary nonpolyposis colorectal cancer in a large newfoundland kindred with a common MSH2 mutation. Dis Colon Rectum 2002; 45: 1223–32. Hampel H, Frankel WL, Martin E, Arnold M, Khanduja K, Kuebler P et al. Screening for the Lynch syndrome (hereditary nonpolyposis colorectal cancer). N Engl J Med 2005; 352: 1851–60. Aaltonen LA, Peltomaki P, Leach FS, Sistonen P, Pylkkanen L, Mecklin JP et al. Clues to the pathogenesis of familial colorectal cancer. Science 1993; 260: 812–16. © 2015 Royal Australasian College of Physicians 488 Familial colorectal cancer 16 Peltomaki P, Lothe RA, Aaltonen LA, Pylkkanen L, Nystrom-Lahti M, Seruca R et al. Microsatellite instability is associated with tumors that characterize the hereditary non-polyposis colorectal carcinoma syndrome. Cancer Res 1993; 53: 5853–5. 17 Duval A, Hamelin R. Mutations at coding repeat sequences in mismatch repair-deficient human cancers: toward a new concept of target genes for instability. Cancer Res 2002; 62: 2447–54. 18 Tannergård P, Liu T, Weger A, Nordenskjöld M, Lindblom A. Tumorigenesis in colorectal tumors from patients with hereditary non-polyposis colorectal cancer. Hum Genet 1997; 101: 51–5. 19 Kempers MJE, Kuiper RP, Ockeloen CW, Chappuis PO, Hutter P, Rahner N et al. Risk of colorectal and endometrial cancers in EPCAM deletion-positive Lynch syndrome: a cohort study. Lancet Oncol 2011; 12: 49–55. 20 Hampel H, Stephens JA, Pukkala E, Sankila R, Aaltonen LA, Mecklin J-P et al. Cancer risk in hereditary nonpolyposis colorectal cancer syndrome: later age of onset. Gastroenterology 2005; 129: 415–21. 21 Watson P, Vasen HF, Mecklin JP, Bernstein I, Aarnio M, Jarvinen HJ et al. The risk of extra-colonic, extra-endometrial cancer in the Lynch syndrome. Int J Cancer 2008; 123: 444–9. 22 Umar A, Boland CR, Terdiman JP, Syngal S, de la Chapelle A, Rüschoff J et al. Revised Bethesda guidelines for hereditary nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability. J Natl Cancer Inst 2004; 96: 261–8. 23 Hampel H. Point: justification for Lynch syndrome screening among all patients with newly diagnosed colorectal cancer. J Natl Compr Canc Netw 2010; 8: 597–601. 24 Vasen HFA, Watson P, Mecklin JP, Lynch HT. New clinical criteria for hereditary nonpolyposis colorectal cancer (HNPCC, Lynch syndrome) proposed by the International Collaborative Group on HNPCC. Gastroenterology 1999; 116: 1453–6. 25 Hampel H, Frankel WL, Martin E, Arnold M, Khanduja K, Kuebler P et al. Feasibility of screening for Lynch syndrome among patients with 26 27 28 29 30 31 32 33 34 colorectal cancer. J Clin Oncol 2008; 26: 5783–8. Hendriks YMC, Wagner A, Morreau H, Menko F, Stormorken A, Quehenberger F et al. Cancer risk in hereditary nonpolyposis colorectal cancer due to MSH6 mutations: impact on counseling and surveillance. Gastroenterology 2004; 127: 17–25. Raevaara TE, Korhonen MK, Lohi H, Hampel H, Lynch E, Lönnqvist KE et al. Functional significance and clinical phenotype of nontruncating mismatch repair variants of MLH1. Gastroenterology 2005; 129: 537–49. Jenkins MA, Hayashi S, O’Shea A-M, Burgart LJ, Smyrk TC, Shimizu D et al. Pathology features in Bethesda guidelines predict colorectal cancer microsatellite instability: a population-based study. Gastroenterology 2007; 133: 48–56. Domingo E, Laiho P, Ollikainen M, Pinto M, Wang L, French AJ et al. BRAF screening as a low-cost effective strategy for simplifying HNPCC genetic testing. J Med Genet 2004; 41: 664–8. De Jong AE, Hendriks YMC, Kleibeuker JH, De Boer SY, Cats A, Griffioen G et al. Decrease in mortality in Lynch syndrome families because of surveillance. Gastroenterology 2006; 130: 665–71. Renkonen-Sinisalo L, Aarnio M, Mecklin JP, Jarvinen HJ. Surveillance improves survival of colorectal cancer in patients with hereditary nonpolyposis colorectal cancer. Cancer Detect Prev 2000; 24: 137–42. Vasen HFA, van Ballegooijen M, Buskens E, Kleibeuker JK, Taal BG, Griffioen G et al. A cost-effectiveness analysis of colorectal screening for hereditary nonpolyposis colorectal carcinoma gene carriers. Cancer 1998; 82: 1632–7. Järvinen HJ, Aarnio M, Mustonen H, Aktan-Collan K, Aaltonen LA, Peltomäki P et al. Controlled 15-year trial on screening for colorectal cancer in families with hereditary nonpolyposis colorectal cancer. Gastroenterology 2000; 118: 829–34. Vasen HF, Blanco I, Aktan-Collan K, Gopie JP, Alonso A, Aretz S et al. Revised guidelines for the clinical management of Lynch syndrome (HNPCC): recommendations by a group of European experts. Gut 2013; 62: 812–23. 35 Vasen HF, Abdirahman M, Brohet R, Langers AM, Kleibeuker JH, van Kouwen M et al. One to 2-year surveillance intervals reduce risk of colorectal cancer in families with Lynch syndrome. Gastroenterology 2010; 138: 2300–6. 36 Balmaña J, Balaguer F, Cervantes A, Arnold D, ESMO Guidelines Working Group. Familial risk-colorectal cancer: ESMO Clinical Practice Guidelines. Ann Oncol 2013; 24(Suppl 6): vi73–80. 37 Renkonen-Sinisalo L, Bützow R, Leminen A, Lehtovirta P, Mecklin J-P, Järvinen HJ. Surveillance for endometrial cancer in hereditary nonpolyposis colorectal cancer syndrome. Int J Cancer 2007; 120: 821–4. 38 Stuckless S, Green J, Dawson L, Barrett B, Woods MO, Dicks E et al. Impact of gynecological screening in Lynch syndrome carriers with an MSH2 mutation. Clin Genet 2013; 83: 359–64. 39 Parry S, Win AK, Parry B, Macrae FA, Gurrin LC, Church JM et al. Metachronous colorectal cancer risk for mismatch repair gene mutation carriers: the advantage of more extensive colon surgery. Gut 2011; 60: 950–7. 40 Pollett WG, Marion K, Moeslein G, Schneider C, Parry S, Veysey K et al. Quality of life after surgery in individuals with familial colorectal cancer: does extended surgery have an adverse impact? ANZ J Surg 2013; 84: 359–64. 41 Burn J, Gerdes A-M, Macrae F, Mecklin J-P, Moeslein G, Olschwang S et al. Long-term effect of aspirin on cancer risk in carriers of hereditary colorectal cancer: an analysis from the CAPP2 randomised controlled trial. Lancet 2011; 378: 2081–7. 42 Wimmer K, Etzler J. Constitutional mismatch repair-deficiency syndrome: have we so far seen only the tip of an iceberg? Hum Genet 2008; 124: 105–22. 43 Felton KEA, Gilchrist DM, Andrew SE. Constitutive deficiency in DNA mismatch repair: is it time for Lynch III? Clin Genet 2007; 71: 499–500. 44 Jasperson KW, Samowitz WS, Burt RW. Constitutional mismatch repair-deficiency syndrome presenting as colonic adenomatous polyposis: clues from the skin. Clin Genet 2011; 80: 394–7. © 2015 Royal Australasian College of Physicians 489 Lung et al. 45 Bisgaard ML, Fenger K, Bülow S, Niebuhr E, Mohr J. Familial adenomatous polyposis (FAP): frequency, penetrance, and mutation rate. Hum Mutat 1994; 3: 121–5. 46 Björk J, Akerbrant H, Iselius L, Alm T, Hultcrantz R. Epidemiology of familial adenomatous polyposis in Sweden: changes over time and differences in phenotype between males and females. Scand J Gastroenterol 1999; 34: 1230–5. 47 Fearnhead NS, Britton MP, Bodmer WF. The ABC of APC. Hum Mol Genet 2001; 10: 721–33. 48 Nagase H, Miyoshi Y, Horii A, Aoki T, Ogawa M, Utsunomiya J et al. Correlation between the location of germ-line mutations in the APC gene and the number of colorectal polyps in familial adenomatous polyposis patients. Cancer Res 1992; 52: 4055–7. 49 Bertario L, Russo A, Sala P, Varesco L, Giarola M, Mondini P et al. Multiple approach to the exploration of genotype-phenotype correlations in familial adenomatous polyposis. J Clin Oncol 2003; 21: 1698–707. 50 Bertario L, Russo A, Sala P, Eboli M, Giarola M, D’Amico F et al. Genotype and phenotype factors as determinants of desmoid tumors in patients with familial adenomatous polyposis. Int J Cancer 2001; 95: 102–7. 51 Luijt R, Vasen HA, Tops CJ, Breukel C, Fodde R, Khan PM. APC mutation in the alternatively spliced region of exon 9 associated with late onset familial adenomatous polyposis. Hum Genet 1995; 96: 705–10. 52 Matsubara N, Isozaki H, Tanaka N. The farthest 3′ distal end APC mutation identified in attenuated adenomatous polyposis coli with extracolonic manifestations. Dis Colon Rectum 2000; 43: 720–1. 53 Spirio L, Olschwang S, Groden J, Robertson M, Samowitz W, Joslyn G et al. Alleles of the APC gene: an attenuated form of familial polyposis. Cell 1993; 75: 951–7. 54 Knudsen AL, Bulow S, Tomlinson I, Moslein G, Heinimann K, Christensen IJ et al. Attenuated familial adenomatous polyposis: results from an international collaborative study. Colorectal Dis 2010; 12: e243–9. 55 Filipe B, Baltazar C, Albuquerque C, Fragoso S, Lage P, Vitoriano I et al. APC or MUTYH mutations account for the 56 57 58 59 60 61 62 63 64 65 66 majority of clinically well-characterized families with FAP and AFAP phenotype and patients with more than 30 adenomas. Clin Genet 2009; 76: 242–55. Groen E, Roos A, Muntinghe F, Enting R, Vries J, Kleibeuker J et al. Extra-intestinal manifestations of familial adenomatous polyposis. Ann Surg Oncol 2008; 15: 2439–50. Trainer AH. Extra-colonic manifestations of familial adenomatous polyposis coli. Adv Exp Med Biol 2009; 656: 119–27. Lipton L, Tomlinson I. The genetics of FAP and FAP-like syndromes. Fam Cancer 2006; 5: 221–6. Heiskanen I, Luostarinen T, Järvinen HJ. Impact of screening examinations on survival in familial adenomatous polyposis. Scand J Gastroenterol 2000; 35: 1284–7. Spigelman AD, Williams CB, Talbot IC, Domizio P, Phillips RK. Upper gastrointestinal cancer in patients with familial adenomatous polyposis. Lancet 1989; 2: 783–5. Vasen HFA, Möslein G, Alonso A, Aretz S, Bernstein I, Bertario L et al. Guidelines for the clinical management of familial adenomatous polyposis (FAP). Gut 2008; 57: 704–13. Gega M, Yanagi H, Yoshikawa R, Noda M, Ikeuchi H, Tsukamoto K et al. Successful chemotherapeutic modality of doxorubicin plus dacarbazine for the treatment of desmoid tumors in association with familial adenomatous polyposis. J Clin Oncol 2006; 24: 102–5. Bussey HJR, Decosse JJ, Deschner EE, Eyers AA, Lesser ML, Morson BC et al. A randomized trial of ascorbic acid in polyposis coli. Cancer 1982; 50: 1434–9. Giardiello FM, Hamilton SR, Krush AJ, Piantadosi S, Hylind LM, Celano P et al. Treatment of colonic and rectal adenomas with sulindac in familial adenomatous polyposis. N Engl J Med 1993; 328: 1313–16. Steinbach G, Lynch PM, Phillips RKS, Wallace MH, Hawk E, Gordon GB et al. The effect of celecoxib, a cyclooxygenase-2 inhibitor, in familial adenomatous polyposis. N Engl J Med 2000; 342: 1946–52. Lynch PM. Pharmacotherapy for inherited colorectal cancer. Expert Opin Pharmacother 2010; 11: 1101–8. 67 Sieber OM, Lipton L, Crabtree M, Heinimann K, Fidalgo P, Phillips RKS et al. Multiple colorectal adenomas, classic adenomatous polyposis, and germ-line mutations in MYH. N Engl J Med 2003; 348: 791–9. 68 Al-Tassan N, Chmiel NH, Maynard J, Fleming N, Livingston AL, Williams GT et al. Inherited variants of MYH associated with somatic G:C→T:A mutations in colorectal tumors. Nat Genet 2002; 30: 227–32. 69 Balaguer F, Castellví-Bel S, Castells A, Andreu M, Muñoz J, Gisbert JP et al. Identification of MYH mutation carriers in colorectal cancer: a multicenter, case-control, population-based study. Clin Gastroenterol Hepatol 2007; 5: 379–87. 70 Grover S, Kastrinos F, Steyerberg EW, Cook EF, Dewanwala A, Burbidge LA et al. Prevalence and phenotypes of APC and MUTYH mutations in patients with multiple colorectal adenomas. JAMA 2012; 308: 485–92. 71 Farrington SM, Tenesa A, Barnetson R, Wiltshire A, Prendergast J, Porteous M et al. Germline susceptibility to colorectal cancer due to base-excision repair gene defects. Am J Hum Genet 2005; 77: 112–19. 72 Terdiman JP. MYH-associated disease: attenuated adenomatous polyposis of the colon is only part of the story. Gastroenterology 2009; 137: 1883–6. 73 Vogt S, Jones N, Christian D, Engel C, Nielsen M, Kaufmann A et al. Expanded extracolonic tumor spectrum in MUTYH-associated polyposis. Gastroenterology 2009; 137: 1976–85, e10. 74 Boparai KS, Dekker E, van Eeden S, Polak MM, Bartelsman JFWM, Mathus-Vliegen EMH et al. Hyperplastic polyps and sessile serrated adenomas as a phenotypic expression of MYH-associated polyposis. Gastroenterology 2008; 135: 2014–18. 75 Cheadle JP, Sampson JR. MUTYH-associated polyposis – from defect in base excision repair to clinical genetic testing. DNA Repair (Amst) 2007; 6: 274–9. 76 Lubbe SJ, Di Bernardo MC, Chandler IP, Houlston RS. Clinical Implications of the colorectal cancer risk associated with MUTYH mutation. J Clin Oncol 2009; 27: 3975–80. 77 Sampson JR, Dolwani S, Jones S, Eccles D, Ellis A, Evans DG et al. Autosomal recessive colorectal adenomatous © 2015 Royal Australasian College of Physicians 490 Familial colorectal cancer 78 79 80 81 82 83 polyposis due to inherited mutations of MYH. Lancet 2003; 362: 39–41. Jones N, Vogt S, Nielsen M, Christian D, Wark PA, Eccles D et al. Increased colorectal cancer incidence in obligate carriers of heterozygous mutations in MUTYH. Gastroenterology 2009; 137: 489–94, e1. Cleary SP, Cotterchio M, Jenkins MA, Kim H, Bristow R, Green R et al. Germline MutY human homologue mutations and colorectal cancer: a multisite case-control study. Gastroenterology 2009; 136: 1251–60. Win A, Hopper J, Jenkins M. Association between monoallelic MUTYH mutation and colorectal cancer risk: a meta-regression analysis. Fam Cancer 2011; 10: 1–9. Worthley DL, Suthers G, Lipton L. Management of MUTYH-associated neoplasia in Australia. Intern Med J 2008; 38: 644–50. Schreibman IR, Baker M, Amos C, McGarrity TJ. The hamartomatous polyposis syndromes: a clinical and molecular review. Am J Gastroenterol 2005; 100: 476–90. Jasperson KW, Tuohy TM, Neklason DW, Burt RW. Hereditary and familial colon cancer. Gastroenterology 2010; 138: 2044–58. 84 Sayed MG, Ahmed AF, Ringold JR, Anderson ME, Bair JL, Mitros FA et al. Germline SMAD4 or BMPRIA mutations and phenotype of juvenile polyposis. Ann Surg Oncol 2002; 9: 901–6. 85 Calva-Cerqueira D, Chinnathambi S, Pechman B, Bair J, Larsen-Haidle J, Howe JR. The rate of germline mutations and large deletions of SMAD4 and BMPR1A in juvenile polyposis. Clin Genet 2009; 75: 79–85. 86 Aretz S, Stienen D, Uhlhaas S, Stolte M, Entius MM, Loff S et al. High proportion of large genomic deletions and a genotype phenotype update in 80 unrelated families with juvenile polyposis syndrome. J Med Genet 2007; 44: 702–9. 87 Cancer Institute NSW. eviQ cancer treatments online. [updated 2014 Aug 7; cited 2014 Aug 25]. Available from URL: https://www.eviq.org.au/Protocol/tabid/ 66/categoryid/66/id/751/Risk+ Management+for+Juvenile+Polyposis+ Syndrome.aspx 88 Hearle N, Schumacher V, Menko FH, Olschwang S, Boardman LA, Gille JJP et al. Frequency and spectrum of cancers in the Peutz-Jeghers syndrome. Clin Cancer Res 2006; 12: 3209–15. 89 Westerman AM, Entius MM, de Baar E, Boor PPC, Koole R, van Velthuysen MLF 90 91 92 93 et al. Peutz-Jeghers syndrome: 78-year follow-up of the original family. Lancet 1999; 353: 1211–15. Cancer Institute NSW. eviQ cancer treatments online. [updated 2014 Jul 9; cited 2014 Aug 25]. Available from URL: https://www.eviq.org.au/Protocol/ tabid/66/categoryid/66/id/395/Risk +Management+for+Peutz-Jeghers +Syndrome++.aspx Vogelstein B, Kinzler KW. Cancer genes and the pathways they control. Nat Med 2004; 10: 789–99. Cancer Institute NSW. eviQ cancer treatments online. [updated 2012 May 31; cited 2014 Aug 25]. Available from URL: https://www.eviq.org.au/Protocol/ tabid/66/categoryid/439/id/657/Cancer +Genetics+-+Colorectal+Cancer+and +Polyposis+Referral+Guidelines.aspx Mallinson EKL, Newton KF, Bowen J, Lalloo F, Clancy T, Hill J et al. The impact of screening and genetic registration on mortality and colorectal cancer incidence in familial adenomatous polyposis. Gut 2010; 59: 1378–82. © 2015 Royal Australasian College of Physicians 491 Internal Medicine Journal 45 (2015) O R I G I N A L A RT I C L E S Clinical triage for colonoscopy is useful in young women K. D. Williamson,1,2,3 K. Steveling,4 G. Holtmann,5,6 M. Schoeman7 and J. M. Andrews3,8 1 Translational Gastroenterology Unit, John Radcliffe Hospital, 2Nuffield Department of Medicine, Oxford University, Oxford, UK, and 3Discipline of Medicine, University of Adelaide, Adelaide, 5Department of Gastroenterology and Hepatology, Princess Alexandra Hospital, Brisbane, 6Faculty of Medicine and Biomedical Sciences, University of Queensland, Queensland and 7Gastrointestinal Endoscopic Services, Department of Gastroenterology and Hepatology and 8Inflammatory Bowel Disease Service and Education, Department of Gastroenterology and Hepatology, Royal Adelaide Hospital, South Australia, Australia, and 4Department of Rheumatology, Knappschaftskrankenhaus, Püttlingen, Germany Key words colonoscopy, endoscopy, diagnosis, human, female. Correspondence Kate Williamson, Translational Gastroenterology Unit, John Radcliffe Hospital, Oxford, UK. Email: [email protected] Received 1 July 2014; accepted 28 January 2015. doi:10.1111/imj.12703 Abstract Background: Colonoscopy is an invasive procedure and a limited resource. It is therefore desirable to restrict its use to those in whom it yields an important diagnosis, without missing pathology in others. Aim: The aim of this study was to determine whether standard clinical criteria can be used to reliably distinguish when colonoscopy is advisable in women 30 years and younger. Methods: A retrospective audit was performed at a single centre of 100 consecutive colonoscopies performed in women 30 years old and younger. The indications for the colonoscopy were recorded, and divided into clear and relative indications. The primary outcome of whether an endoscopic diagnosis was made was compared between the two groups. Clear indications for colonoscopy included overt rectal bleeding, elevated inflammatory markers, anaemia, iron deficiency and strong family history of colorectal cancer. Relative indications included abdominal pain or discomfort, bloating and altered bowel habit/motions. Results: The average age was 23 years. Sixty women had both relative and clear indications. Eleven had only clear indications and 28 only relative indications. Altogether, 58 colonoscopies were normal, and 17 showed inflammatory bowel disease. No subject with only relative indications had an abnormal finding (0/28). The diagnostic yield was significantly different between those with only relative indications (0%) versus those with at least one clear indication (59%; P < 0.0001). Conclusions: Standard clinical criteria can be used to restrict safely the use of colonoscopy in young women. This will avoid performing procedures in people without clear indications, saving costs, resources and complications. Introduction The indications for colonoscopy are clearly defined by various organisations.1 However, what is not clear is whether we can use standard clinical criteria in low-risk populations to restrict reliably the use of colonoscopy. Colonoscopy is an invasive procedure with a documented rate of serious complications, such as bleeding and Funding/Conflict of interest: K. D. Williamson receives funding from Merck Sharp & Dohme to carry out clinical research. J. M. Andrews is in receipt of research support, lecture fees and advisory board membership from AbbVie, Abbott, Janssen, Ferring, Nycomed, Orphan, Shire, Amgen, ImmunosanT, AstraZeneca, Takeda, Hospira. perforation, varying from 0.2–0.3%.2 Despite the risks of the procedure staying relatively stable with age, the pick-up rate of a serious finding is far lower in younger as compared with older subjects – even without considering symptoms. For example, the chance of a 30-year-old patient presenting with colorectal cancer within the next 5 years is 1 in 7000, as compared with 1 in 100 for a 60 year old.3 In addition, resources for colonoscopy are limited, and there are significant costs associated with it, both direct and indirect.4 Common reasons given for requesting a colonoscopy, especially in the young, are symptoms pertaining to irritable bowel syndrome (IBS) or other functional abdominal symptoms, with up to a quarter of colonoscopies being performed in those with IBS-related symptoms.5 © 2015 Royal Australasian College of Physicians 492 Colonoscopy in young women This is despite recommendations that a positive diagnosis of IBS should be made on clinical grounds, with colonoscopy specifically not indicated in those less than 50 years with typical IBS symptoms and no alarm features.6 Therefore, it is important, based on a large number of personal and population-based factors, to restrict the use of colonoscopy to those for whom it is genuinely medically indicated. This has not been studied in a young population. Despite this, we know anecdotally that many individual clinicians find it hard to resist actively performing a procedure as they worry about the implications of a missed diagnosis. Therefore, we set out to determine the ability of standard clinical criteria to predict reliably a clinical finding in young patients undergoing diagnostic colonoscopy. Given that functional disorders, particularly IBS, are more prevalent in females, we focussed on females 30 years old and younger. Methods A retrospective audit was carried out of the last 100 consecutive colonoscopies in women aged 30 years old or younger. The audit was carried out at the Royal Adelaide Hospital, a large metropolitan teaching hospital in South Australia. The endoscopy unit has an annual load of approximately 1800 colonoscopies, with roughly 350 colonoscopies on the waiting list for a 6-month period. Reports were obtained from the electronic recording system, ‘Endoscribe’. Inclusion criteria were colonoscopy reports of patients who were female and aged 30 years old or less at the time of colonoscopy. There were no exclusion criteria. The clinical indications documented on the colonoscopy report, the request form or the case notes were recorded as were any available blood test results pre-procedure which were obtained from electronic sources and case notes. The clinical diagnosis, as well as progress and complications immediately postcolonoscopy, was obtained from the same sources. Indications for colonoscopy were classified as either ‘clear’ or ‘relative’ as generally accepted medically (Table 1). Clear indications included overt rectal bleeding, elevated inflammatory markers, anaemia, iron deficiency or a strong family history affording at least moderately elevated risk of colorectal cancer (according to Australia’s National Health and Medical Record Council (NHMRC) guidelines3). Relative indications included abdominal pain or discomfort, bloating and altered bowel habit. The results were analysed to assess the diagnostic yield of colonoscopies stratified according to indication (relative vs clear). STATA version 10.0 (Statcorp, Texas, USA) was used for statistical analysis. Binary variables Table 1 Clear and relative indications† Clear indications Overt rectal bleeding Iron deficiency Anaemia Elevated inflammatory markers (temperature, ESR, CRP, WBC or platelets) Strong family history of colorectal cancer Relative indications Abdominal pain or discomfort Bloating Altered bowel habit/motions † As per NHMRC guidelines.3 CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; WBC, white blood cells. were arranged into two by two contingency tables, from which positive predictive value, negative predictive value, sensitivity and specificity were derived. Comparisons were made using Pearson’s Chi-squared statistics for categorical variables. The study was approved by the Royal Adelaide Hospital Human Research Ethics Committee as a clinical audit. Results One hundred sequential colonoscopy records were reviewed. The average age of patients was 23 years (range 16–30). Of the 100 patients, 11 patients had clear indications, 28 patients had only relative indications, and 60 patients had clear as well relative indications. In one case, insufficient data were available to determine the indications fully. In the analysis, this case was assumed to have a clear indication as it could not be safely judged that she did not. Thus, in total, 72 patients had at least one clear indication. The most commonly noted relative indications were: abdominal pain (n = 64), chronic diarrhoea (n = 33), acute diarrhoea (n = 17), constipation (n = 14) and alternating stool form/frequency (n = 17). Of the clear indications, the most common was overt rectal bleeding (n = 48), followed by iron deficiency (n = 15), 11 of whom were also anaemic (Table 2). In the 100 colonoscopy reports audited, 58 procedures were reported as normal. The most common single abnormal finding was inflammatory bowel disease (IBD) (n = 17). Other diagnoses included polyps, haemorrhoids, anal fissure, rectal prolapse and one rectal carcinoma (Table 3). In this cohort, no subject had more than one diagnosis. Of those with only relative indications (n = 28) none had a positive finding at colonoscopy (0%, 95% confidence interval (CI) 0–12.1%)). Of those with any clear indication (n = 72), a positive finding was noted in © 2015 Royal Australasian College of Physicians 493 Williamson et al. Table 2 Distribution of indications Indications for colonoscopy Relative indications Abdominal pain Chronic diarrhoea Acute diarrhoea Constipation Alternating bowel motions Clear indications Overt rectal bleeding Iron deficiency Anaemia Family history CRC n 64 33 17 14 17 48 15 11 0 Note that n > 100, as some patients had more than one indication. CRC, colorectal cancer. 42/72 (58%, 95% CI 47–69%)). This difference in yield between those with only relative versus any clear indication was statistically significant (P < 0.0001). The positive predictive value of an abnormal colonoscopy with any clear indication was 58.5%, and the negative predictive value in the absence of any clear indication(s) was 100%. Even if findings of a non-serious nature were excluded (n = 10: haemorrhoids, anal fissure or prolapse – all of which could have been diagnosed with proctoscopy or sigmoidoscopy), the difference in yield remained highly clinically relevant and statistically significant – 0% versus 44% (P < 0.0001). It is important to note that in those without any ‘clear’ indication for colonoscopy, no pathology would have been missed if the colonoscopy had been avoided. The single patient with rectal carcinoma presented with overt rectal bleeding. It was also noted that a higher number of clear indications denoted a higher chance of an abnormal finding at colonoscopy (Table 3). Specifically, of the 17 patients with a finding of IBD, all had at least two clear indications, and 11 of the 17 had three or more clear indications. Table 3 Findings at colonoscopy Outcome colonoscopy Normal Inflammatory bowel disease Polyp Haemorrhoids Anal fissure Prolapse Histological inflammation Cancer† Total Number of clear indications Total 0 1 2 3 4 5 6 28 – – – – – – – 28 21 – 6 2 3 3 3 1 39 7 6 – 1 – – 3 – 17 2 5 – 1 – – 1 – 9 – 2 – – – – 1 – 3 – 1 – – – – – – 1 – 3 – – – – – – 3 †Presentation for this patient was overt rectal bleeding. 58 17 6 4 3 3 8 1 100 Two patients in the study had significant morbidity associated with the procedure, predominantly pain postprocedure. Both patients had presented with only relative indications and had normal colonoscopies. One patient required imaging, opiate analgesia and hospital admission. As expected in such a small cohort, there were no reported perforations or clinically significant haemorrhage. Discussion In this audit, it was found that, of consecutive women under 30 who had undergone colonoscopy in our unit, 42% overall had a positive finding. This is a very high yield compared with what one might expect. This is likely to be so, due to the fact that many patients were referred for clinically accepted, clear indication(s). Therefore, our data indicate that even in a young woman, any clear indication (such as anaemia, bleeding or raised inflammatory markers) should justify a prompt referral. However, perhaps the more interesting finding is that the simple application of well-accepted triage criteria would allow further limitation of colonoscopy in this demographic, without any loss of safety or accuracy. This would potentially free up some colonoscopy resources to be used in those who would benefit most, and would save unnecessary risk or morbidity in those who have no medical need for the procedure. However, it needs to be noted that only 28% of our colonoscopy cohort fell into this group. Thus, utilising the criteria, only 28% of colonoscopies could be avoided. The diagnostic yield of colonoscopy varies greatly depending on indication. One study of 736 colonoscopies (average age 43.6 years), examined diagnostic yield of colonoscopy according to American Society of Gastrointestinal Endoscopy (ASGE) indications.7 The yield ranged from 38% for indications considered ‘generally indicated’, 20% for indications ‘generally not indicated’ and 13% for indications ‘not listed’. Generally indicated indications included such things as haematochezia, unexplained iron deficiency anaemia and acceptable colonic cancer screening or surveillance, whereas ‘generally not indicated’ included ‘chronic, stable, irritable bowel syndrome or chronic abdominal pain’. If we examine the diagnostic yield of the patients in our study, we have figures of 58% for those with a clear (or appropriate) indication, and 0% for those with only relative indications. In a demographic where the prevalence of IBS is relatively high, this audit suggests a conservative approach be taken in the investigation of young women with only relative symptoms, rather than referring directly to colonoscopy given the absent diagnostic yield. The fact that there were complications in two of the 28 © 2015 Royal Australasian College of Physicians 494 Colonoscopy in young women (7%) patients coming to colonoscopy with only relative indications is concerning enough in our audit to recommend holding off endoscopic evaluation in this low-risk population. A Scandinavian retrospective study analysed diagnostic yield at colonoscopy according to indication/symptom. They had a similar finding to us, with a high diagnostic yield for clear indications, such as bleeding (67%) and weight loss (33%), and a low diagnostic yield for patients with non-specific gastrointestinal (GI) symptoms, including abdominal pain, change in bowel habit, constipation, flatulence and weight loss (13.2%).8 We feel that weight loss is a more clear indication for colonoscopy, rather than a non-specific symptom, and the yield in this setting was higher. They did find a significant yield for nonbloody diarrhoea – 31.2% of 176 patients. However, they failed to mention whether there were abnormalities in inflammatory markers, haemoglobin or weight loss, which we feel may well have contributed to increase the pre-test probability. Additionally, the mean age of their patients was 54 years old, with half being male, two factors which may arguably increase diagnostic yield. We are not saying that diarrhoea is not an appropriate indication for colonoscopy, but rather that diarrhoea alone may have a low diagnostic yield in this younger female demographic, as supported by our findings, and that supportive features for organic pathology should be sought before considering endoscopic investigation. There is one caveat to mention regarding the above, and that is to identify the minor subset of patients who present with diarrhoea who may have a form of microscopic colitis (collagenous or lymphocytic). This is a diagnosis made in predominantly middle-aged to older women (average age at diagnosis 53–69 years), and invariably patients have very watery and frequent stools, with a frequency above four times per day, and often the presence of nocturnal diarrhoea.9 These specific features of high frequency and nocturnal diarrhoea are unusual in IBS. This small subset of patients would be best served with a flexible sigmoidoscopy (rather than colonoscopy) with colonic biopsies to look for this diagnosis, as recent literature suggests that left-sided colonic biopsies are just as sensitive as full colonic series biopsies in making a diagnosis of microscopic colitis.10 The ASGE guidelines give recommendations for indications and contraindications for colonoscopy, as well as settings in which colonoscopy is ‘generally not recommended’. As mentioned above, falling under this latter heading is ‘chronic, stable, irritable bowel syndrome or chronic abdominal pain’. Twenty-eight patients in our audit had only relative indications, and based on our data it might be concluded that colonoscopy may have been reasonably avoided in these patients without missing pathology. On the other hand, our study did not assess the impact of the colonoscopy for the management of these patients. We cannot exclude that the potential ‘therapeutic effects’ due to the reassurance of a normal colonoscopy actually has a relevant influence on the outcome or healthcare utilisation that would justify the procedure. If a colonoscopy is normal in a patient with symptoms, it is possible that the very fact of doing the procedure may make it more difficult to help the patient come to terms with a functional diagnosis. The flip side of this is that a negative colonoscopy in a young female may provide reassurance, although this is unproven. Pertinently, this issue has been addressed in two previous studies with conflicting results. A prospective study of 59 patients aged less than 50 years old undergoing colonoscopy found a mean reduction in anxiety scores as well as symptom scores, despite a minimal diagnostic yield.11 However, a second retrospective study of 458 patients under 50 years old with IBS found the opposite, with no association between a negative colonoscopy and reassurance or health-related quality of life.12 Hence, the justification of doing a colonoscopy in a young female with only relative indications for the sake of reassurance might not be necessarily justifiable. We additionally note that procedure-related pain may be higher in those with functional GI disorders, such as IBS13 – in one study, 7% needed admission for pain post procedure – which further justifies restriction of use of colonoscopy in this demographic unless there are real concerns for a positive finding. Another observation made in this study is that the finding of IBD at colonoscopy in this young female population was related to the number of clear indications they possessed. All patients with IBD had at least two clear indications, with 64% of them having three clear indications. This indicates that one should have a higher suspicion of IBD in the patient with multiple clear indications prior to colonoscopy in this demographic. While colonoscopy in this group is necessary to confirm the diagnosis, the diagnosis itself should be anticipated. The limitations of the study were the retrospective nature, and the small sample size. It was therefore not powered to look at complications, nor cost-effectiveness, but rather yield. One should therefore note, that although none of 28 patients with only relative indications had a significant finding, the 95% CI was 0% to 12%. Hence, based on our sample size, up to 12% of patients may still have had a significant finding. The use of faecal calprotectin to enhance diagnostic accuracy may be of benefit here, by minimising the risk in not performing colonoscopy where only ‘relative’ indications exist.14 © 2015 Royal Australasian College of Physicians 495 Williamson et al. Conclusion In women, under 30 years of age, after simple clinical and laboratory parameters are found to be normal, colonoscopy can be safely avoided. These data should encourage gastroenterologists to be confident in making a positive diagnosis of functional GI disease on clinical grounds in the absence of alarm symptoms (or ‘clear References 1 ASGE Standards of Practice Committee. Appropriate use of GI endoscopy. Gastrointest Endosc 2012; 75: 1127–31. 2 Dominitz JA, Eisen GM, Baron TH, Goldstein JL, Hirota WK, Jacobson BC et al. Complications of colonoscopy. Gastrointest Endosc 2003; 57: 441–5. 3 Australian Cancer Network Colorectal Cancer Guidelines Revision Committee. Guidelines for the Prevention, Early Detection and Management of Colorectal Cancer. Sydney: The Cancer Council Australia and Australian Cancer Network; 2005. 4 Sharara N, Adam V, Crott R, Barkun AN. The costs of colonoscopy in a Canadian hospital using a microcosting approach. Can J Gastroenterol 2008; 22: 565–70. 5 Lieberman DA, Holub J, Eisen G, Kraemer D, Morris CD. Utilization of colonoscopy in the United States: results from a national consortium. Gastrointest Endosc 2005; 62: 875–83. indications’), and reserve colonoscopy for subjects in whom the medical need for the procedure is greater. Acknowledgements The authors acknowledge Dr Crispin Corte, Concord Hospital, Australia, for assistance with statistical analysis. 6 American College of Gastroenterology Task Force on Irritable Bowel Syndrome, Brandt LJ, Chey WD, Foxx-Orenstein AE, Schiller LR, Schoenfeld PS et al. An evidence-based position statement on the management of irritable bowel syndrome. Am J Gastroenterol 2009; 104(Suppl 1): S1–35. 7 Siddique I, Mohan K, Hasan F, Memon A, Patty I, Al-Nakib B. Appropriateness of indication and diagnostic yield of colonoscopy: first report based on the 2000 guidelines of the American Society for Gastrointestinal Endoscopy. World J Gastroenterol 2005; 11: 7007–13. 8 Lasson A, Kilander A, Stotzer PO. Diagnostic yield of colonoscopy based on symptoms. Scand J Gastroenterol 2008; 43: 356–62. 9 Pardi DS, Kelly CP. Microscopic colitis. Gastroenterology 2011; 140: 1155–65. 10 Chapman TP, Macfaul G, Abraham A. Diagnosing microscopic colitis: is flexible sigmoidoscopy a reliable alternative to colonoscopy? Clin Gastroenterol Hepatol 2015; 13: 618. 11 Esfandyari T, Harewood GC. Value of a negative colonoscopy in patients with non-specific gastrointestinal symptoms. J Gastroenterol Hepatol 2007; 22: 1609–14. 12 Spiegel BM, Gralnek IM, Bolus R, Chang L, Dulai GS, Naliboff B et al. Is a negative colonoscopy associated with reassurance or improved health-related quality of life in irritable bowel syndrome? Gastrointest Endosc 2005; 62: 892–9. 13 Kim ES, Cheon JH, Park JJ, Moon CM, Hong SP, Kim TI et al. Colonoscopy as an adjunctive method for the diagnosis of irritable bowel syndrome: focus on pain perception. J Gastroenterol Hepatol 2010; 25: 1232–8. 14 Tibble J, Teahon K, Thjodleifsson B, Roseth A, Sigthorsson G, Bridger S et al. A simple method for assessing intestinal inflammation in Crohn’s disease. Gut 2000; 47: 506–13. © 2015 Royal Australasian College of Physicians 496 Comparison of the management and in-hospital outcomes of acute coronary syndrome patients in Australia and New Zealand: results from the binational SNAPSHOT acute coronary syndrome 2012 audit C. Ellis,1 C. Hammett,2 I. Ranasinghe,3 J. French,4 T. Briffa,5 G. Devlin,6 J. Elliott,7 J. Lefkovitz,8 B. Aliprandi-Costa,9 C. Astley,10 J. Redfern,3 T. Howell,11 B. Carr,12 K. Lintern,12 S. Bloomer,13 A. Farshid,14 P. Matsis,15 A. Hamer,16 M. Williams,17 R. Troughton,18 M. Horsfall,19 K. Hyun,3 G. Gamble,20 H. White,21 D. Brieger9 and D. Chew,19 on behalf of Bi-National Acute Coronary Syndromes (ACS) ‘SNAPSHOT’ Audit Group 1 Department of Cardiology, Auckland City Hospital, 20Department of Medicine, University of Auckland, 21Department of Cardiology, Auckland City Hospital, Auckland, 6Department of Cardiology, Waikato Hospital, Hamilton, 7Cardiology Department, Christchurch Hospital, Christchurch, 15 Cardiology Department, Wellington Hospital, Wellington, 16Department of Cardiology, Nelson Marlborough District Health Board, Nelson, 17 Cardiology Department, Dunedin Hospital, Dunedin, 18The Christchurch Heart Institute, Department of Medicine, University of Otago Christchurch, Christchurch, New Zealand; and 2Royal Brisbane and Women’s Hospital, 11Clinical Access and Redesign Unit, Queensland Department of Health, Brisbane, Queensland, 3The George Institute for Global Health, 4Department of Cardiology, Liverpool Hospital, 9Department of Cardiology, Concord Hospital, 12Agency for Clinical Innovation, Sydney, 14Department of Cardiology, The Canberra Hospital, Canberra, ACT, New South Wales, 5School of Population Health, University of Western Australia, 13Health Networks Branch, Department of Health of Western Australia, Perth, Western Australia, 8 Royal Melbourne Hospital, Melbourne, Victoria, 10Statewide Systems Strategy, SA Health, and 19Department of Cardiovascular Medicine, Flinders University, Adelaide, South Australia, Australia Key words cardiology, audit, acute coronary syndrome. Abstract Background/Aims: We aimed to assess differences in patient management, and out- Correspondence Chris Ellis, Cardiology Department, Green Lane CVS Services, Level 3, Auckland City Hospital, Grafton, Auckland 1023, New Zealand. Email: [email protected] Received 20 December 2014; accepted 4 March 2015. doi:10.1111/imj.12739 comes, of Australian and New Zealand patients admitted with a suspected or confirmed acute coronary syndrome (ACS). Methods: We used comprehensive data from the binational Australia and New Zealand ACS ‘SNAPSHOT‘ audit, acquired on individual patients admitted between 00.00 h on 14 May 2012 to 24.00 h on 27 May 2012. Results: There were 4387 patient admissions, 3381 (77%) in Australia and 1006 (23%) in New Zealand; Australian patients were slightly younger (67 vs 69 years, P = 0.0044). Of the 2356 patients with confirmed ACS, Australian patients were at a lower cardiovascular risk with a lower median Global Registry Acute Coronary Events score (147 vs 154 P = 0.0008), but as likely to receive an invasive coronary angiogram (58% vs 54%, P = 0.082), or revascularisation with percutaneous coronary intervention (32% vs 31%, P = 0.92) or coronary artery bypass graft surgery (7.0% vs 5.6%, P = 0.32). Of the 1937 non-segment elevation myocardial infarction/unstable angina pectoris (NSTEMI/UAP) patients, Australian patients had a shorter time to angiography (46 h vs 67 h, P < 0.0001). However, at discharge, Australian NSTEMI/UAP survivors were less likely to receive aspirin (84% vs 89%, P = 0.0079, a second anti-platelet agent (57% vs 63%, P = 0.050) or a beta blocker (67% vs 77%, P = 0.0002). In-hospital death rates were not different (2.7% vs 3.2%, P = 0.55) between Australia and New Zealand. Conclusions: Overall more similarities were seen, than differences, in the management of suspected or confirmed ACS patients between Australia and New Zealand. However, in several management areas, both countries could improve the service delivery to this high-risk patient group. © 2015 Royal Australasian College of Physicians 497 Ellis et al. Introduction The medical knowledge which directs the optimal management of patients with an acute coronary syndrome (ACS) is the result of numerous clinical trials and is summarised in local1–3 and international4–7 guidelines. A key step in the management of ACS patients is for them to access cardiac angiography in a timely manner.1–7 From this investigation revascularisation with percutaneous coronary intervention (PCI) or coronary artery bypass graft (CABG) surgery can be undertaken, where appropriate. Another key area of management is in the provision of proven secondary prevention medication and participation in a cardiac rehabilitation/secondary prevention programme.1–7 The principal challenge for the management of ACS patients is the translation of this robust evidence into clinical practice.8–10 Better delivery of proven care has more immediate potential to improve outcomes than treatment innovations.11 To facilitate better service provision, there is a growing recognition of the need for comparative effectiveness research. The American Institute of Medicine identified healthcare delivery systems and cardiovascular care as among the highest priorities for comparative effectiveness research.12 However, there are few studies that simultaneously examine care and outcomes between countries,13 although international comparisons of healthcare systems have the potential to yield important insights and guide policies.14 Australia and New Zealand have many historical, cultural, economic and medical similarities. However, there are also differences in the delivery of healthcare and other variables between the two countries. For example Australia has a major private healthcare contribution to supplement public hospital care of ACS patients, with significant inter-state differences,15 whereas much less privately funded ACS care is seen in New Zealand.16 The ‘SNAPSHOT’ ACS study was a prospective audit of the care provided to consecutive patients admitted with suspected ACS during a 2-week period in Australia and New Zealand in May 2012.15,16 The purpose of the study was to identify current management and available treatments, with the aim of better understanding the ACS environment, in order subsequently to improve ACS patient care. It provided a unique opportunity to examine the delivery of care between the two countries. Methods Study group The binational SNAPSHOT ACS study was a prospective audit of the care provided to consecutive patients Australia and New Zealand SNAPSHOT ACS 2012 Steering Committee David Brieger (NSW) (Co-chair), John French (NSW) (Co-chair), Derek Chew (SA) (Co-chair), Chris Ellis (NZ) (Co-Chair), Gerry Devlin (NZ) (Co-Chair), Chris Hammett (QLD), Bernadette Aliprandi-Costa (NSW), Isuru Ranasinghe (NSW), Bridie Carr (NSW), Julie Redfern (NSW), Fiona Turnbull (NSW), Carolyn Astley (SA), Tom Briffa (WA), Jamie Rankin (WA), Stephen Bloomer (WA), Ahmad Farshid (ACT), Jeffrey Lefkovitz (VIC). Project Managers – State-based Cardiac Clinical Networks New Zealand – Greg Gamble, NSW/ACT – Bernadette Aliprandi-Costa, Bridie Carr, Karen Lintern, Queensland – Tegwen Howell, Cindy Hall, Susanne Spencer, Dayna Williamson, Victoria – Hella Parker, Julie Plunkett, Wendy Wallace-Mitchell, South Australia, TAS, NT Rosanna Tavella, Carolyn Astley, Western Australia – Samantha Thompson. Data Management and Analysis – The George Institute for Global Health and the South Australian Health and Medical Research Institute (SAHMRI) Fiona Turnbull, Isuru Ranasinghe, Julie Redfern, Karice Hyun, Matthew Horsfall, Helen Hughes. New Zealand SNAPSHOT ACS 2012 Steering Committee Chris Ellis (Chair), Greg Gamble, Harvey White (Auckland), Gerald Devlin (Hamilton), Philip Matsis (Wellington), Andrew Hamer (Nelson), John Elliott, Richard Troughton (Christchurch), Michael Williams (Dunedin). Australia and New Zealand SNAPSHOT ACS 2012 Support Funding: The SNAPSHOT ACS study was supported in part by: The Cardiac Society of Australia and New Zealand, The Heart Foundation of Australia, The Agency for Clinical Innovation Cardiac Network (NSW), the Victorian Cardiac Clinical Network, the Queensland Cardiac Clinical Network, the Western Australian Cardiovascular Health Network and the South Australian Cardiac Clinical Network. Conflict of interest: Derek P. Chew: lecture fees AstraZeneca Australia; educational programme: Heart.org, John French: Advisory Board Membership Sanofi Aventis Australia, AstraZeneca Australia, Eli Lilly Australia and Boehringer Ingelheim; Grant in Aid; the Medicines Company. Tom Briffa: Grant In Aid WA Department of Health; travel support WA Department of Health. Chris Hammett: Consultancy Bayer Australia and Eli Lilly Australia; lecture fees Boehringer Ingelheim and Eli Lilly Australia; travel assistance AstraZeneca Australia, Bayer Australia, Boehringer Ingelheim Australia and Eli Lilly Australia, Schering Plough Australia, Abbott Medical Australia. Greg Gamble: Grant Auckland Greenlane Fund. Tegwen Howell: travel assistance Heart Foundation Australia. Stephen Bloomer: Grant WA Department of Health. David Brieger: Advisory Board AstraZeneca Australia, Boehringer Ingelheim Australia, Bayer Australia, Pfizer, BMS Australia; Grants: AstraZeneca Australia, Sanofi Aventis Australia, Merck Schering Plough Australia, Boehringer Ingelheim Australia; lecture fees AstraZeneca Australia, Bayer Australia; travel assistance Bayer Australia, Boehringer Ingelheim Australia. © 2015 Royal Australasian College of Physicians 498 Australia versus NZ ACS SNAPSHOT audit admitted to an Australian or New Zealand hospital with suspected ACS over a 2-week period: 00.00 h on Monday 14 May to 24.00 h on Sunday 27 May 2012. The study methods are outlined in the initial publications.15,16 In summary, the study was designed and run by academic clinicians and researchers from both countries, with widespread support from the Cardiac Society of Australia and New Zealand, and from many associated state and national groups, including cardiac clinical networks.15,16 The binational steering committee, project and data management teams consisted of 31 representatives (see Acknowledgements). A 2-week audit period was accepted as a compromise between the need to collect sufficient patient numbers to obtain an accurate representative cohort versus the ability of unfunded clinicians and nurses to collect consecutive patient data. Data collection Written study protocols were supplied to all participating sites, along with definitions of the various data being collected. The data collection form recorded patient demographics, initial and discharge diagnosis, medication use in hospital and at discharge, as well as investigations undertaken, invasive treatments received and major adverse cardiovascular events (MACE) experienced by patients. Clinical variables enabled the calculation of the Global Registry Acute Coronary Events (GRACE) risk score.17 Ethnicity was self-reported at hospital admission. changes consistent with ischaemia. ‘UAP’ and ‘chest-pain unlikely ischaemic’ reflected local clinical determination. Where the diagnosis remained uncertain in the absence of definitive ECG changes and/or biomarker elevation, but where the patient received in-hospital coronary revascularisation (either PCI or CABG), the classification of ‘chest-pain likely ischaemic’ was applied. Where a clear alternative primary diagnosis emerged, or when evidence of myonecrosis was considered secondary to another disease process (e.g. pulmonary embolus, sepsis), patients were grouped as ‘other diagnosis including secondary myonecrosis’. Patient events and outcome In-hospital MACE, previously defined,15,16 included the occurrence of any one of the following events: death, new or recurrent myocardial infarction (MI), MI following PCI or CABG, major bleeding, stroke, cardiac arrest or worsening heart failure. Clinical event reporting relied on local documentation using a standardised completion note. Formal adjudication of events was not possible. Ethical approval Ethical approval (with opt-out consent) was obtained for Australian sites, except for two hospitals in one state where informed consent applied. In New Zealand’s case, following review by the national multicentre ethics committee, the study was deemed to be an audit of clinical management, and a consent waiver was given for all participating sites.15,16 Patient eligibility and diagnosis The inclusion criterion for the audit was ‘a patient admitted overnight with a suspected or confirmed ACS’. Patients were tracked for the duration of the acute care episode including all transfers between hospitals. Following admission and investigations, a ‘discharge diagnosis’ was subsequently determined by the local clinical team who confirmed the diagnosis of an ACS as an ST – segment elevation myocardial infarction (STEMI), nonSTEMI (NSTEMI) or unstable angina pectoris (UAP) or determined a ‘non-ACS’ presentation resultant on investigations undertaken in hospital and the patient’s clinical course. ‘STEMI/LBBB’ required ST elevation or new onset left bundle branch block (LBBB) on an electrocardiogram (ECG) at any time during the admission, with elevation of cardiac biomarkers except where patients had died prior to biomarkers being taken. ‘NSTEMI’ required evidence of biomarker elevation with or without ECG Statistical analysis Data are presented as mean (standard deviation) or median (interquartile range) as indicated. Comparisons between groups for categorical variables were made using Fisher’s exact test, or the Chi-squared test as appropriate. Between groups comparison of non-normally distributed data was made using Wilcoxon/Kruskall–Wallis test. Confidence intervals for rates were calculated using a mid-P method18 (www.openepi.com, cited 2014 Sept 10). All tests were two tailed, P < 0.05 was considered significant and since all comparisons had been prespecified no adjustment to the overall significance level was made. All analyses were performed using SAS (v9.4, SAS Institute Inc., Cary, NC, USA). A deliberate response to some late data clarification from smaller sites led to minor changes to the baseline data; hence, some data have slightly changed from earlier publications.15,16,19 © 2015 Royal Australasian College of Physicians 499 Ellis et al. Results Patient demographics Over the 2-week period of 14 to 27 May 2012, 4387 patients were admitted with a suspected or confirmed ACS to an Australian (3381 (77%)) or a New Zealand (1006 (23%)) hospital (Fig. 1). Australian patients were 2 years younger; there were mild differences in ethnicity (P < 0.0001) and minor clinical differences (Table 1). Of the 2356 patients with a final diagnosis of a locally confirmed ACS, Australian patients were again younger at 69 vs 72 years (P = 0.0004), and again had mild ethnic differences (P < 0.0001) and modest clinical differences (Table 2). Australian patients were at a lower cardiovascular risk, as assessed by the GRACE hospital admission score,17 with a lower median GRACE score (147 vs 154, P = 0.0008). Investigations, revascularisations and adverse events For the entire cohort (n = 4387), Australian patients were less likely to report the receipt of a chest X-ray (80% vs 91%, P < 0.0001), or a standard exercise treadmill test (8.8% vs 23%, P < 0.0001), but slightly more likely to receive a stress echocardiogram (2.7% vs 1.4%, P = 0.014), stress nuclear study (4.4% vs 0.1%, P < 0.0001) or an invasive cardiac angiogram (38% vs 33%, P = 0.0012) (Table 3). Australian patients had a longer hospital length of stay (2.6 vs 2.2 days, P = 0.019). For patients subsequently determined to have a confirmed ACS (n = 2356), Australian patients were still less likely to report the receipt of a chest x-ray (83% vs 92%, P < 0.0001) or a standard exercise treadmill test AUSTRALIA (n=3,381) NT (n=114) WA (n=352) *Includes Tasmania SA (n=360) QLD (n=695) NSW (n=1138) *Includes ACT Vic (n=722) NEW ZEALAND (n=1006) (4.4% vs 17%, P < 0.0001) (Table 4). However, there was no difference in the number receiving an invasive cardiac angiogram (58% vs 54%, P = 0.082), or revascularisation with PCI (32% vs 31%, P = 0.92) or CABG surgery (7.0% vs 5.6%, P = 0.32). Further, the hospital length of stay did not differ between the two countries. STEMI/LBBB patients There were 419 STEMI/LBBB patients admitted over 2 weeks (Table 5). There was no statistically significant difference between Australia and New Zealand with regards to standard patient demographics; however, Australian patients had fewer exercise treadmill tests (0.6% vs 4.1%, P = 0.029) (Table 5). Reperfusion management and time to treatment of STEMI/LBBB patients Primary PCI in 39% of STEMI/LBBB patients (Australian 37% vs New Zealand 43%, P = 0.34) was the most common form of reperfusion therapy (Table 6). There was no difference in the door to device time (DTDT) with an overall median DTDT of 82 (53, 138) min. Further, 59% patients had a DTDT of ≤90 min (Australia 57% vs New Zealand 67%, P = 0.28), the current target time.1–7 Some 29% of patients had a DTDT of >120 min (Australia 32% vs New Zealand 21%, P = 0.24). Fibrinolytic therapy was received by 25% of STEMI/ LBBB patients (Australian 23% vs New Zealand 32%, P = 0.42). There was no difference in the overall median door to needle time (DTNT) of 42 (interquartile range 25, 70) min. Further, 34% patients had a DTNT of ≤30 min (Australia 36% vs New Zealand 31%, P = 0.81) (Table 6), the current target time.1–7 Australian patients were more likely to receive neither fibrinolysis nor primary PCI as a reperfusion strategy (40% vs 27%, P = 0.017). In addition, although the use of glycoprotein 2b/3a inhibitor medication, bivalirudin and unfractionated heparin were similar, Australian patients were less likely to receive a low molecular weight heparin (42% vs 56%, P = 0.020, Table 5). In both countries, in-hospital death was seen in 7% of patients, with 29% of patients experiencing a MACE (death, new or recurrent MI, major bleeding, stroke, cardiac arrest or worsening heart failure). NSTEMI/UAP patients Figure 1 Number of suspected ACS patients registered (n = 4387) in Australia (n = 3381) and New Zealand (n = 1006). Of the total 1937 NSTEMI/UAP patients, Australian patients were younger (70 vs 73 years, P = 0.0006) and more likely to be male (64% vs 59%, P = 0.048); there © 2015 Royal Australasian College of Physicians 500 Australia versus NZ ACS SNAPSHOT audit Table 1 Baseline demographic data of all of patients admitted with suspected or confirmed ACS (n = 4387) Number of eligible hospitals Participating hospitals (% eligible) Age median (range) (years) Sex (male) Family history Ethnicity Caucasian Maori Aboriginal Pacific Island Torres Strait Islander Asian Indian Other Tobacco smoking Current Past Never Clinical factors Hypertension Diabetes mellitus Dyslipidaemia Atrial fibrillation Renal impairment On dialysis Morbid obesity Mechanical heart valve Chronic liver disease Chronic lung disease Active cancer limiting life Dementia/cognitive impairment Significant impairment mobility/dependent for ADL Prior vascular disease Prior myocardial infarction Prior PCI Prior CABG Prior TIA/Stroke Prior PAD Grace risk score (Granger) GRACE risk score (med/IQR) GRACE score ≥ 140 Killip class (I or II or III/IV) % Australia n = 3381 (77%) New Zealand n = 1006 (23%) Total n = 4387 525 478 (91%) 67 (18,99) 2035 (60%) 1172 (35%) P-value 39 39 (100%) 69 (20,97) 585 (58%) 257 (26%) 564 517 (92%) 67 (18,99) 2620 (60%) 1429 (33%) 0.0044 0.26 <0.0001 2936 (87%) 10 (0.3%) 90 (2.7%) 16 (0.5%) 4 (0.1%) 45 (1.3%) 42 (1.2%) 238 (7.0%) 779 (77%) 86 (8.5%) 0 46 (4.6%) 0 35 (3.5%) 43 (4.3%) 17 (1.7%) 3715 (85%) 96 (2.2%) 90 (2.7%) 62 (1.4%) 4 (0.1%) 80 (1.8%) 85 (1.9%) 255 (5.8%) 646 (19%) 1197 (35%) 1538 (46%) 153 (15%) 432 (43%) 422 (42%) 799 (18%) 1629 (37%) 1956 (45%) 0.0058 <0.0001 0.046 2157 (64%) 879 (26%) 1844 (55%) 494 (15%) 335 (10%) 24 282 (8.3%) 70 (2.1%) 65 (1.9%) 452 (13.3%) 87 (2.6%) 114 (3.4%) 189 (5.6%) 620 (62%) 234 (23%) 539 (54%) 170 (17%) 167 (17%) 9 67 (6.7%) 12 (1.2%) 5 (0.5%) 121 (12%) 19 (1.9%) 34 (3.4%) 56 (5.6%) 2777 (63%) 1113 (25%) 2383 (54%) 664 (15%) 502 (11%) 33 349 (8.0%) 82 (1.9%) 70 (1.6%) 573 (13%) 106 (2.4%) 148 (3.4%) 245 (5.6%) 0.22 0.083 0.61 0.080 <0.0001 899 (27%) 686 (20%) 363 (11%) 326 (10%) 189 (5.6%) 292 (29%) 203 (20%) 103 (10%) 127 (13%) 78 (7.8%) 1191 (27%) 889 (20%) 466 (11%) 453 (10%) 267 (6.1%) 0.15 0.96 0.68 0.99 0.013 141 (115, 168) 504 (51%) 84%/13%/3% 139 (115, 165) 2085 (49%) 86%/11%3% 0.15 0.12 0.079 139 (115, 165) 1577 (48%) 87%/10%/3% <0.0001 0.085 0.084 0.0008 0.29 0.13 0.99 0.99 ADL, activities of daily living; ACS, acute coronary syndrome; CABG, coronary artery bypass graft; GRACE, Global Registry Acute Coronary Events; IQR, interquartile range; PAD, peripheral artery disease; PCI, percutaneous coronary intervention: TIA, transient ischaemic attack. were minor clinical differences (Table 7). Australian patients had a lower GRACE score (143 vs 151, P = 0.0014). Anticoagulation management, GRACE scores and time to treatment of NSTEMI/UAP patients Overall, of the 1937 NSTEMI/UAP patients, 982 (51%) received an invasive coronary angiogram (Table 8). Aus- tralian patients had higher rates of coronary angiography than New Zealand patients (52% vs 46%, P = 0.0011), and Australian patients had a shorter time to angiography (46 h vs 67 h, P < 0.0001). More high-risk Australian NSTEMI/UAP patients with a GRACE score of ≥140 received an angiogram (51% vs 42%, P = 0.013) than equivalent New Zealand patients. These high-risk Australian patients were also more likely to receive their angiogram within 24 h (24% vs © 2015 Royal Australasian College of Physicians 501 Ellis et al. Table 2 Baseline demographic data of patients admitted with confirmed ACS (n = 2356) % ACS admissions/All Age median (range) (years) Sex (male) Family history Ethnicity Caucasian Maori Aboriginal Torres Strait Islander Pacific Island Asian Indian Other Tobacco smoking Current Past Never Clinical factors Hypertension Diabetes mellitus Dyslipidaemia Atrial fibrillation Renal Impairment On dialysis Morbid obesity Mechanical heart valve Chronic liver disease Chronic lung disease Active cancer limiting life Dementia/cognitive impairment Significant impairment mobility/dependent for ADL Prior vascular disease Prior myocardial infarction Prior PCI Prior CABG Prior TIA/Stroke Prior PAD Grace risk score (Granger) GRACE score, median (IQR) % GRACE score ≥ 140 Killip class (I or II or III/IV) % Australia n = 1825 (77%) New Zealand n = 531 (23%) Total n = 2356 54% 69 (20,99) 1194 (65%) 656 (36%) P-value 53% 72 (21,97) 328 (62%) 137 (26%) 54% 70 (20,99) 1522 (65%) 793 (34%) 0.0004 0.12 <0.0001 1593 (87%) 5 (0.3%) 47 (2.6%) 2 (0.1%) 6 (0.3%) 21 (1.2%) 23 (1.2%) 128 (7.0%) 430 (81%) 43 (7.9%) 0 0 21 (4.0%) 10 (1.9%) 18 (3.6%) 9 (1.7%) 2024 (86%) 48 (2.0%) 47 (2.0%) 2 (0.1%) 27 (1.1%) 31 (1.3%) 41 (1.7%) 137 (5.8%) 354 (19%) 708 (39%) 763 (42%) 85 (16%) 232 (44%) 214 (41%) 439 (19%) 940 (40%) 977 (42%) 0.11 0.053 0.53 1240 (68%) 540 (30%) 1082 (59%) 234 (13%) 208 (11%) 17 155 (8.5%) 33 (1.8%) 38 (2.1%) 254 (14%) 48 (2.6%) 56 (3.1%) 95 (5.2%) 357 (67%) 144 (27%) 309 (58%) 92 (17%) 108 (20%) 5 29 (5.5%) 5 (0.9%) 2 (0.4%) 68 (13%) 8 (1.5%) 23 (4.3%) 34 (6.4%) 1597 (68%) 684 (29%) 1391 (59%) 328 (14%) 316 (13%) 22 184 (7.8%) 38 (1.6%) 40 (1.7%) 322 (14%) 56 (2.4%) 79 (3.4%) 129 (5.5%) 0.75 0.28 0.65 0.0054 <0.0001 573 (31%) 420 (23%) 222 (12%) 194 (11%) 126 (6.9%) 179 (34%) 118 (22%) 67 (13%) 80 (15%) 54 (10%) 752 (32%) 538 (23%) 289 (12%) 274 (12%) 180 (7.6%) 0.32 0.72 0.76 0.0070 0.016 147 (125, 173) 1035 (58%) 86%/11%/3.0% 154 (132, 181) 346 (66%) 81%/16%/3.5% 149 (126, 175) 1381 (60%) 85%/12%/3.2% <0.0001 0.022 0.24 0.0040 0.57 0.15 0.17 0.28 0.0008 0.0001 0.053 ADL, activities of daily living; ACS, acute coronary syndrome; CABG, coronary artery bypass graft; GRACE, Global Registry Acute Coronary Events; IQR, interquartile range; PAD, peripheral artery disease; PCI, percutaneous coronary intervention: TIA, transient ischaemic attack. 17%, P < 0.0001) or within 72 h (74% vs 57%, P = 0.0053) than similar New Zealand patients (Fig. 2). Australian patients were less likely to receive low molecular weight heparin treatment (50% vs 68%, P < 0.0001) (Table 7). Overall 12% of patients experienced a MACE, with a hospital death rate of 1.8%. There was no statistical difference in these outcomes between the two countries (Table 8). Discharge medications Of the 2356 confirmed ACS patients, 49 (2.6%) of 1825 Australian patients and 17 (3.2%) of 531 New Zealand patients died in hospital, with 2290 patients subsequently being discharged. Of the 388 surviving patients following a STEMI/LBBB presentation, the use of aspirin, statins, beta-blockers, angiotensin converting enzyme inhibitors/ angiotensin receptor blockers (ACE-I/ARB) and other © 2015 Royal Australasian College of Physicians 502 Australia versus NZ ACS SNAPSHOT audit Table 3 Investigations, revascularisations and events. (all patients, n = 4387) Procedure Chest X-ray Echocardiogram Stress echocardiogram Exercise test Stress nuclear study CT coronary angiogram Conventional angiogram PCI CABG PCI or CABG In-hospital events Major bleed Cardiac arrest Worsening heart failure Stroke MI post-admission In-hospital death MACE† Length of stay, median (IQR) (days) Australia n = 3381 2725 (80%) 1006 (30%) 92 (2.7%) 299 (8.8%) 148 (4.4%) 125 (3.7%) 1299 (38%) 582 (17%) 128 (3.7%) 706 (21%) 34 (1.0%) 65 (1.9%) 236 (7.0%) 16 (0.5%) 63 (1.9%) 63 (1.9%) 354 (10%) 2.6 (1.2, 4.8) New Zealand n = 1006 910 (91%) 287 (29%) 14 (1.4%) 229 (23%) 1 (0.1%) 39 (3.9%) 330 (33%) 169 (17%) 34 (3.4%) 202 (20%) 6 (0.6%) 18 (1.8%) 60 (6.0%) 5 (0.5%) 22 (2.2%) 20 (2.0%) 98 (9.7%) 2.2 (1.0, 4.6) Total n = 4387 P-value 3635 (83%) 1293 (29%) 106 (2.4%) 528 (12%) 149 (3.4%) 164 (3.7%) 1629 (37%) 751 (17%) 162 (3.7%) 908 (21%) <0.0001 0.48 0.014 <0.0001 <0.0001 0.77 0.0012 0.78 0.63 0.60 40 (0.93) 83 (1.9%) 296 (6.7%) 21 (0.5%) 85 (1.9%) 83 (1.9%) 443 (10%) 2.5 (1.1, 4.8) 0.26 0.90 0.28 0.99 0.52 0.79 0.72 0.019 †MACE includes all cause death, new or recurrent MI, major bleeding, stroke, cardiac arrest, worsening heart failure. CABG, coronary artery bypass graft; CT, computed tomography; IQR, interquartile range; MACE, major adverse cardiovascular events; PCI, percutaneous coronary intervention Table 4 Investigations and revascularisations in patients with confirmed ACS (n = 2356): STEMI/LBBB (n = 419), NSTEMI (n = 1012) or UAP (n = 925) Procedure Chest X-ray Echocardiogram Stress echo Exercise test Stress nuclear study CT coronary angiogram Conventional angiogram PCI CABG PCI or CABG In-hospital events Major bleed Cardiac arrest Worsening heart failure Stroke MI post-admission In-hospital death MACE† Length of stay, median (IQR) (days) Australia n = 1825 1515 (83%) 662 (36%) 35 (1.9%) 81 (4.4%) 64 (3.5%) 67 (3.7%) 1054 (58%) 577 (32%) 127 (7.0%) 700 (38%) 28 (1.5%) 50 (2.7%) 189 (10%) 12 (0.6%) 58 (3.2%) 49 (2.7%) 272 (15%) 3.6 (2.0, 5.8) New Zealand n = 531 488 (92%) 210 (40%) 4 (0.8%) 89 (17%) 1 (0.2%) 23 (4.3%) 284 (54%) 166 (31%) 30 (5.6%) 195 (37%) 5 (0.9%) 14 (2.6%) 47 (8.9%) 4 (0.8%) 20 (3.8%) 17 (3.2%) 80 (15%) 3.5 (1.9, 6.0) Total n = 2356 P-value 2003 (85%) 872 (37%) 39 (1.7%) 170 (7.2%) 65 (2.8%) 90 (3.8%) 1338 (57%) 743 (32%) 157 (6.7%) 895 (38%) <0.0001 0.18 0.080 <0.0001 <0.0001 0.52 0.082 0.92 0.32 0.51 33 (1.4%) 64 (2.7%) 236 (10%) 16 (0.7%) 78 (3.3%) 66 (2.8%) 352 (15%) 3.6 (2.0, 5.8) 0.40 0.99 0.33 0.77 0.49 0.55 0.95 0.65 †MACE includes all cause death, new or recurrent MI, major bleeding, stroke, cardiac arrest, worsening heart failure. ACS, acute coronary syndrome; CABG, coronary artery bypass graft; CT, computed tomography; NSTEMI, non-segment elevation myocardial infarction; MACE, major adverse cardiovascular events; STEMI,/LBBB, segment elevation myocardial infarction/ left bundle branch block; PCI, percutaneous coronary intervention; UAP, unstable angina pectoris. © 2015 Royal Australasian College of Physicians 503 Ellis et al. Table 5 Demographics, investigations and management of ‘STEMI/LBBB‘ patients Demographics Age, median (range) Sex (male %) Family history Prior MI Prior PCI Prior CABG Prior TIA/Stroke GRACE dcore median (IQR) % GRACE score ≥ 140 Investigations/Management Chest X-ray Echocardiogram Stress echo Exercise test CT angiogram Conventional angiogram Total PCI CABG Anti-coagulation GP IIb/IIIa inhibitor Bivalirudin UF heparin LMW heparin STEMI/LBBB Australia n = 321 (77%) STEMI/LBBB New Zealand n = 98 (23%) Total P-value n = 419 63 (30, 99) 228 (71%) 102 (32%) 59 (18%) 36 (11%) 18 (5.6%) 16 (5.0%) 170 (145, 199) 250 (80%) 68 (33, 97) 73 (75%) 22 (22%) 15 (15%) 11 (11%) 3 (3.1%) 7 (7.1%) 171 (149, 193) 83 (86%) 0.092 0.61 0.079 0.55 0.99 0.43 0.45 0.79 0.056 64 (30, 99) 301 (72%) 124 (30%) 74 (18%) 47 (11%) 21 (5.0%) 23 (5.5%) 171 (146, 197) 313 (76%) 268 (84%) 194 (60%) 2 (0.6%) 2 (0.6%) 12 (3.7%) 270 (84%) 208 (65%) 28 (8.7%) 87 (89%) 70 (71%) 1 (1%) 4 (4.1%) 4 (4.1%) 86 (88%) 66 (67%) 6 (6.1%) 0.26 0.056 0.55 0.029 0.77 0.42 0.72 0.53 355 (85%) 264 (63%) 3 (0.7%) 6 (1.4%) 16 (3.8%) 356 (85%) 274 (65%) 34 (8.1%) 90 (28%) 7 (2.2%) 219 (68%) 136 (42%) 28 (29%) 3 (3.1%) 73 (75%) 55 (56%) 0.90 0.70 0.26 0.020 118 (28%) 10 (2.4%) 292 (70%) 191 (46%) CABG, coronary artery bypass graft; CT, computed tomography; GRACE, Global Registry Acute Coronary Events; IQR, interquartile range; LMW, low molecular weight; MACE, major adverse cardiovascular events; MI, myocardial infarction; STEMI/LBBB, segment elevation myocardial infarction/left bundle branch block; PCI, percutaneous coronary intervention; TIA, transient ischaemic attack; UAP, unstable angina pectoris; UF, unfractionated. lipid medication was not statistically different, but fewer Australian patients received dual anti-platelet therapy at discharge (83% vs 98%, P < 0.0001) (Table 9). Of the 1902 surviving patients after a NSTEMI/UAP presentation, Australian patients were less likely to receive aspirin (84% vs 89%, P = 0.0079) or a betablocker (67% vs 77%, P = 0.0002), but more likely to receive an ACE-I/ARB medicine (65% vs 58%, P = 0.0060) or ‘other’ lipid lowering agent (8.2% vs 5.47%, P = 0.024). Statin use was similar in Australia (80%) and New Zealand (83%) (P = 0.21) (Table 9). Rehabilitation/scheduled outpatient investigations Referrals for cardiac rehabilitation were low, with less than half of discharged confirmed ACS patients having a recorded referral for any of the six indicators assessed (Table 10). Australian patients were less likely to be referred as an in-patient in four of the five services, whereas they were more likely to be referred to an outpatient service (Table 10). Few patients were scheduled for outpatient investigations after hospital discharge, and there was no statistical difference in these numbers of patients between the two countries. Discussion The SNAPSHOT ACS study has enabled a comparison of 4387 Australian and New Zealand patients admitted to hospital with a suspected or confirmed ACS. Overall, the patient demographic differences between the two countries were quite small, although the ethnic mix gives an interesting insight into some minor population differences. Nonetheless, the similar ACS population does allow a reasonably valid comparison of ACS management across the two countries. Patients admitted with a suspected ACS require investigations to help to make an accurate medical diagnosis. However, we found that less than half of patients received an anatomical assessment of left ventricular function with an echocardiogram, or of the coronary arteries with a computed tomography coronary angiogram or an invasive © 2015 Royal Australasian College of Physicians 504 Australia versus NZ ACS SNAPSHOT audit Table 6 Reperfusion management and time to treatment of ‘STEMI/LBBB‘ patients Reperfusion Fibrinolysis† Primary PCI Number with rescue PCI (n) Neither fibrinolysis nor Primary PCI Reperfusion time frames Number with pre-hospital fibrinolysis (n) Number with in-hospital fibrinolysis (n) Median DTNT (IQR) (min)‡ % DTNT ≤ 30 min Primary PCI time frames Number with primary PCI (PCI) DTDT (All in-hospital PPCI) median (IQR) (min) DTDT % ≤ 90 min DTDT % ≤ 120 min Start of angiogram to DT median (IQR) (min) Angiogram time frames Points with routine angiogram (excluding PPCI/Rescue PCI) Time to routine angiogram (h) Time to routine angiogram ≤ 24 h In-hospital events Major bleed Cardiac arrest Worsening heart failure CVA MI post-admission In-hospital death MACE§ Length of stay (median IQR) STEMI/LBBB Australia n = 321 (77%) STEMI/LBBB New Zealand n = 98 (23%) P-value n = 419 74 (23%) 120 (37%) 19 (6%) 129 (40%) 31 (32%) 42 (43%) 6 (6%) 26 (27%) 0.42 0.34 0.99 0.017 105 (25%) 162 (39%) 25 (6%) 155 (37%) 3 (3.1%) 28 (29%) 48 (28, 84) 9 (31%) 0.99 0.096 0.32 0.81 10 (3.1%) 64 (20%) 42 (25, 68) 22 (36%) 120 (37%) 82 (52, 143) 68/120 (57%) 82/120 (68%) 20 (14, 29) 42 (43) 82 (56, 93) 28/42 (67%) 33/42 (79%) 22 (13, 27) Total 0.42 0.81 0.28 0.24 0.78 13 (3.1%) 92 (22%) 42 (25, 70) 31 (34%) 162 (39%) 82 (53, 138) 96/162 (59%) 115/162 (71%) 20 (14, 28) 65 (20%) 23 (14, 52) 34 (52%) 18 (18%) 36 (21, 67) 5 (28%) 0.99 0.098 0.11 83 (20%) 28 (15, 53) 38 (46%) 9 (2.8%) 25 (7.7%) 61 (19%) 7 (2.2%) 17 (5.3%) 24 (7.5%) 93 (29%) 4.4 (3.0, 6.6) 1 (1%) 9 (9%) 16 (16%) 1 (1%) 5 (5%) 7 (7%) 29 (30%) 3.7 (2.9, 6.1) 0.46 0.67 0.66 0.69 0.99 0.99 0.90 0.081 10 (2.4%) 34 (8.1%) 77 (18%) 8 (1.9%) 22 (5.3%) 31 (7.4%) 122 (29%) 4.1 (2.9, 6.6) †Includes one NZ patient and two Australian treated with pharmaco-invasive intervention (fibrinolysis + PPCI). ‡Excludes pre-hospital fibrinolysis. §MACE includes all cause death, new or recurrent MI, major bleeding, stroke, cardiac arrest, worsening heart failure. CVA, cerebrovascular accident; DTNT, door to needle time; DTDT, door to device time; DT, device time; IQR, interquartile range; MACE, major adverse cardiovascular events; NZ, New Zealand; PCI, percutaneous coronary intervention; PPCI, primary percutaneous coronary intervention. STEMI/LBBB, segment elevation myocardial infarction/left bundle branch block. cardiac angiogram. Further, less than one fifth received a functional cardiac assessment with a standard treadmill test, stress echocardiogram or a stress nuclear study. The ‘optimal’ level for these tests is unclear, but the numbers do suggest a limited availability or underutilisation of diagnostic investigations. This was seen across Australia and New Zealand. For patients with a confirmed ACS, optimal management is already defined in guidelines.1–7 Overall, a low level of cardiac investigations was available to patients admitted with an ACS. Many ACS patients are not assessed with an echocardiogram or an invasive cardiac angiogram. Even if some patients are particularly frail, and it would be inappropriate for them to undergo an invasive cardiac angiogram, just under half of the patients who did not receive this test would not fit into this category. Further, few patients would be so frail that a non-invasive echocardiogram would not help to guide good management, but it was performed in only one third of the confirmed ACS patients. There was again a similarly low level of investigations seen in both countries. It might have been thought that increased spending on health would result in increased access to these investigations. The 2011 Organisation for Economic Cooperation and Development reported that Australia has about twice the gross domestic product of New Zealand (US$ 68 099.60 vs US$ 38 587.90 per capita, respectively) and spends about 8.6% of gross domestic product (GDP) on health compared with 10% of GDP spent on health in New Zealand.20 Total health expenditure per capita (USD purchasing power parity) was reported to be $3800 in Australia and $3182 in New Zealand. However, despite © 2015 Royal Australasian College of Physicians 505 Ellis et al. Table 7 Demographics, investigations and management of ‘NSTEMI/UAP‘ patients Demographics Age, median (IQR) (years) Sex (male %) Family history Prior MI Prior PCI Prior CABG Prior TIA/Stroke Grace score (median IQR) % GRACE score ≥ 140 Investigations/Management Chest X-ray Echocardiogram Stress echo Stress nuclear study Exercise test CT angiogram Conventional angiogram Total PCI CABG Anti-Coagulation Fibrinolysis UF heparin LMW heparin GP IIb/IIIa inhibitor Bivalirudin NSTEMI/UAP Australia n = 1504 (78%) NSTEMI/UAP New Zealand n = 433 (22%) P-value Total NSTEMI/UAP n = 1937 70 (60, 79) 966 (64%) 554 (37%) 514 (34%) 384 (26%) 204 (14%) 178 (12%) 143 (122, 166) 785 (53%) 73 (62, 82) 255 (59%) 115 (27%) 164 (38%) 107 (25%) 64 (15%) 73 (17%) 151 (127, 175) 263 (61%) 0.0006 0.048 <0.0001 0.17 0.75 0.53 0.0073 0.0014 0.0024 71 (61, 80) 1221 (63%) 669 (35%) 678 (35%) 491 (25%) 268 (14%) 251 (13%) 145 (123, 168) 1482 (78%) 401 (93%) 140 (32%) 3 (0.7%) 1 (0.2%) 85 (20%) 19 (4.4%) 198 (46%) 100 (23%) 24 (5.5%) <0.0001 0.64 0.043 <0.0001 <0.0001 0.48 0.019 0.57 0.50 1648 (85%) 608 (31%) 36 (1.9%) 63 (3.2%) 164 (8.5%) 74 (3.8%) 982 (51%) 469 (24%) 123 (6.4%) 0 131 (30%) 293 (68%) 11 (2.5%) 3 (0.7%) 0.99 0.95 <0.0001 0.15 0.45 2 (0.10%) 583 (30%) 1043 (54%) 73 (3.8%) 23 (1.2%) 1247 (83%) 468 (31%) 33 (2.2%) 62 (4.0%) 79 (5.3%) 55 (3.7%) 784 (52%) 369 (25%) 99 (6.6%) 2 (0.10%) 452 (30%) 750 (50%) 62 (4.1%) 20 (1.3%) CABG, coronary artery bypass graft; CT, computed tomography; GP, glycoprotein; GRACE, Global Registry Acute Coronary Events; IQR, interquartile range; MI, myocardial infarction; NSTEMI/UAP, segment elevation myocardial infarction/unstable angina pectoris; PCI, percutaneous coronary intervention; TIA, transient ischaemic attack; UF, unfractionated. Table 8 Anticoagulation management, GRACE scores and time to treatment of ‘NSTEMI/UAP‘ patients Angiogram time frames† Number of conventional angiograms Time to angiography (median IQR) (h) GRACE score ≥ 140‡ GRACE score ≥ 140 + angiogram GRACE score ≥ 140 + angiogram ≤ 24 h GRACE score < 140 (n) GRACE score < 140 + angiogram GRACE score < 140 + angiogram ≤ 72 h In-hospital events Major bleed Cardiac arrest Worsening heart failure CVA MI post-admission In-hospital death MACE§ Length of stay (median IQR) (days) Australia n = 1504 (78%) New Zealand n = 433 (22%) P-value Total n = 1937 784 (52%) 46 (23, 77) 785 (53%) 398 (51%) 96 (24%) 697 (47%) 375 (54%) 278 (74%) 198 (46%) 67 (32, 96) 263 (61%) 110 (42%) 19 (17%) 166 (39%) 87 (52%) 50 (57%) 0.0011 <0.0001 0.0024 0.013 <0.0001 0.0024 0.75 0.0053 982 (51%) 49 (24, 85) 1048 (55%) 508 (48%) 115 (23%) 863 (45%) 462 (54%) 328 (71%) 19 (1.3%) 25 (1.7%) 128 (8.5%) 5 (0.3%) 41 (2.7%) 25 (1.6%) 179 (12%) 3.2 (1.8, 5.5) 4 (0.9%) 5 (1.2%) 31 (7.2%) 3 (0.7%) 15 (3.5%) 10 (2.3%) 51 (12%) 3.5 (1.8, 6.0) 0.80 0.66 0.43 0.39 0.42 0.41 0.99 0.34 23 (1.2%) 30 (1.5%) 159 (8.2%) 8 (0.4%) 56 (2.9) 35 (1.8%) 230 (12%) 3.3 (1.8, 5.7) †Data from two angiograms are excluded because times unavailable. ‡GRACE score could not be calculated for 28 patients. §MACE includes all cause death, new or recurrent MI, major bleeding, stroke, cardiac arrest, worsening heart failure. CVA, cerebrovascular accident; GRACE, Global Registry Acute Coronary Events; IQR, interquartile range; MACE, major adverse cardiovascular events; MI, myocardial infarction. © 2015 Royal Australasian College of Physicians 506 Australia versus NZ ACS SNAPSHOT audit Figure 2 Proportion of ‘high risk’ NSTEMI/UAP patients (GRACE score ≥ 140) with time to angiogram less than 24 or 72 h. □, New Zealand; , Australia. this difference in healthcare spending, the investigations received by suspected or confirmed ACS patients were remarkably similar. We found that for NSTEMI/UAP patients, there was a slightly higher rate and more rapid access to cardiac angiography in Australia. This might be a reflection of higher healthcare spending in Australia, although the differences between the two countries were not great. Further, there are so many unknown variables, such as the relative costs of angiography, the availability and cost of medical and non-medical staff, the relative costs of maintaining the healthcare facilities, the relative geography, local and regional hospital provision, etc., which prevent any firm conclusion being drawn. However, overall the data are remarkable for the similarities seen between the two countries rather than the differences. We also found some other areas of ACS management where there seemed to be suboptimal delivery of proven treatments. Approximately one third of STEMI patients did not receive reperfusion therapy. This figure is consistent with overseas experience. In a recent study describing Table 9 Discharge medications of confirmed ACS patients (NZ n = 514: – 17 in hospital deaths, Australia n = 1776: – 49 in hospital deaths) STEMI/LBBB Aspirin (1) Other antiplatelet (2) Dual antiplatelet (1&2) Beta blocker ACE-I/ARB Statin Other lipid lowering Australia n = 297 New Zealand n = 91 284 (96%) 245 (83%) 242 (82%) 242 (82%) 221 (74%) 270 (91%) 14 (5%) 90 (99%) 89 (98%) 90 (98%) 75 (82%) 74 (81%) 86 (95%) 1 (1%) NSTEMI/UAP P-value Total (n = 388) Australia n = 1429 New Zealand n = 423 P-value Total n = 1902 0.20 <0.0001 <0.0001 0.99 0.21 0.38 0.13 374 (96%) 334 (86%) 331 (85%) 317 (82%) 295 (76%) 356 (92%) 15 (3.8%) 1246 (84%) 846 (57%) 768 (52%) 991 (67%) 962 (65%) 1189 (80%) 121 (8.2%) 378 (89%) 265 (63%) 260 (62%) 324 (77%) 244 (58%) 352 (83%) 23 (5.4%) 0.0079 0.050 0.0006 0.0002 0.006 0.21 0.024 1642 (85%) 1111 (58%) 1028 (54%) 1315 (69%) 1206 (63%) 1541 (81%) 144 (7.6%) ACE-I/ARB, angiotensin converting enzyme inhibitors/angiotensin receptor blocker; ACS, acute coronary syndrome; NSTEMI/UAP, non-segment elevation myocardial infarction/unstable angina pectoris; STEMI/LBBB, segment elevation myocardial infarction/ left bundle branch block. Table 10 In-hospital cardiac rehabilitation/scheduled outpatient investigations in those discharged alive In-hospital rehabilitation/screening In-hospital cardiac rehabilitation Smoking cessation advice/intervention Screening for depression Dietary modification advice Physical activity advice Referral to OP cardiac rehabilitation Scheduled outpatient investigations Coronary angiogram PCI CABG Function test Echocardiogram Australia n = 1776 New Zealand n = 514 P-value Total n = 2290 703 (40%) 355 (20%) 163 (9.2%) 668 (37%) 775 (44%) 853 (48%) 258 (50%) 143 (28%) 65 (13%) 161 (31%) 212 (41%) 210 (41%) <0.0001 0.0003 0.024 0.0092 0.34 0.0042 961 (42%) 499 (22%) 228 (10%) 829 (36%) 987 (43%) 1063 (46%) 101 (5.7%) 53 (3.0%) 42 (2.4%) 199 (11%) 145 (8.2%) 18 (3.5%) 9 (1.8%) 11 (2.1%) 49 (9.5%) 43 (8.4%) 0.055 0.16 0.53 0.30 0.86 119 (5.2%) 62 (2.7%) 53 (2.3%) 248 (11%) 188 (8.2%) CABG, coronary artery bypass graft; OP, outpatient; PCI, percutaneous coronary intervention. © 2015 Royal Australasian College of Physicians 507 Ellis et al. the current situation in 30 European countries, no reperfusion therapy was given to 7% to 63% of patients.21 Why this occurs is unknown, and further assessment as to how an increase in reperfusion in Australia and New Zealand can be achieved is certainly required. Improvements in ACS patient care have been reported22 with attention to detail in several clinical areas resulting in improved patient outcomes.23 We also found that many areas of secondary prevention management seemed to be suboptimal. Up to half of ACS events occur in individuals who have had a prior hospital admission for coronary heart disease,24 emphasising the need for widespread use of secondary prevention medication as well as comprehensive cardiac rehabilitation/secondary prevention programmes. There are certainly some patients who are unsuitable candidates for individual medications, but the numbers of patients not being discharged on proven secondary medication is of concern. Once more, although there was a minor difference in uptake of these services between Australia and New Zealand, the major issue is clearly one of a missed opportunity to better deliver these proven strategies to many patients in each country19). The SNAPSHOT ACS Study has been an extensive programme designed to understand current ACS patient management in Australia and New Zealand. Further in depth assessment of the structure of the clinical services, which are central to the delivery of healthcare to individual patients, is certainly warranted to try to find solutions to the limitations seen across the two countries. These challenges of service delivery are common to all References 1 Chew DP, Aroney CN, Aylward PE, Kelly AM, White HD, Tideman PA et al. 2011 Addendum to the National Heart Foundation of Australia/Cardiac Society of Australia and New Zealand Guidelines for the management of acute coronary syndromes (ACS) 2006. Heart Lung Circ 2011; 20: 487–502. 2 ST-Elevation Myocardial Infarction Guidelines Group and the New Zealand Branch of the Cardiac Society of Australia and New Zealand. ST-elevation myocardial infarction: New Zealand management guidelines, 2013. N Z Med J 2013; 126: 127–64. 3 Non ST-Elevation Acute Coronary Syndrome Guidelines Group and the New Zealand Branch of the Cardiac Society of Australia and New Zealand. New Zealand 2012 guidelines for the contemporary ACS management services, and warrant the ongoing development of therapeutic advances, clinical trials, practice guidelines and performance and outcome measures, termed the ‘cycle of quality’.25 The advent of local clinical networks is likely to facilitate greatly improvements in ACS care in many areas.26,27 There are several limitations to our study, including the fact that although the majority of ACS patients were identified, we could not guarantee consecutive recruitment over the 2-week period. The scope of this paper was to report binational comparison data of acute in-hospital management and outcomes, thus we have not included follow-up data nor have we reported differences in ACS management between city and more geographically isolated, rural populations. Neither has the scope of this paper included a review of comparative cost structures across Australia and New Zealand, although all of these areas may importantly advance knowledge. Conclusion Overall the management of suspected or confirmed ACS patients showed more similarities than differences between Australia and New Zealand. However, some limitation to important investigations and treatments was seen in both countries. It is likely that most patient benefit will come from a coordinated, ongoing assessment of the available clinical services within each country, with timely feedback to focus improvements in the management of ACS patients in both countries. management of non ST-elevation acute coronary syndromes. N Z Med J 2012; 125: 122–47. 4 Steg PG, James SK, Atar D, Badano LP, Blömstrom-Lundqvist C, Borger MA et al. ESC Guidelines for the management of acute myocardial infarction in patients presenting with ST-segment elevation: the task force on the management of ST-segment elevation acute myocardial infarction of the European Society of Cardiology (ESC). Eur Heart J 2012; 33: 2569–619. 5 Hamm CW, Bassand J-P, Agewall S, Bax J, Boersma E, Bueno H et al. ESC Guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation: the task force for the management of acute coronary syndromes (ACS) in patients presenting without persistent ST-segment elevation of the European Society of Cardiology (ESC). Eur Heart J 2011; 32: 2999–3054. 6 O’Gara PT, Kushner FG, Ascheim DD, Casey DE Jr, Chung MK, de Lemos JA et al. 2013 ACCF/AHA guideline for the management of ST-elevation myocardial infarction: a report of the American College of Cardiology Foundation/ American Heart Association Task Force on Practice Guidelines. J Am Coll Cardiol 2013; 61: e78–140. 7 Anderson JL, Adams CD, Antman EM, Bridges CR, Califf RM, Casey DE Jr et al. 2012 ACCF/AHA focused update incorporated into the ACCF/AHA 2007 guidelines for the management of patients with unstable angina/nonST-elevation myocardial infarction: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice © 2015 Royal Australasian College of Physicians 508 Australia versus NZ ACS SNAPSHOT audit 8 9 10 11 12 13 14 15 Guidelines. J Am Coll Cardiol 2013; 61: e179–347. Astley CM, MacDougall CJ, Davidson PM, Chew DP. Lost in translation: health resource variability in the achievement of optimal performance and clinical outcome. Circ Cardiovasc Qual Outcomes 2011; 4: 512–20. Ellis CJ, Hamer AW. Cardiovascular Health in New Zealand: areas of concern and targets for improvement in 2008 and beyond. N Z Med J 2008; 121: 5–10. White HD. Systems of care: need for hub and spoke systems of care for patients with myocardial infarction. A call for action. N Z Med J 2010; 123: 7–10. White HD, Chew DP. Acute myocardial infarction. Lancet 2008; 372: 570–84. Iglehart JK. Prioritizing comparative-effectiveness research-IOM recommendations. N Engl J Med 2009; 361: 325–8. Chung SC, Gedeborg R, Owen N, James S, Jeppsson A, Wolfe C et al. Acute myocardial infarction: a comparison of short-term survival in national outcome registries in Sweden and the UK. Lancet 2014; 383: 1305–12. Levy AR, Mitton C, Johnstone KM, Harrigan B, Briggs AH. International comparison of comparative effectiveness research in five jurisdictions: insight for the US. Pharmacoeconomics 2010; 28: 813–30. Chew DP, French J, Briffa TG, Hammett CJ, Ellis CJ, Ranasinghe I et al. Acute coronary syndrome care across Australia and New Zealand: the SNAPSHOT ACS study. MJA 2013; 199: 1–7. 16 Ellis C, Gamble G, Devlin G, Elliott J, Hamer A, Williams M et al. The management of acute coronary syndrome patients across New Zealand in 2012: results of a third comprehensive nationwide audit and observations of current care. N Z Med J 2013; 126: 36–68. 17 Granger CB, Goldberg RJ, Dabbous O, Pieper KS, Eagle KA, Cannon CP et al. Predictors of hospital mortality in the Global Registry of Acute Coronary Events. Arch Intern Med 2003; 163: 2345–53. 18 Rothman KJ, Boice JD Jr. Epidemiologic Analysis with a Programmable Calculator (NIH Publication 79-1649). Washington, DC: US Government Printing Office; 1979. 19 Redfern J, Hyun K, Chew DP, Astley C, Chow C, Aliprandi-Costa B et al. Prescription of secondary prevention medications, lifestyle advice, and referral to rehabilitation among acute coronary syndrome inpatients: results from a large prospective audit in Australia and New Zealand. Heart 100: 1281–8. 20 OECD. Health at a Glance 2013: OECD Indicators. France: OECD Publishing; 2013. 21 Widimsky P, Wijns W, Fajadet J, de Belder M, Knot J, Aaberge L et al. Reperfusion therapy for ST elevation acute myocardial infarction in Europe: description of the current situation in 30 countries. Eur Heart J 2010; 31: 943–57. 22 Gibson CM, Pride YB, Frederick PD, Pollack CV Jr, Canto JG, Tiefenbrunn AJ 23 24 25 26 27 et al. Trends in reperfusion strategies, door-to-needle and door-to-balloon times, and in-hospital mortality among patients with ST-segment elevation myocardial infarction enrolled in the National Registry of Myocardial Infarction from 1990 to 2006. Am Heart J 2008; 156: 1035–44. Peterson ED, Shah BR, Parsons L, Pollack CV Jr, French WJ, Canto JG et al. Trends in quality of care for patients with acute myocardial infarction in the National Registry of Myocardial Infarction from 1990 to 2006. Am Heart J 2008; 156: 1045–55. Briffa T, Hobbs M, Tonkin A, Sanfilippo FM, Hickling S, Ridout SC et al. Population trends of current coronary heart disease event rates remain high. Circ Cardiovasc Qual Outcomes 2011; 4: 107–13. Califf RM. The benefits of moving quality to a national level. Am Heart J 2008; 156: 1019–22. Kerr AJ, Lin A, Lee M, Ternouth I, Killion B, Devlin G. Risk stratification and timing of coronary angiography in acute coronary syndromes: are we targeting the right patients in a timely manner? (ANZACS-QI 1). N Z Med J 2013; 126: 69–80. Tideman PA, Tirimacco R, Senior DP, Setchell JJ, Huynh LT, Tavella R et al. Impact of a regionalised clinical cardiac support network on mortality among rural patients with myocardial infarction. MJA 2014; 200: 157–60. Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Appendix I Participating hospitals. © 2015 Royal Australasian College of Physicians 509 Assessing the use of initial oxygen therapy in chronic obstructive pulmonary disease patients: a retrospective audit of pre-hospital and hospital emergency management C. Susanto1 and P. S. Thomas1,2 1 Department of Respiratory Medicine, Prince of Wales Hospital and 2Inflammation and Infection Research Centre (IIRC), Faculty of Medicine, University of New South Wales, Sydney, New South Wales, Australia Key words oxygen, emergency, chronic obstructive pulmonary disease, ambulance, hospital. Correspondence Clarissa Susanto, Department of Respiratory Medicine, Prince of Wales Hospital, PO Box 295, Sydney, NSW 2060, Australia. Email: [email protected]; [email protected] Received 25 August 2014; accepted 1 February 2015. doi:10.1111/imj.12727 Abstract Background: Carbon dioxide retention in chronic obstructive pulmonary disease (COPD) exacerbations can be a complication of oxygen therapy. Current recommendations suggest an inspired oxygen level (FiO2) < 0.28, aiming for saturation (SpO2) of 88–92% until arterial blood gas analysis is available. Aims: This study aims to assess the use of O2 therapy and FiO2 in the emergency management of patients with a known diagnosis of COPD. Methods: Retrospective audit of 150 COPD patients admitted over 18 months, data being extracted from the hospital records. Results: Of the records reviewed, 57% were male, mean age 75 years. COPD was recognised in 53%. SpO2 recorded in 124 patients, with SpO2 < 88% seen in 40 patients. Oxygen was administered in 123 patients in ambulances; high flow in 111 patients, and only 12 patients received O2 therapy in line with the recommended FiO2 < 0.28. In the emergency department (ED), 112 patients received O2 supplementation; high flow given in 68 patients. Hypercapnia was seen in 71 patients; FiO2 > 0.28 given in 54 patients in ambulances and in 35 patients in ED. Non-invasive ventilation was required in 53 patients; FiO2 > 0.28 given in 29 patients in the ED. Seven patients were admitted to intensive care unit, and 10 patients died. Conclusion: High-flow oxygen is used for the initial treatment of COPD exacerbations, but only 53% are recognised as having COPD. A FiO2 > 0.28 is often initiated before admission and continued in the ED. A larger study would be required to assess any possible harm of this approach, but education of those involved in the care of COPD patients may reduce the risk of complications of hypercapnia. Introduction The administration of oxygen (O2) is a common intervention during acute medical care in emergency situations. It is often initially administered in high concentrations. Hypoxaemia should be treated without delay, but the development of carbon dioxide (CO2) retention following O2 therapy is a complication seen in some patients with lung diseases including chronic obstructive pulmonary disease (COPD). Hypercapnia in COPD patients following O2 therapy is a well-established risk that has been Funding: None. Conflict of interest: None. described in many papers dating back more than 50 years.1–4 The current recommendation by the British Thoracic Society (BTS) and the Australian COPDX Plan is that the fractional inspired O2 (FiO2) should be no more than 0.28 when administered to patients with an exacerbation of COPD, until the result of an arterial blood gas analysis (ABG) is available, and for nebulised bronchodilators to be given with compressed air rather than oxygen as the driving gas.5,6 The importance of controlled O2 therapy may be a lower priority in pre-hospital and emergency settings as failure to correct inadequate oxygenation is often perceived to be more dangerous than excessive administration.7–9 Hypercapnic respiratory failure and respiratory acidosis associated with a FiO2 > 0.28 are © 2015 Royal Australasian College of Physicians 510 Audit of oxygen therapy in COPD patients observed in patients admitted under the care of respiratory services.10 We conducted this study with the aims of assessing the use of O2 therapy and FiO2 in the emergency management of COPD patients who were admitted to this hospital, and to assess any associated outcomes with regards to this practice. Aims This study assessed retrospectively the use of O2 therapy and FiO2 in the emergency management of COPD patients who were admitted to hospital, and to document the outcomes. We hypothesised that a higher FiO2 administration may be used than recommended and might be associated with higher rates of morbidity and mortality. Methods A retrospective audit was performed randomly on 150 medical records of patients who were admitted to Prince of Wales Hospital Respiratory Department with an acute exacerbation of COPD between 1 January 2011 and 30 June 2013. Patients included in the audit had to present initially through the emergency department (ED), and they also had to be brought into the hospital by ambulance. The audit included assessment of the ambulance records in the paper hospital records, as well as the electronic medical records. Only patients who had a known pre-existing COPD diagnosis were included in this study. The diagnosis of COPD was obtained via the diseaserelated group coding provided by the medical records department and a record of a diagnosis of COPD by a respiratory physician on an outpatient clinic letter together with previous appropriate spirometry results and a history of current or previous smoking. The severity was assessed by the spirometry results based on the COPDX criteria.7 In cases where the clinic letter did not specify the severity of COPD, this was recorded as unknown. The patients’ demographics, oxygen saturations (SpO2), oxygen delivery and types of oxygen supplementation, blood gas results, mortality and associated morbidity such as hypercapnia, non-invasive ventilation (NIV) usage, intensive care unit (ICU) admission and requirement for intubation were collated. Hypercapnia was defined as a partial pressure of arterial carbon dioxide (PaCO2) > 45 mmHg. Oxygen therapy was classified as high flow or low flow, with high flow being defined as O2 delivery by Hudson Mask (HM), non-rebreather mask (NRB) or via nasal cannula with flow rate >2 L/min. Oxygen delivery by nasal cannula is highly variable, but 1–2 L/min of O2 delivers a FiO2 between 0.24–0.38, depending on whether the patient mouth breathes during the administration.11,12 Results In this audit of 150 medical records, 86 patients were male and 64 were female. The mean age of the patient cohort was 75 years old (SD = 8.7). Outside the hospital, the initial recognition of COPD was noted in 80 patients (53%), and the majority of the patients had severe COPD (Table 1). Thirty-six patients were on long-term home O2 supplementation and of these, 29 received O2 supplementation at a flow rate higher than their usual rates. Twenty-one of these patients had received the FiO2 > 0.28 via either HM or NRB (HM = 15, NRB = 6). Out of the 29 patients, 11 patients had O2 saturations defined as low by standard convention (i.e. SpO2 < 94%). The median SpO2 in these 20 patients was 89% (range 60–95%). Oxygen saturations The O2 saturation was recorded in 124 patients (83%) prior to hospital. The mean O2 saturation in patients audited was 88% (SD 7.73, CI 95% = 86.76–89.24%). An oxygen saturation of <88% was observed in 40 patients, SpO2 of 88–92% seen in 42 patients and SpO2 of >92% in 42 patients. Initial oxygen therapy Oxygen supplementation was administered at some stage during the ambulance transfers in 123 patients (82%), with 111 patients (75%) receiving a FiO2 > 0.28. The most common device to deliver O2 therapy was via HM (Fig. 1). Nebulised bronchodilators were given in 25 patients, but in 18 these were administered with 8 L/min O2 rather than air. A FiO2 of >0.28 was administered in 33 patients with SpO2 < 88%, 27 patients with SpO2 88–92% and in 32 patients with SpO2 > 92% (Fig. 2). Of those with SpO2 > 92%, 22 patients received O2 supplementation via HM, five patients via NRB, five patients via nasal cannula at Table 1 Chronic obstructive pulmonary disease (COPD) severity in patients audited (classified based on COPDX criteria of severity) Severe Moderate Mild Unknown 102 patients 28 patients 10 patients 10 patients 68% 18% 7% 7% © 2015 Royal Australasian College of Physicians 511 Susanto & Thomas Figure 1 Types of oxygen therapy given before hospital admission. ( ), Hudson mask (HM); ( ), non-re-breather mask (NRB); ( ), 3–4 L nasal cannula (NC); ( ), ≤ 2 L NC; ( ), nebulised bronchodilator with air; ( ), other. >2 L/min and only one patient received O2 supplementation via nasal cannula at ≤2 L/min (Fig. 2). Of the 80 patients recognised as having a pre-existing diagnosis of COPD, 51 of them received high flow O2 therapy. Overall, only 12 patients received O2 therapy in line with the BTS and COPDX recommendation with FiO2 < 0.28. Types of oxygen therapy given in the emergency department Oxygen supplementation was administered in the ED in 112 patients (75%), and high flow O2 was administered in 68 patients (45%). The most common type of O2 delivery device in the ED was also a HM (34 patients, Figure 2 Types of oxygen therapy based on initial saturations. ( ), Hudson mask (HM); ( ), non-re-breather mask (NRB); ( ), 3–4 L nasal cannula (NC); ( ), ≤ 2 L NC; ( ), nebulised bronchodilators with air; ( ), unknown; ( ), no O2. © 2015 Royal Australasian College of Physicians 512 Audit of oxygen therapy in COPD patients Figure 3 Types of oxygen therapy given in ED. ( ), Hudson mask (HM); ( ), non-re-breather mask (NRB); ( ), 3–4 L nasal cannula (NC); ( ), bi-level non-invasive ventilation (NIV); ( ), ≤2 L NC; ( ), Venturi mask (VM); ( ), other. Fig. 3). Long-standing hypercapnia was previously known to be present in 39 patients, and O2 supplementation with a FiO2 > 0.28 was administered in 24 of these patients. PCO2 level on a VBG. An initial ABG was performed in 52 patients (35%) in the ED. Morbidity Blood gas measurements Blood gas analysis was performed in 93% of patients arriving in the ED with an exacerbation of COPD. Venous blood gas (VBG) was the most common type of blood gas measurement, being performed in 88 patients (59%), although recognised not to reflect accurately an arterial blood gas (ABG).13 Of the 88 patients who had VBG measurement, 41 patients had a venous CO2 level above the range for a normal arterial value. ABG was performed subsequently in 13 out of the 41 patients who were deemed to have an elevated partial pressure of carbon dioxide (PCO2) level on a VBG. These ABG measurements did confirm the presence of hypercapnia in all of the patients shown to have an elevated Hypercapnia was seen in 71 patients, and in these patients a FiO2 > 0.28 was given in 54 patients outside the hospital and continued in 35 patients in ED (Table 2). NIV was required in 53 patients, of whom 29 were given a FiO2 > 0.28, 19 patients were given a FiO2 < 0.28, and five patients were given an unknown FiO2 in ED. Intubation was required in only one patient, and a FiO2 > 0.28 was administered in this patient in the ambulance as well as in ED. The majority of patients were managed in the ward, with only seven patients requiring admission to the ICU or high dependency unit (HDU). The median length of stay (LOS) for those receiving low flow O2 was 6.5 days (range 2–27 days), and those receiving high flow O2 was 5 days (range 1–32 days). Table 2 Morbidity based on FiO2 given in the ambulance and in emergency department (ED) In ambulance In ED FiO2 < 0.28 FiO2 > 0.28 Unknown FiO2 < 0.28 FiO2 > 0.28 Unknown 8 (36%) 6 (27%) 1 (5%) 54 (48%) 38 (34%) 5 (5%) 9 (56%) 9 (56%) 1 (6%) 29 (43%) 19 (28%) 2 (3%) 35 (52%) 29 (43%) 4 (6%) 7 (47%) 5 (33%) 1 (7%) Acute hypercapnia (71 patients) NIV (53 patients) ICU/HDU (7 patients) FiO2, fraction of inspired oxygen; ICU, intensive care unit; NIV, non-invasive. © 2015 Royal Australasian College of Physicians 513 Susanto & Thomas Mortality There was a total of 10 deaths, of which nine patients had known severe COPD. In those who died, a FiO2 > 0.28 was given in six patients in ambulances and in eight patients in the ED. Discussion This audit confirms that oxygen administration is a common medical intervention for emergency treatment of COPD exacerbations, and that high flow oxygen is often administered. Based on current guidelines, the majority of the patients had not required the initial oxygen supplementation given that their mean oxygen saturation was ≥88% or could have been managed on a lower FiO2. This audit shows that a diagnosis of COPD was not necessarily appreciated as being a relative contraindication for high-flow supplemental oxygen. Interestingly, a previous audit performed in the United Kingdom had also shown a similar problem indicating that a lack of recognition of COPD is widespread.8 Initial assessments outside hospital often recorded asthma, cardiac failure or simply ‘shortness of breath’ as an alternative pre-existing diagnosis. This lack of recognition of a pre-existing diagnosis of COPD could account for the high number of uncontrolled oxygen administration episodes; however, more than half of those patients recognised as having pre-existing diagnosis of COPD still had received a FiO2 > 0.28. It is understandable that, when presented with an acutely ill patient who cannot breathe or communicate, oxygen supplementation takes priority, and this is appropriate. A long-term history of carbon dioxide retention would not be obtained in such circumstances. This audit also shows that while high-flow oxygen therapy is often initiated in the ambulances, in more than half of cases this was continued in the ED and probably a downtitration of this treatment was required. Administration of high-flow oxygen in general leads to an increase in minute ventilation, which leads to a lower end-tidal carbon dioxide concentration.14 In patients with COPD, however, hyperoxia leads to a decreased minute ventilation and increase in transcutaneous carbon dioxide.15 These changes have been postulated to be a result of either depression of ventilation or due to worsening ventilation perfusion inequality relating to recruitment of poorly ventilated lung units by reversal of local hypoxic pulmonary vasoconstriction with subsequent release of sequestered carbon dioxide.16 The clinical effects of supplemental oxygen-induced hypercapnia have been known for a long time, and these include Table 3 Variables associated with hypercapnia Home O2 Severe COPD Age >60 years FiO2 > 0.28 in ambulance FiO2 > 0.28 in ED Unadjusted OR Adjusted OR 95% CI P-value 4.76 — — — — 4.64 6.09 2.05 2.04–11.11 1.63–13.22 1.18–31.36 0.70–6.01 <0.01 <0.01 0.03 0.19 — 1.37 0.59–3.15 0.46 CI, confidence interval; FiO2, fraction of inspired oxygen; OR, odds ratio. depression of neurological and cardiorespiratory function.17,18 In a study of blood gas data of patients with COPD, a negative correlation was shown between pH and partial pressure of arterial oxygen (PaO2) after O2 therapy with increased oxygenation associated with a lower pH, especially in those with hypercapnia.19 Several other studies have also reported a greater incidence of adverse outcomes associated with higher flow oxygen in COPD patients.8,10,20 While a higher proportion of those who were given high-flow oxygen therapy developed hypercapnia and required NIV in this study, logistic regression analysis showed that the higher FiO2 administered was not necessarily a significant variable associated with the development of these morbidities (Tables 3, 4). This result could however be related to missing data with an unknown FiO2 and a lack of statistical power. This study showed that the severity of COPD (OR 4.64, 95% CI 1.63–13.22) and older age group (OR 6.09, 95% CI 1.18– 31.36) were significant variables associated with the development of hypercapnia. In an unadjusted OR analysis, pre-existing home oxygen usage was also significantly associated with development of hypercapnia, likely to be a reflection of the underlying severity of the COPD. There was an overall mortality rate of 6.7%, which is similar to the 6–10% rates quoted in other studies.10,19–22 The length of stay in our study is longer than the quoted average in the National Health Performance Authority (NHPA) of 5 days in COPD admission Table 4 Variables associated with usage of NIV Severe COPD Age >60 years FiO2 > 0.28 in ambulance FiO2 > 0.28 in ED Adjusted OR 95% CI P-value 1.93 0.32 1.05 5.10 0.56–6.64 0.07–1.41 0.32–3.45 1.79–14.50 0.30 0.13 0.94 <0.01 CI, confidence interval; COPD, chronic obstructive pulmonary disease; ED, emergency department; NIV, non-invasive; OR, odds ratio. © 2015 Royal Australasian College of Physicians 514 Audit of oxygen therapy in COPD patients without complications.23 However, the NHPA also acknowledges that there is significant variation in the LOS between 2.1 to 2.5 times longer depending on the hospitals and underlying complications and comorbidities. In our study, there was a wide range in the LOS in the low and high-flow oxygen group and obviously oxygen administration is not the sole determinant factor of LOS. Duration of admission in these patients was affected not only by their underlying COPD and treatment, but also reflects contributions of other factors such as other comorbidities, need for rehabilitation, mobility, placement or social issues, etc. Blood gas measurements were performed, but there was a high proportion of VBG measurements rather than the recommended arterial analysis. Although this study shows that the VBG prediction of PCO2 level matches that of the ABG in the 13 patients who had ABG repeated following VBG sampling, a recent meta-analysis by Byrne et al. showed that while VBG analysis compares well to ABG for pH estimations, VBG results show an unacceptably large variability in the PCO2 and partial pressure of oxygen (PO2). At present the accepted view is that VBGs are unable to estimate the PaO2 and PaCO2 and furthermore, VBGs are not commonly used outside Australasia.13 A similar study performed by Joosten et al. in a Melbourne university teaching hospital found comparable results to ours, with similar demographic characteristics and findings that high flow O2 administration is a common practice that is initiated in the ambulance and then carried on in the ED.24 Also similar to our study, Joosten pointed out the significant proportion of patients who did not have ABG performed as part of their COPD management, further highlighting this widespread practice.24 While the study by Joosten had a smaller number of audit samples, they managed to show significant relationship between higher PaO2 measured (≥74.5 mmHg) and morbidity variables such as increased LOS, NIV usage and HDU admission.24 These findings’ differences with ours likely reflect the different measurement of relationships with the variables rather than a contradiction of findings. We did not use PaO2 as a measurement variable given the high proportion of VBG performed which limited our ability to document PO2 confidently. Overall, this study has confirmed that un-titrated administration of oxygen in COPD patients is a common practice. An audit that was recently performed in Waikato hospital in New Zealand further highlights that the practice of un-titrated oxygen administration is common and is not only limited to the respiratory specialty.25 We acknowledge that given that this is an audit study with multiple variables, it is not possible to conclude that there is a causal relationship between a higher FiO2 administration and adverse outcomes such as hypercapnia or need for NIV. Indeed, other variables such as COPD severity or age also play a significant part in the development of morbidity and mortality in this cohort and could have been detailed along with type of exacerbation and medication. We acknowledge the limitations of this study being that of a retrospective study with a relatively small sample size and a proportion of missing data, all of which limit the analysis of this study. To date, there has only been one randomised controlled trial that studied the relationship between high flow oxygen therapy and mortality in patients with COPD which indicated a reduced risk of death in patients with titrated oxygen therapy.20 Larger, prospective studies would be required to confirm the possible harm of un-titrated oxygen approach in COPD patients. The implementation of current oxygen guidelines for use in the pre-hospital setting and education of those who are involved in treating COPD patients in emergency care and other situations may reduce the risk of complications in COPD patients.6,7 Oxygen is not commonly titrated in the pre-hospital setting and administered using high-flow delivery devices on the perception that failure to correct oxygenation is more dangerous than excessive administration.26 Perhaps consideration of developing oxygen administration guidelines depending on the initial SpO2 would be useful as this could potentially prevent administration of high– flow oxygen as first line treatment. Beasley et al. recommended no oxygen supplementation for those with a SpO2 > 92%, 2–3 L O2 via nasal cannula in those with SpO2 85–92% and usage of simple masks at higher flows for those with SpO2 < 85%, titrated to aim for a SpO2 > 92%.27 Other potential useful interventions which can be considered include education of patients regarding their diagnosis of COPD, the importance of alerting ambulance and medical personnel to the diagnosis and the provision of a medical alert bracelet or oxygen alert card, especially in those with known hypercapnia. The utilisation of a dedicated oxygen prescription chart, which has been used in some hospitals, may also be of some benefit.25 Conclusion Our study highlights that high flow oxygen is commonly used for the initial treatment of COPD exacerbations but that the diagnosis of COPD is often not recognised. The administration of oxygen supplementation with a FiO2 >0.28 is often initiated during ambulance transfers and subsequently continued in the ED. A larger prospective study would be required to confirm any possible harm of © 2015 Royal Australasian College of Physicians 515 Susanto & Thomas this approach, but education of those involved in the care of COPD patients may reduce the risk of complications of hypercapnia. Hospital for their invaluable help in obtaining the disease-related group coding and medical records. We also thank Professor Jenny Peat for her invaluable statistical advice. Acknowledgements We thank Eilish Portelli, Annie Blenkinsopp and the Medical Records Department at Prince of Wales References 1 Campbell EJM. A method of controlled oxygen administration which reduces the risk of carbon dioxide retention. Lancet 1960; 2: 12–14. 2 Donald KW. Neurological effects of oxygen. Lancet 1949; 2: 1056–7. 3 Westlake EK, Simpson T, Kaye M. Carbon dioxide narcosis in emphysema. Q J Med 1955; 94: 155–73. 4 Smith J, Stone R, Muschenheim C. Acute respiratory failure in chronic lung disease: observations on controlled oxygen therapy. Am Rev Respir Dis 1968; 97: 791–803. 5 Aubier M, Murciano D, Milic-Emili J, Touaty E, Daghfous J, Pariente R et al. Effects of administration of O2 on ventilation and blood gases in patients with chronic obstructive pulmonary disease during acute respiratory failure. Am Rev Respir Dis 1980; 122: 747–54. 6 O’Driscoll BR, Howard LS, Davison AG, British Thoracic Society. British Thoracic Society guideline for emergency oxygen use in adult patients. Thorax 2008; 63(Suppl 6): vi1–68. 7 McKenzie DK, Frith PA, Burdon JGW, Town GI. The COPDX Plan: Australia and New Zealand Guidelines for the management of Chronic Obstructive Pulmonary Disease 2003. Med J Aust 2003; 178(Suppl): S1–40. 8 Durrington HJ, Flubacher M, Ramsay CF, Howard LSGE, Harrison BDW. Initial oxygen management in patients with an exacerbation of chronic obstructive pulmonary disease. Q J Med 2005; 98: 499–504. 9 Denniston AK, O’Brien C, David S. The use of oxygen in acute exacerbations of chronic obstructive pulmonary disease: a prospective audit of pre-hospital and hospital emergency management. Clin Med 2002; 2: 449–51. 10 Cameron L, Pilcher J, Weatherall M, Beasley R, Perrin K. The risk of serious adverse outcomes associated with hypoxaemia and hyperoxaemia in acute exacerbations of COPD. Postgrad Med J 2012; 88: 684–9. 11 Wijesinghe M, Perrin K, Healy B, Hart K, Clay J, Weatherall M et al. Pre-hospital oxygen therapy in acute exacerbations of chronic obstructive pulmonary disease. Intern Med J 2011; 41: 618–22. 12 Bazuaye E, Stone T, Corris P, Gibson G. Variability of inspired oxygen concentration with nasal cannulas. Thorax 1992; 47: 609–11. 13 Byrne A, Bennett M, Chatterji R, Symons R, Pace NL, Thomas PS. Peripheral venous and arterial blood gas analysis in adults: are they comparable? A systematic review and meta-analysis. Respirology 2014; 19: 168–75. 14 Becker HF, Polo O, McNamara SG, Berthon Jones M, Sullivan CE. Effect of different levels of hyperoxia on breathing in healthy subjects. J Appl Physiol 1996; 81: 1683–90. 15 Sassoon CSH, Hassell KT, Mahutte CK. Hypoxic induced hypercapnia in stable chronic obstructive pulmonary disease. Am Rev Respir Dis 1987; 135: 907–11. 16 Wettstein RB, Shelledy DC, Peters JI. Delivery oxygen concentrations using low-flow and high-flow nasal cannulas. Respir Care 2005; 50: 604–9. 17 Seevers MH. The narcotic properties of carbon dioxide. N Y State J Med 1944; 44: 597–602. 18 Sicker HO, Hickarn JB. Carbon dioxide intoxication. Medicine (Baltimore) 1956; 35: 389–423. 19 Plant PK, Owen JL, Elliott MV. One year prevalence study of respiratory acidosis in acute exacerbations of COPD: implications for provision of non-invasive ventilation and oxygen administration. Thorax 2000; 55: 550–4. 20 Austin M, Wills E, Blizzard L, Walters EH, Wood-Baker R. Effect of high flow oxygen on mortality on chronic obstructive pulmonary disease patients in prehospital setting: randomised controlled trial. BMJ 2010; 341: c546. 21 Roberts CM, Stone RA, Buckingham RJ, Pursey NA, Lowe D. Acidosis, non-invasive ventilation and mortality in hospitalized COPD exacerbations. Thorax 2011; 66: 43–8. 22 Connors AF Jr, Dawson NV, Thomas C, Harrell FE Jr, Desbisens N, Fulkerson WJ et al. Outcomes following acute exacerbation of severe chronic obstructive lung disease. The SUPPORT investigators (Study to Understand Prognoses and Preferences for Outcomes and Risks of Treatments). Am J Respir Crit Care Med 1996; 154: 959–67. 23 National Health Performance Authority. Hospital Performance: Length of Stay in Public Hospital in 2011–12. Sydney, NSW: NHPA; 2013; 16–17. Length of stay for selected medical conditions, Chronic Obstructive Pulmonary Disease. 24 Joosten SA, Koh MS, Bu X, Smallwood D, Irving LB. The effects of oxygen therapy in patients presenting to an emergency department with exacerbation of chronic obstructive pulmonary disease. Med J Aust 2007; 185: 235–8. 25 Holbourn A, Wong J. Oxygen prescribing practice at Waikoto Hospital does not meet guideline recommendations. Intern Med J 2014; 44: 1231–4. 26 Branson RD, Johannigman JA. Pre-hospital oxygen therapy. Respir Care 2013; 58: 86–97. 27 Beasley R, Aldington S, Robinson G. Is it time to change the approach to oxygen therapy in the breathless patient? Thorax 2007; 62: 840–1. © 2015 Royal Australasian College of Physicians 516 Obvious emphysema on computed tomography during an acute exacerbation of chronic obstructive pulmonary disease predicts a poor prognosis T. Cheng,1 H. Y. Wan,1 Q. J. Cheng,1 Y. Guo,2 Y. R. Qian,2 L. Fan,2 Y. Feng,2 Y. Y. Song,3 M. Zhou,2 Q. Y. Li,2 G. C. Shi2 and S. G. Huang2 1 Department of Respiratory Medicine, Ruijin Hospital, North, 2Department of Respiratory Medicine, Ruijin Hospital and 3Department of Biostatistics, Shanghai Jiaotong University School of Medicine, Shanghai, China Key words chronic obstructive, pulmonary disease, acute exacerbation of chronic obstructive pulmonary disease (AECOPD), X-ray computed, tomography, emphysema, prognosis. Correspondence QiJian Cheng, Department of Respiratory Medicine, Ruijin Hospital North, Shanghai Jiaotong University School of Medicine, No. 999, Xiwang Road, Malu Town, Jiading, Shanghai, 201800, China. Email: [email protected]; [email protected] HuanYing Wan, Department of Respiratory Medicine, Ruijin Hospital North, Shanghai Jiaotong University School of Medicine, No. 999, Xiwang Road, Malu Town, Jiading, Shanghai, 201800, China. Email: [email protected] Received 20 August 2014; accepted 12 January 2015. doi:10.1111/imj.12723 Abstract Background: Emphysematous change on computed tomography (CT) during the stable phase of chronic obstructive pulmonary disease (COPD) is reported to correlate with COPD prognosis. Acute exacerbation of COPD (AECOPD) is associated with a high risk of mortality and a poor prognosis. Aims: This study aims to study the relationship between prognosis and emphysematous changes on CT during an AECOPD. Methods: Histories were recorded, and CT acquired for 106 patients who visited the emergency department for an AECOPD. Emphysematous change was quantified by measuring the percentage of low-attenuation areas (LAA%) in the entire lung on CT images with a threshold of –950 Hounsfield units. Other factors that could influence AECOPD prognosis were also recorded on admission and analysed. At follow ups conducted in 1 year, patient survival, the modified Medical Research Council (mMRC) Dyspnoea Scale, and performance status (PS) were evaluated, and a COPD Assessment Test (CAT) was completed. Results: The 1-year follow up was completed by 103 of 106 patients. The median LAA% was significantly higher in non-survivors (11%, n = 16) than in survivors (5.69%, n = 87) (P = 0.006) at the 1-year follow up. LAA% was significantly correlated with mMRC grade (r = 0.285, P = 0.008), PS (r = 0.397, P < 0.001) and CAT score (r = 0.27, P = 0.017) at the 3-month follow up, and with mMRC grade (r = 0.405, P < 0.001) and PS (r = 0.377, P < 0.001) at the 1-year follow up. LAA% > 7.5% was a significant predictor of 1-year mortality, higher mMRC and PS at the 3-month and 1-year follow ups, after adjustment for other prognostic predictors. Conclusion: Obvious emphysematous changes on CT (LAA% > 7.5%) during an AECOPD predicts a poor prognosis independent of other known indicators. Introduction Chronic obstructive pulmonary disease (COPD) is characterised by persistent airflow limitation and is a leading cause of morbidity and mortality worldwide.1 An acute exacerbation of COPD (AECOPD) is an acute event characterised by worsening of the patient’s respiratory Funding: This study was funded by: (i) The Chronic Disease Prevention and Treatment Programme of the Shanghai ShenKang Hospital Development Centre, China (Shanghai ShenKang Yi Yuan Fa Zhan Zhong Xin Man Xing Bing Zong He Fang Zhi Xiang Mu) (SHDC12012305); and (ii) The 11th National 5-year Development Plan (2008BAI52B00). Conflict of interest: None. symptoms beyond normal day-to-day variations, and leads to changes in medication.1 It contributes to overall disease severity in individual patients.1 The mean frequency of exacerbations is 0.9 times per year, according to the ECLIPSE (Evaluation of COPD Longitudinally to Identify Predictive Surrogate End-points) cohort.2 The prognosis of an AECOPD is poor. In the United States, the in-hospital mortality was 4.3% in 2006.3 In Chang’s study, the 30-day mortality was 8.5% (21/248), and the 1-year mortality was 18.5% (42/227) among inpatients in New Zealand.4 Screening high-risk patients helps in selecting more aggressive treatments for certain patients while avoiding unnecessary treatment in others. However, knowledge about the determinants of prognosis is limited. © 2015 Royal Australasian College of Physicians 517 Cheng et al. In stable COPD, the severity of emphysema as measured by low-attenuation areas (LAA%) has been established to be a stronger predictor of mortality than lung function, age or body mass index (BMI).5 The LAA% is positively correlated with dyspnoea severity (the modified Medical Research Council (mMRC) Dyspnoea Scale) and negatively correlated with forced expiratory volume in 1 s (FEV1) % predicted, the 6-min walk test distance (6MWT) and BMI.6 However, to the best of our knowledge, the prognostic value of LAA% in an AECOPD has not yet been studied. Many studies have shown that after an exacerbation, most patients gradually return to their baseline level, and almost no patient will attain better lung function than in the stable phase of their disease.7,8 During the exacerbation, the aggravation of airflow limitations is mainly caused by greater mucus production, airway wall oedema and bronchoconstriction.9 These changes are reversed during recovery. In contrast, emphysema is defined as the abnormal, permanent enlargement of air spaces distal to the terminal bronchioles, and accompanied by the destruction of their walls.10 Therefore, we hypothesised that the severity of emphysema may reflect the irreversibility and prognosis of an AECOPD. The present study was designed to assess prospectively the ability of LAA% measurements during COPD exacerbations to predict the mortality and severity of COPD after the exacerbation. Methods Patients Consecutive patients with a primary AECOPD diagnosis who visited the emergency department from December 2011 to May 2012 were recruited. An AECOPD was diagnosed by the admitting physician and defined as two out of three of: an increase in dyspnoea, sputum volume or sputum purulence from COPD beyond normal day-today variations that required emergency treatment.11 COPD was diagnosed on the basis of history and spirometry (Fig. 1) and confirmed by spirometry when the patients were stable whenever possible. Exclusion criteria were a history of other respiratory illnesses, such as lung cancer, pneumothorax, hydrothorax, severe bronchiectasis, thorax malformation, destroyed lung, illness too severe to undergo routine examinations (for example, haemodynamic instability) and those who visited the emergency department for reasons other than an AECOPD. Only the first visit was included in the analysis, even if the patient visited the emergency department more than once during the study period. Patients were treated according to Global Initiative for Chronic Obstructive Lung Disease (GOLD) guidelines.1 The Ethics Committee of Ruijin Hospital approved the study protocol (2009-23), and informed consent was obtained from all participants. Figure 1 Flow chart of cohort enrolment, evaluation and follow up. AECOPD, acute exacerbation of COPD; CAT, COPD Assessment Test; COPD, chronic obstructive pulmonary disease; mMRC, modified Medical Research Council Dyspnoea Scale. © 2015 Royal Australasian College of Physicians 518 Emphysema during AECOPD and prognosis Clinical data collection Table 1 The overall characteristics of the AECOPD patients Medical history and physiological variables were recorded during the first visit (Fig. S1). CRB-65 score was calculated and one point given for each of the following features present: confusion; respiratory rate ≥ 30/min; diastolic blood pressure ≤ 60 mmHg or systolic blood pressure < 90 mmHg; and age ≥ 65 years.12 Follow ups were performed at 1 month, 3 months and 1 year after the first visit. If the patient had died, survival time and cause of death were registered. At the 3-month and 1-year follow ups, if the patient was alive, mMRC grade,1 performance status (PS),13 COPD Assessment Test (CAT) score14 and severity of cough and sputum were evaluated (Fig. S2). Parameter n/total Mean ± SD (n) Median (interquartile range) (n) Male Age (years) BMI (kg/m2) 87/106 75.8 ± 9.8 21.0 ± 3.6 Smoking status Current smoker Ex-smoker Pack-years 23/105 59/105 37.9 ± 24.5 Computed tomography emphysema evaluation Chest computed tomography (CT) without contrast media was performed during the first visit. Imaging was performed during breath holding at full inflation with the patient in supine positioning using the same scanner (Light Speed 16; GE Medical Systems, Milwaukee, WI, USA) and protocol (tube voltage, 120 kV; tube current, 220 mA; tube rotation time, 0.8 s; and collimation, 1.25 mm). Images were reconstructed with the ‘standard algorithm’ at a 1.25-mm section thickness, 1.25-mm interval and a 512 × 512 matrix, as in previous studies.15 Sixteen patients underwent follow-up CT with the same parameters at the 3-month follow-up visit. The LAA% was calculated automatically using commercial software (Myrian, Intrasense; Montpellier, France) using a threshold of -950 Hounsfield units to determine emphysematous extent, as in previous studies.16 Statistical analysis All statistical analyses were conducted with SPSS 17.0 (SPSS, Chicago, IL, USA). The LAA% of patients who died within 1 month, between 1 month and 1 year, and those who were alive at the 1-year follow up were rank transformed and compared using a one-way analysis of variance and the least significant difference method. Spearman’s correlation was used to evaluate the relationship between LAA% and mMRC grade, performance status and CAT score at the follow ups. A Cox regression was used to examine risk factors for mortality. An ordinal logistic regression was performed to examine factors influencing mMRC grade and performance status at the follow ups. Results Population characteristics One hundred and six patients were enrolled (Table 1). Two patients were lost to follow up within 1 month, and Comorbidities Asthma Diabetes mellitus Hypertension Coronary artery disease Left heart failure 13/106 11/104 41/105 32/103 7/99 Clinical presentation Increase in cough Increase in sputum volume Increase in sputum purulence Increase in dyspnoea Fever 92/104 90/103 51/103 94/105 44/98 CRB-65 score LAA% 1 (1–1) (83)† 6.6 (2.4–12.1) (106)† 3-month follow up Survival mMRC PS CAT 93/104 2 (1–3) (85)† 1 (1–2) (94)† 11.9 ± 7.6 (78) 1-year follow up Survival mMRC PS CAT 87/103 2 (1–3) (83)† 1 (1–2) (97)† 13.5 ± 7.7 (73) †Parameter is not normally distributed and is therefore presented as the median and interquartile range. AECOPD, acute exacerbation of chronic obstructive pulmonary disease; BMI, body mass index; CAT, COPD Assessment Test; CRB-65 score, confusion, respiratory rate ≥ 30/min, systolic blood pressure < 90 mmHg or diastolic blood pressure ≤ 60 mmHg and age ≥ 65 years; LAA%, the percentage of low-attenuation areas (emphysema) on computed tomography imaging during an AECOPD using a threshold of -950 HU; mMRC, modified Medical Research Council Dyspnoea Scale; PS, performance status. one patient was lost between the 3-month and 1-year follow ups (follow-up rate: 98.11% at 1 month and 3 months; 97.17% at 1 year). Mortality was 6.73% (7/104), 10.58% (11/104) and 15.53% (16/103) at 1 month, 3 months and 1 year, respectively, and a bit lower than previously reported.3,4,17 The median LAA% was 6.6% (interquartile range: 2.4–12.1%, n = 106) (the LAA% did not follow a normal distribution in these patients). Sixteen patients underwent follow-up CT with © 2015 Royal Australasian College of Physicians 519 Cheng et al. Figure 2 (A) LAA% in patients who died within 1 month, between 1 month and 1 year, and 1-year survivors. **The LAA% during an acute exacerbation of chronic obstructive pulmonary disease (AECOPD) was significantly higher in patients who died within 1 year than in 1-year survivors (median (interquartile range) 11% (7.14–24.5) vs 5.69% (2.35–11.0), P = 0.006). *The LAA% during an AECOPD was significantly higher in patients who died between 1 month and 1 year than in 1-year survivors (23.2% (2.64–29.9) vs 5.69% (2.35–11.0), P = 0.03). (B) A Kaplan–Meier survival curve for patients with an AECOPD stratified according to LAA%. Survival was worse in patients with LAA% > 7.5% (P = 0.009, Cox regression). LAA%, the percentage of low-attenuation areas (emphysema) on computed tomography (CT) imaging during an AECOPD using a threshold of –950 Hounsfield units; y, year; mo, month; f/u, follow up. the same parameter. A good correlation (r = 0.840, P < 0.001) and no significant difference (13.38% ± 9.04% vs 11.43% ± 7.1%, P = 0.135) was observed between the LAA% measured during the exacerbation and during the stable phase (the LAA% of these patients followed a normal distribution) (Fig. S3). The median CRB-65 score was 1 (interquartile range: 1–1, n = 83). The CRB-65 score could not be calculated for 23 patients because of missing data. There was no significant difference between patients with or without a CRB-65 score with respect to LAA% or prognosis (Table S1). Twenty-nine patients underwent standard pulmonary function tests (mean FEV1 = 44.77 ± 18.54% predicted), and 13 underwent bronchodilation tests (mean post-bronchodilator FEV1 = 48.65 ± 13.8% predicted) at follow up (Tables S2, S3). Most AECOPD patients (86/105) have lung infiltration to a greater or lesser extent on CT; however, the clinical significance is limited. The presence of asthma or pneumonia was not significantly associated with any other factor, including LAA%, CRB-65 score, smoking history or prognosis (Table S4). The risk of death and LAA% The LAA% of patients who died within 1 year was significantly higher than that of survivors (median (interquartile range), 11% (7.14–24.5%) vs 5.69% (2.35–11.0%), P = 0.006, Mann–Whitney U-test). The LAA% of patients who died between 1 month and 1 year after exacerbation was significantly higher than those still alive at the 1-year follow up (median (interquartile range) 23.2% (2.64–29.9%) vs 5.69% (2.35–11.0%), P = 0.03, Fig. 2a). The risk of death in patients with an LAA% > 7.5% was significantly higher than in patients with an LAA% ≤ 7.5% (RR = 4.5, P = 0.009; Fig. 2b). Compared with the patients who died within 1 month, patients who died between 1 month and 1 year had a higher LAA% and lower incidence of fever, although the results were not statistically significant. However, there were no statistically significant differences during the first visit to the emergency department between the group who died within 1 month and the group who died later (Table S5). © 2015 Royal Australasian College of Physicians 520 Emphysema during AECOPD and prognosis Table 2 An univariate Cox regression analysis of risk factors for 1-year mortality in patients who came to the emergency department for an AECOPD Table 3 A multivariate Cox regression analysis of risk factors for 1-year mortality in patients who came to the emergency department for an AECOPD Characteristics Characteristics RR P value Age (increment by 1 year) BMI (kg/m2) Male 1.063 0.913 1.55 0.047 0.209 0.562 CRB-65 LAA% > 7.5% Fever (T > 37.3°C) Clinical presentation Increase in cough Increase in sputum volume Increase in sputum purulence Increase in dyspnoea Fever (T > 37.3°C) 0.385 0.389 1.361 1.861 0.279 0.098* 0.102 0.541 0.548 0.046* AECOPD, acute exacerbation of COPD; CI, confidence interval; CRB-65 score, confusion, respiratory rate ≥ 30/min, systolic blood pressure < 90 mmHg or diastolic blood pressure ≤ 60 mmHg, and age ≥ 65 years; LAA%, the percentage of low-attenuation areas (emphysema) on CT imaging during an AECOPD using a threshold of -950 Hounsfield units; RR, risk ratio of death in 1 year; T, body temperature. Clinical scores CRB-65 (increment by 1) 4.219 <0.001* In the past 1 year Exacerbations ≥ 2 Hospitalisation because of an AECOPD 1.569 2.147 0.368 0.139 Past medical history Asthma Hypertension Diabetes Coronary artery disease Left heart failure History of smoking 0.488 0.664 1.131 1.118 0.8 1.855 0.489 0.448 0.87 0.839 0.829 0.413 CT emphysema evaluation LAA > 7.5% 4.545 0.009* *Factors related to the prognosis with P < 0.1 in the univariate analysis, which were selected for multivariate Cox regression analysis. AECOPD, acute exacerbation of COPD; CI, confidence interval; COPD, chronic obstructive pulmonary disease; CRB-65 score, confusion, respiratory rate ≥ 30/min, systolic blood pressure < 90 mmHg or diastolic blood pressure ≤ 60 mmHg, and age ≥ 65 years; LAA%, the percentage of low-attenuation areas (emphysema) on computed tomography imaging during an AECOPD using a threshold of -950 Hounsfield units; RR, risk ratio of death in 1 year; T, body temperature. RR P 95% CI 2.836 3.891 0.259 0.001 0.039 0.085 1.55–5.19 1.07–14.1 0.06–1.21 The severity of symptoms after stabilisation and LAA% LAA% was significantly correlated with mMRC grade (r = 0.285, P = 0.008), performance status (r = 0.397, P < 0.001) and CAT score (r = 0.27, P = 0.017) at the 3-month follow up; and mMRC grade (r = 0.405, P < 0.001) and performance status (r = 0.377, P < 0.001) at the 1-year follow up (Table 4). However, the correlations were not significant between LAA% and the CAT score at the 1-year follow up, exacerbation frequency, severity of cough or severity of sputum (Table 4). In the stratified analysis, relationships between LAA% and dyspnoea symptoms after stabilisation were more significant in men, patients with smoking histories and patients without histories of left heart failure or asthma (Table S6). In univariate analyses, age, absence of increase in cough during the exacerbation, CRB-65 score, Table 4 The correlation between LAA% during an AECOPD and COPD symptoms at follow up 3-month follow up In the stratified analysis, the relationship between LAA% and mortality was more significant in patients with a history of smoking and without a history of left heart failure or asthma (Table S6). In the univariate Cox proportional hazard regression, higher CRB-65 scores, ageing, absence of fever during the exacerbation and LAA% > 7.5% were significantly related to mortality (Table 2). After performing a multivariate Cox regression using CRB-65, LAA%, presence of fever and presence of increase in cough, the following were mortality predictors: higher CRB-65 scores (RR = 2.836, P = 0.001) and LAA% > 7.5% (RR = 3.891, P = 0.039) (Table 3). mMRC grade Performance status CAT score Severity of cough Severity of sputum Frequency of exacerbations Frequency of hospitalisations for exacerbations 1-year follow up r P r P 0.285 0.397 0.27 0.018 0.051 0.128 0.008 <0.001 0.017 0.869 0.644 0.247 0.405 0.377 0.18 -0.05 -0.045 0.09 0.219 <0.001 <0.001 0.127 0.66 0.689 0.429 0.051 CAT, COPD Assessment Test; COPD, chronic obstructive pulmonary disease; LAA%, the percentage of low-attenuation areas (emphysema) on computed tomography imaging during an AECOPD using a threshold of -950 Hounsfield units; mMRC, modified Medical Research Council Dyspnoea Scale. © 2015 Royal Australasian College of Physicians 521 Cheng et al. Table 5 Univariate and multivariate ordinal logistic regression analyses of factors influencing the mMRC scale and performance status at the 3-month follow up in patients who came to emergency department for an AECOPD Characteristics M3 mMRC (increment by 1) Univariate analysis M3 PS (increment by 1) Multivariate ordinal logistic regression OR P OR Age (increment by 1 year) BMI Male 1.126 0.991 1.332 <0.001 0.867 0.565 Clinical presentation Increase in cough Increase in sputum volume Increase in sputum purulence Increase in dyspnoea Fever (T > 37.3°C) 0.121 0.334 0.416 3.102 0.732 0.003 0.089 0.032 0.081 0.447 0.134 2.638 0.263 2.329 0.063 0.315 0.014 0.351 Clinical scores CRB-65 (increment by 1) 5.129 <0.001 4.034 In the past 1 year Exacerbation ≥ 2 Hospitalisation due to an AECOPD 1.925 6.917 0.117 <0.001 7.434 Medical history Asthma Hypertension Diabetes Coronary artery disease Left heart failure History of smoking 0.64 1.13 1.059 1.571 4.693 0.742 0.463 0.759 0.928 0.29 0.035 0.534 CT emphysema evaluation LAA% > 7.5% 2.91 0.01 10.47 3.195 P 95% CI Univariate analysis OR P 1.147 0.949 1.034 <0.001 0.31 0.946 0.02–1.11 0.40–17.5 0.09–0.76 0.39–13.8 0.230 0.217 0.764 5.807 0.696 0.008 1.44–11.3 0.002 2.11–26.2 0.018 1.49–73.8 0.036 1.08–9.45 Multivariate ordinal logistic regression OR P 95% CI 0.023 0.008 0.489 0.017 0.37 1.412 0.599 0.723 0.545 0.21–9.46 0.11–3.14 1.27 0.792 0.21–7.54 5.646 <0.001 5.327 <0.001 2.29–12.4 1.968 3.337 0.094 0.013 1.13 2.713 0.805 0.076 0.43–2.98 0.90–8.18 0.382 1.716 1.323 1.271 2.079 1.095 0.132 0.890 0.964 0.569 0.308 0.846 3.662 0.001 3.619 0.014 1.30–10.0 Age was not utilised in the multivariate logistic regression because it was embodied in the CRB-65 score. Odds ratios (OR) refer to the change in OR of PS or mMRC grade at least 1 unit higher at follow up with an increase in the predictor variables by 1 unit. Bold values refer to the OR of the independent prognosis predictors. AECOPD, acute exacerbation of COPD; BMI, body mass index; CAT, COPD Assessment Test; CI, confidence interval; COPD, chronic obstructive pulmonary disease; CRB-65 score, confusion, respiratory rate ≥ 30/min, systolic blood pressure < 90 mmHg or diastolic blood pressure ≤ 60 mmHg, and age ≥ 65 years; LAA%, the percentage of low-attenuation areas (emphysema) on computed tomography imaging during an AECOPD using a threshold of -950 Hounsfield units; mMRC, modified Medical Research Council Dyspnoea Scale; M3, 3-month follow up; M12, 1-year follow up; PS, performance status; T, body temperature. AECOPD-related hospitalisations in the past year and LAA% > 7.5% predicted poor mMRC grades and performance statuses at follow up. A history of left heart failure also predicted a poor mMRC grade; an increase in dyspnoea, and no increase in sputum volume during exacerbations also predicted a poor performance status at follow up (Tables 5,6). In the multivariate analysis, LAA% > 7.5% remained a significant predictor of higher mMRC grades at the 3-month (odds ratio (OR) = 3.195, P = 0.036) and 1-year follow ups (OR = 3.414, P = 0.028), and poor performance statuses at the 3-month (OR = 3.619, P = 0.014) and 1-year follow ups (OR = 4.751, P = 0.017) (Tables 5,6). Discussion Previous studies significantly correlated emphysematous extent on CT with disease severity and prognosis.5,6 However, this is the first study that compared emphysema severity on CT during an exacerbation and prognosis to our knowledge. In the present study, there was a very good correlation and no significant difference between LAA% measured during the exacerbation and in the stable phase. This suggested that LAA% during an AECOPD has a similar prognostic predictive effect as LAA% during the stable phase. CT is more often performed for patients with exacerbations to evaluate lung consolidation, differentiate from pneumothorax or © 2015 Royal Australasian College of Physicians 522 Emphysema during AECOPD and prognosis Table 6 Univariate and multivariate ordinal logistic regression analyses of factors influencing the mMRC score and performance status at the 1-year follow up in patients who came to emergency department for an AECOPD Characteristics M12 mMRC (increment by 1) Univariate analysis OR P Age (increment by 1 year) BMI Male 1.070 0.949 1.679 0.001 0.368 0.301 Clinical presentation Increase in cough Increase in sputum volume Increase in sputum purulence Increase in dyspnoea Fever (T > 37.3°C) 0.130 0.197 0.632 4.411 0.747 0.007 0.019 0.255 0.020 0.477 Clinical scores CRB-65 (increment by 1) 6.521 In the past 1 year Exacerbations ≥ 2 Hospitalisation due to an AECOPD M12 PS (increment by 1) Multivariate ordinal logistic regression OR P 95% CI Univariate analysis OR P 1.089 0.937 1.182 <0.001 0.209 0.734 0.152 0.207 0.582 6.456 0.334 0.002 0.007 0.159 0.005 0.008 Multivariate ordinal logistic regression OR P 95% CI 0.222 1.143 0.152 0.891 0.03–1.74 0.17–7.73 8.430 0.345 0.047 0.059 1.03–69.0 0.11–1.04 0.164 1.82 0.081 0.529 0.02–1.25 0.28–11.75 7.516 0.028 1.24–45.42 <0.001 4.428 0.007 1.5–13.07 9.300 <0.001 5.380 0.001 1.90–15.2 1.644 2.945 0.230 0.038 1.232 0.741 0.36–4.24 1.362 3.714 0.425 0.005 2.117 0.232 0.62–7.24 Past medical history Asthma Hypertension Diabetes Coronary artery disease Left heart failure History of smoking 0.800 1.026 1.071 1.837 17.64 1.808 0.702 0.949 0.917 0.160 0.001 0.220 0.494 0.934 1.296 2.305 3.522 1.322 0.226 0.86 0.671 0.047 0.082 0.547 2.450 2.728 0.174 0.327 0.67–8.91 0.37–20.2 CT emphysema evaluation LAA% > 7.5% 3.987 0.001 3.770 0.001 4.751 0.017 1.32–17.1 19.53 3.414 0.007 2.24–170.4 0.028 1.14–10.24 The multivariate logistic regression was performed only on influencing factors related to the mMRC grade or performance status in the univariate analyses with P < 0.1. Age was not utilised in the multivariate logistic regression because it was embodied in the CRB-65 score. Odds ratios (OR) refer to the change in OR ratios of PS or mMRC grade at least 1 unit higher at follow up with an increase in the predictor variables by 1 unit. Bold values refer to the OR of the independent prognosis predictors. AECOPD, acute exacerbation of chronic obstructive pulmonary disease; BMI, body mass index; CAT, COPD Assessment Test; CI, confidence interval; CRB-65 score, confusion, respiratory rate ≥ 30/min, systolic blood pressure < 90 mmHg or diastolic blood pressure ≤ 60 mmHg, and age ≥ 65 years; LAA%, the percentage of low-attenuation areas (emphysema) on CT imaging during an AECOPD using a threshold of -950 HU; M3, 3-month follow up; M12, 1-year follow up; mMRC, the modified Medical Research Council Dyspnoea Scale; PS, performance status; T, body temperature. hydrothorax and screen for post-obstructive pneumonia caused by neoplasms. Emergency CT imaging is inexpensive and readily available at our hospital. The LAA% of patients who died between 1 month and 1 year was even higher than those who died within 1 month (although not statistically significant). LAA% may reflect the mid-term risk of death to a greater extent than the short-term risk. That is, patients without obvious emphysema (LAA% ≤ 7.5%) may have better reversibility. LAA% differs from other indices mainly related to the risk of death within 1 month. In the present study, mMRC grade, performance status and CAT score at follow up were registered as end-points in addition to mortality. The mMRC scale is a 5-point scale to evaluate COPD-related dyspnoea severity, recommended by GOLD guidelines,1 and correlates significantly with respiratory symptom severity, disability18 and mortality.19 Performance status is a 6-point scale formulated by the Eastern Cooperative Oncology Group to evaluate performance and disability, formerly used in patients with malignant tumours and validated to be a predictor of mortality in COPD.20,21 In the present study, LAA% was correlated with mMRC grade and performance status at both the 3-month and 1-year follow ups, suggesting that LAA% is correlated with COPD severity and mortality for more extended durations. The correlation was not significant between LAA% and chronic bronchitis symptoms, such as cough and sputum © 2015 Royal Australasian College of Physicians 523 Cheng et al. after stabilisation, or between LAA% and exacerbation frequency. These results agree with findings of previous studies showing that chronic bronchitis symptoms22 and exacerbation risks6 are more related to bronchial wall thickening than emphysematous changes. The CAT is an 8-item measure of health status impairment from COPD, correlates closely with health status measured by the St George’s Respiratory Questionnaire, and is reliable and responsive.1,14 The correlation between LAA% during exacerbations and CAT scores at the 3-month follow up was limited but significant, while the correlation between LAA% and CAT scores at the 1-year follow up was not significant. There are two possible reasons for this: first, the CAT includes each aspect of COPD symptoms, while LAA% correlates to dyspnoea rather than chronic bronchitis symptoms. Second, many patients completed the CAT questionnaire with the help of others because of low education and weakness, which may have caused errors; this problem was also described previously.23 The median LAA% (6.6%) and criterion for obvious emphysematous change (7.5%) in the present research were much lower than in other cohorts, such as in Haruna’s study (22.1% and 32.3% respectively).5 This may be because, first, patients with thickened bronchial walls rather than severe emphysema tend to suffer from frequent exacerbations.6,24 Second, the present study was based on emergency department patients, some of whom did not manifest severe dyspnoea in the stable phase2 and did not regularly seek treatment for COPD, and therefore were not registered in an outpatient department-based cohort. Third, the severity of emphysema differs among ethnic groups, even with similar lung function impairment.25 The COPD patients with hereditary alpha-1 antitrypsin deficiency, who often manifest severe emphysema, are extremely rare in China.26 Since we screened almost all AECOPD patients who visited our emergency department without selection, and the mortality was only a little lower than in other cohorts,3,4,17 we consider that this cohort covered a wide range of GOLD categories and different degrees of emphysema. In the present study, we diagnosed COPD based on clinical presentation and bedside spirometry in addition to previous diagnoses, because only a few patients with COPD had been diagnosed previously in China, especially those with mild COPD.27 Patients with a history of asthma or left heart failure in addition to COPD were not excluded, because we consider them to be representative of some COPD patients. Many who reported to be suffering from asthma (‘xiao chuan’ in Chinese) were actually suffering from COPD. In some patients with chronic asthma, COPD may coexist.1 The incidence of concomitant COPD and asthma was reported to be 2604/6059 in a Medicaid population.28 Left heart failure is another common COPD comorbidity. Left ventricular dysfunction was found in 32% of COPD patients with symptomatic deterioration.29 Even in patients with stable COPD and without a cardiologist-confirmed diagnosis of heart failure, roughly 30% had heart failure to some extent.30 Although the cardinal symptoms of COPD and left heart failure are similar, dyspnoea and exercise intolerance, left heart failure does not cause obstructive airflow limitation.31 Therefore, FEV1/FVC < 70% indicates the existence of COPD, regardless of the presence of left heart failure. Patients with radiographic consolidation were not excluded, because pneumonia is a common AECOPD complication. In previous studies, 15–36.3% of inpatients with an AECOPD had radiographic consolidation3,32,33 and were not excluded from a state audit.3,33 Furthermore, only a portion (12%/15%) would be diagnosed with pneumonia based on paired radiographs.32 In the present study, the CRB-65 score was one of the best predictors of mortality, severity of dyspnoea and disability after stabilisation. The CRB-65 is a 4-point score, originally used for risk stratification in communityacquired pneumonia. Recently, CRB-65 was reported to predict in-hospital and 30-day mortality, but not 1-year mortality.12,34 In our study, the CRB-65 score predicted 1-year mortality, mMRC grade and performance status at the 1-year follow up. This may be because those enrolled in the previous study were inpatients, while the CRB-65 score and CURB-65 score are portions of the admission criteria.35 The present study enrolled almost all AECOPD patients who visited the emergency department without selection, thereby including different levels of severity, making the predictive ability of the CRB-65 score more obvious. The present study showed that a history of left heart failure predicts a higher mMRC grade at the 3-month and 1-year follow ups independently. It is suggested that left heart failure may aggravate dyspnoea in COPD, which confuses severity assessments using the mMRC grade. Indeed, the widely used New York Heart Association functional classification for left heart failure is similar to the mMRC scale.36 These findings suggest the necessity of grading criteria to assess COPD-related dyspnoea and left heart failure separately. Limitations The present study had some limitations. First, some prognostic predictors, such as blood gas analyses and lung function tests were not analysed in this study, because only a few patients completed these tests in the emergency department. Thus, it remained undetermined © 2015 Royal Australasian College of Physicians 524 Emphysema during AECOPD and prognosis whether the LAA% is a prognostic factor independent of the blood gas analysis and lung function test. Second, the CRB-65 score could not be calculated because of missing data in some patients. However, there were no significant differences in LAA% and prognosis between the patients with or without CRB-65 score. Among the patients with CRB-65 score, the LAA% was proven to be a prognosis predictor independent of CRB-65. Third, only a few patients underwent the follow-up CT with the same parameter. Therefore, the CT manifestation of exacerbation could hardly be analysed in detail in this study. The relationship between CT imaging and the aetiology of exacerbation awaits further investigation. The impact of exacerbation on emphysema progression, as shown in a previous study,37 could not be analysed in the present study. Fourth, among the several CT indices, only LAA% References 1 Global Strategy for the Diagnosis, Management and Prevention of COPD, Global Initiative for Chronic Obstructive Lung Disease (GOLD). 2011 [cited 2011 Feb 21]. Available from: http://www. goldcopd.org/ 2 Agusti A, Calverley PM, Celli B, Coxson HO, Edwards LD, Lomas DA et al. Characterisation of COPD heterogeneity in the ECLIPSE cohort. Respir Res 2010; 11: 122. 3 Perera PN, Armstrong EP, Sherrill DL, Skrepnek GH. Acute exacerbations of COPD in the United States: inpatient burden and predictors of costs and mortality. COPD 2012; 9: 131–41. 4 Chang CL, Robinson SC, Mills GD, Sullivan GD, Karalus NC, McLachlan JD et al. Biochemical markers of cardiac dysfunction predict mortality in acute exacerbations of COPD. Thorax 2011; 66: 764–8. 5 Haruna A, Muro S, Nakano Y, Ohara T, Hoshino Y, Ogawa E et al. CT scan findings of emphysema predict mortality in COPD. Chest 2010; 138: 635–40. 6 Han MK, Bartholmai B, Liu LX, Murray S, Curtis JL, Sciurba FC et al. Clinical significance of radiologic characterizations in COPD. COPD 2009; 6: 459–67. 7 Niewoehner DE, Erbland ML, Deupree RH, Collins D, Gross NJ, Light RW et al. Effect of systemic glucocorticoids on exacerbations of chronic obstructive pulmonary disease. Department of Veterans Affairs Cooperative Study 8 9 10 11 12 13 14 15 was analysed in the present study. Thus, it remains unclear whether other CT indices were prognostic factors. Lastly, the sample size of the present study was small. Despite these limitations, the LAA% was still proven to be associated with the prognosis, even after adjustment for other co-variables. Conclusions The severity of emphysematous change on CT during an acute exacerbation of COPD was correlated with the risk of death in 1 year, and the severity of dyspnoea and disability at 3 months and 1 year after exacerbation. Obvious emphysema on CT during an AECOPD is an independent predictor of a poor prognosis. Group. N Engl J Med 1999; 340: 1941–7. Seemungal TA, Donaldson GC, Bhowmik A, Jeffries DJ, Wedzicha JA. Time course and recovery of exacerbations in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2000; 161: 1608–13. Hurst JR, Wedzicha JA. The biology of a chronic obstructive pulmonary disease exacerbation. Clin Chest Med 2007; 28: 525–36. The definition of emphysema. Report of a National Heart, Lung, and Blood Institute, Division of Lung Diseases workshop. Am Rev Respir Dis 1985; 132: 182–5. Burge S, Wedzicha JA. COPD exacerbations: definitions and classifications. Eur Respir J Suppl 2003; 41: 46s–53s. Edwards L, Perrin K, Wijesinghe M, Weatherall M, Beasley R, Travers J. The value of the CRB65 score to predict mortality in exacerbations of COPD requiring hospital admission. Respirology 2011; 16: 625–9. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET et al. Toxicity and response criteria of the Eastern Cooperative Oncology Group. Am J Clin Oncol 1982; 5: 649–55. Jones PW, Harding G, Berry P, Wiklund I, Chen WH, Kline LN. Development and first validation of the COPD Assessment Test. Eur Respir J 2009; 34: 648–54. Han MK, Kazerooni EA, Lynch DA, Liu LX, Murray S, Curtis JL et al. Chronic 16 17 18 19 20 21 obstructive pulmonary disease exacerbations in the COPDGene study: associated radiologic phenotypes. Radiology 2011; 261: 274–82. Martinez CH, Chen YH, Westgate PM, Liu LX, Murray S, Curtis JL et al. Relationship between quantitative CT metrics and health status and BODE in chronic obstructive pulmonary disease. Thorax 2012; 67: 399–406. Roberts CM, Stone RA, Lowe D, Pursey NA, Buckingham RJ. Co-morbidities and 90-day outcomes in hospitalized COPD exacerbations. COPD 2011; 8: 354–61. Bestall JC, Paul EA, Garrod R, Garnham R, Jones PW, Wedzicha JA. Usefulness of the Medical Research Council (MRC) dyspnoea scale as a measure of disability in patients with chronic obstructive pulmonary disease. Thorax 1999; 54: 581–6. Nishimura K, Izumi T, Tsukino M, Oga T. Dyspnea is a better predictor of 5-year survival than airway obstruction in patients with COPD. Chest 2002; 121: 1434–40. Chen CZ, Ou CY, Wang WL, Lee CH, Lin CC, Chang HY et al. Using post-bronchodilator FEV(1) is better than pre-bronchodilator FEV(1) in evaluation of COPD severity. COPD 2012; 9: 276–80. Roberts CM, Lowe D, Bucknall CE, Ryland I, Kelly Y, Pearson MG. Clinical audit indicators of outcome following admission to hospital with acute exacerbation of chronic obstructive © 2015 Royal Australasian College of Physicians 525 Cheng et al. 22 23 24 25 26 27 pulmonary disease. Thorax 2002; 57: 137–41. Mair G, Maclay J, Miller JJ, McAllister D, Connell M, Murchison JT et al. Airway dimensions in COPD: relationships with clinical variables. Respir Med 2010; 104: 1683–90. Ringbaek T, Martinez G, Lange P. A comparison of the assessment of quality of life with CAT, CCQ, and SGRQ in COPD patients participating in pulmonary rehabilitation. COPD 2012; 9: 12–15. Fujimoto K, Kitaguchi Y, Kubo K, Honda T. Clinical analysis of chronic obstructive pulmonary disease phenotypes classified using high-resolution computed tomography. Respirology 2006; 11: 731–40. Hansel NN, Washko GR, Foreman MG, Han MK, Hoffman EA, DeMeo DL et al. Racial differences in CT phenotypes in COPD. COPD 2013; 10: 20–7. Kwok JS, Lawton JW, Yew WW, Chau CH, Lee J, Wong PC. Protease inhibitor phenotypes and serum alpha-1-antitrypsin levels in patients with COPD: a study from Hong Kong. Respirology 2004; 9: 265–70. Fang X, Wang X, Bai C. COPD in China: the burden and importance of proper management. Chest 2011; 139: 920–9. 28 Shaya FT, Dongyi D, Akazawa MO, Blanchette CM, Wang J, Mapel DW et al. Burden of concomitant asthma and COPD in a Medicaid population. Chest 2008; 134: 14–19. 29 Render ML, Weinstein AS, Blaustein AS. Left ventricular dysfunction in deteriorating patients with chronic obstructive pulmonary disease. Chest 1995; 107: 162–8. 30 Rutten FH, Cramer MJ, Grobbee DE, Sachs AP, Kirkels JH, Lammers JW et al. Unrecognized heart failure in elderly patients with stable chronic obstructive pulmonary disease. Eur Heart J 2005; 26: 1887–94. 31 Wasserman K, Zhang YY, Gitt A, Belardinelli R, Koike A, Lubarsky L et al. Lung function and exercise gas exchange in chronic heart failure. Circulation 1997; 96: 2221–7. 32 Lieberman D, Lieberman D, Gelfer Y, Varshavsky R, Dvoskin B, Leinonen M et al. Pneumonic vs nonpneumonic acute exacerbations of COPD. Chest 2002; 122: 1264–70. 33 Myint PK, Lowe D, Stone RA, Buckingham RJ, Roberts CM. U.K. National COPD Resources and Outcomes Project 2008: patients with chronic 34 35 36 37 obstructive pulmonary disease exacerbations who present with radiological pneumonia have worse outcome compared to those with non-pneumonic chronic obstructive pulmonary disease exacerbations. Respiration 2011; 82: 320–7. Chang CL, Sullivan GD, Karalus NC, Mills GD, McLachlan JD, Hancox RJ. Predicting early mortality in acute exacerbation of chronic obstructive pulmonary disease using the CURB65 score. Respirology 2011; 16: 146–51. Lim WS, Baudouin SV, George RC, Hill AT, Jamieson C, Le Jeune I et al. BTS guidelines for the management of community acquired pneumonia in adults: update 2009. Thorax 2009; 64(Suppl 3): i1–55. New York Heart Association. Diseases of the Heart and Blood Vessels: Nomenclature and Criteria for Diagnosis. Boston, MA: Little, Brown and Co.; 1964. Tanabe N, Muro S, Hirai T, Oguma T, Terada K, Marumo S et al. Impact of exacerbations on emphysema progression in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2011; 183: 1653–9. Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Figure S1 The questionnaire used during an acute exacerbation of COPD. Figure S2 The questionnaire used at the 3-month and 1-year follow ups after an acute exacerbation of COPD. Figure S3 The correlation between the LAA% on computed tomography (CT) during exacerbations and stable phases (Pearson’s correlation). LAA%: the percentage of low-attenuation areas (emphysema) on CT imaging during an acute exacerbation of chronic obstructive pulmonary disease (AECOPD) using a threshold of –950 HU. Table S1 Comparisons between patients with and without a CRB-65 score. Table S2 Main pulmonary function test data at follow up and during an exacerbation. Table S3 Complete pulmonary function test data at the 3-month follow up. Table S4a Comparisons between patients with and without asthma. Table S4b Comparisons between patients with and without infiltration. Table S5 Comparisons between patients who died within 1 month, who died between 1 month–1 year and survivors at 1-year follow up. Table S6 The correlation between low-attenuation areas (LAA%) during an acute exacerbation of chronic obstructive pulmonary disease (AECOPD) and COPD symptoms at follow up stratified by other factors. © 2015 Royal Australasian College of Physicians 526 Efficacy of non-invasive mechanical ventilation in the general ward in patients with chronic obstructive pulmonary disease admitted for hypercapnic acute respiratory failure and pH < 7.35: a feasibility pilot study S. Fiorino,1 L. Bacchi-Reggiani,2 E. Detotto,1 M. Battilana,1 E. Borghi,1 C. Denitto,1 C. Dickmans,1 B. Facchini,1 R. Moretti,1 S. Parini,1 M. Testi,1 A. Zamboni,1 A. Cuppini,1 L. Pisani3 and S. Nava3 1 Unità Operativa di Medicina Interna, Ospedale di Budrio (Bologna), Department of Internal Medicine, Azienda Unità Sanitaria Locale di Bologna and Istituto di Cardiologia and 3Terapia Intensiva Pneumologia S. Orsola, Azienda Ospedaliera Policlinico S. Orsola-Malpighi, Department of Specialist, 2 Diagnostic, and Experimental Medicine, School of Medicine, University of Bologna, Bologna, Italy Key words chronic obstructive pulmonary disease, acute respiratory failure, non-invasive mechanical ventilation. Correspondence Sirio Fiorino, Unità Operativa di Medicina Interna, Ospedale di Budrio, Via Benni 44, 40065 Budrio (Bologna), Italy. Email: sirio.fi[email protected] Received 29 October 2014; accepted 12 January 2015. doi:10.1111/imj.12726 Abstract Aim: To date non-invasive (NIV) mechanical ventilation use is not recommended in chronic obstructive pulmonary disease (COPD) patients with acute respiratory failure (ARF) and pH < 7.30 outside a ‘protected environment’. We assessed NIV efficacy and feasibility in improving arterial blood gases (ABG) and in-hospital outcome in patients with ARF and severe respiratory acidosis (RA) admitted to an experienced rural medical ward. Methods: This paper is a prospective pilot cohort study conducted in the General Medicine Ward of Budrio’s District Hospital. Two hundred and seventy-two patients with ARF were admitted to our Department, 112, meeting predefined inclusion criteria (pH < 7.35, PaCO2 > 45 mmHg). Patients were divided according to the severity of acidosis into: group A (pH < 7.26), group B (7.26 ≤ pH < 7.30) and group C (7.30 ≤ pH < 7.35). ABG were assessed at admission, at 2–6 h, 24 h, 48 h and at discharge. Results: Group A included 55 patients (24 men, mean age: 80.8 ± 8.3 years), group B 31 (12 men, mean age: 80.3 ± 9.4 years) and group C 26 (15 men, mean age: 78.6 ± 9.9 years). ABG improved within the first hours in 92/112 (82%) patients, who were all successfully discharged. Eighteen per cent (20/112) of the patients died during the hospital stay, no significant difference emerged in mortality rate (MR) within the groups (23%, 16% and 8%, for groups A, B and C, respectively) and between patients with or without pneumonia: 8/29 (27%) versus 12/83 (14%). On multivariable analysis, only age and Glasgow Coma Scale had an impact on the clinical outcome. Conclusion: In a non-‘highly protected’ environment such as an experienced medical ward of a rural hospital, NIV is effective not only in patients with mild, but also with severe forms of RA. MR did not vary according to the level of initial pH. Introduction Funding: None. Conflict of interest: S. Nava: speaking fees from PhilipsRespironics International – Resmed International – Weinman International; travel grants: Weinman; research grants from Starmed – Fisher and Paykel; free loan of equipment from: Maquet – Air Liquide – Resmed – Philips-Respironics – Breas – Siare. Acute respiratory failure (ARF) with decompensated respiratory acidosis represents a frequent reason for hospital admission of patients with chronic obstructive pulmonary disease (COPD).1 Recent research has shown that COPD is very often associated with different comorbidities that considerably impact on the management and the prognosis of these patients.2,3 Despite the burden that COPD is increasing and that it will be the third cause of death in a few years, the number of patients admitted to the intensive care unit (ICU) has © 2015 Royal Australasian College of Physicians 527 Fiorino et al. decreased in the last decades. This may be partly due to better pharmacological and rehabilitative strategies but also to the early use of non-invasive mechanical ventilation (NIV) outside of a highly protected environment like an ICU or a respiratory ICU (RICU). The early use of such a therapeutic approach, when appropriate, may prevent clinical deterioration of these patients, reducing risk of endotracheal intubation (ETI) and mortality. However, the pH level has been reported to be a crucial factor in determining the NIV success rate.4,5 Although the confidence of healthcare providers with NIV has progressively improved and although NIV has been applied with success also outside the critical care environment,6,7 to date NIV is not recommended outside ICU in patients with severe hypercapnic ARF and a pH < 7.30.8 In particular, it was shown that NIV treatment failed in approximately 50–60% of COPD-exacerbated subjects with a baseline pH < 7.25. Indeed, concerns were also placed on treating these patients outside a protected environment when they are affected by comorbidities. We have prospectively performed a feasibility pilot study with the aim to assess efficacy of NIV on mortality rate in the ‘every day clinical practice’ at the General Medical Ward of a small rural Italian hospital without ICU, focusing our analysis on patients presenting acute or acute-on-chronic respiratory failure and severe respiratory acidosis (pH < 7.35) Secondary outcomes were the influence of acute and chronic comorbidities on patients’ outcomes. Therefore, the results may be useful to calculate sample sizes for future definitive studies. Methods We performed a prospective-cohort study in the General Medicine Ward of Budrio’s District Hospital with the ‘external’ support of the RICU of S. Orsola-Malpighi Hospital at Bologna. If the patient met the intubation criteria, it was agreed to transfer her/him promptly to that unit, which is approximately 15 km far away. Budrio District Hospital is a rural hospital of 80 beds with medicine and surgery units as well as emergency department but without ICU. We enrolled consecutive COPD patients with hypercapnic ARF or with exacerbations on chronic RF (AHRF) admitted to our medical ward over a 13-month period (from 1 January 2013 to 31 January 2014). All these patients were first admitted to our emergency room, and if they showed signs of AHRF, they were sent to the doctor on duty at the medical ward. Only the patients who met the inclusion criteria (see below) were therefore consecutively enrolled. Inclusion criteria were pH < 7.35 and PaCO2 > 45 mmHg, in association with a respiratory rate > 25 breaths/min and massive activation of accessory (or secondary) respiratory muscles. The patients were subsequently divided into three groups according to the severity of acidosis: • Group A included 55 patients with pH < 7.26; • Group B included 31 patients with pH between 7.26 and 7.299; • Group C included 26 patients with pH ≥ 7.30. Exclusion criteria included multiple organ failure, haemodynamic instability, acute ischaemic heart disease, cerebrovascular accident, facial deformity preventing adequate mask fitting, upper airway obstruction, any causes of metabolic acidosis; gastrointestinal bleeding or surgery, severe psychiatric conditions with psychomotor agitation, cardiac or respiratory arrest with need of urgent intubation and NIV refusal. Any type of metabolic acidosis was excluded on the basis of the ‘classical’ arterial blood gases (ABG) criteria that is the presence of pH < 7.35 and pCO2 < 45 mmHg with bicarbonate lower than the normal range. In addition, we enrolled in our study only patients with a body mass index < 30, to minimise the chances that patients with overlap syndrome could be included. Seven patients (four in group A, two in group B and one in group C) had previously been treated with NIV for an episode of acute COPD exacerbation, whereas no patient was enrolled in a home care NIV programme. COPD diagnosis was performed, according to a 1987 American Thoracic Society statement on the basis of pulmonary function tests (PFT) in 68% of our patients, whereas in the remaining subset, it was carried out based on the ‘usual criteria’ employed in most of the published NIV trials4,5,8,9 to define COPD in absence of PFT, which includes clinical history, physical examination and imaging data, such as chest radiograph or high-resolution computed tomography scan. In addition, health status of each patient was assessed by Charlson Index comorbidity score at hospital admission based on the clinical history and patient’s previous and actual records.10 The protocol was approved by our local Ethical Committee and written consent was obtained from all patients. Before starting NIV treatment, COPD patients received a standard medical treatment, including aerosolised bronchodilator drugs, intravenous steroid and, when necessary, furosemide and antibiotics. NIV settings Patients were treated with pressure support ventilation with a fixed back-up rate (12 breaths/min) (Resmed VSIII, ResMed, Sydney, NSW, Australia) supplied by means of a double-tube circuit through an oro-nasal non-vented mask (Performatrak total mask Respironics, Pittsburgh, PA, USA). © 2015 Royal Australasian College of Physicians 528 COPD: non-invasive ventilation Different sizes of interfaces were available at patients’ bedside during NIV start. Peak inspiratory pressure was initially set at 14 cmH2O and gradually increased to a maximum of 34 cmH2O (median value was 22 cmH2O, range 14–34 cmH2O) to obtain an expired tidal volume of 7–8 mL/kg, according to patients’ tolerance, whereas the positive end-expiratory pressure was initially set at 4 cmH2O and increased to a maximum of 8 cmH2O or reduced to resolve patients’ hypoxaemia or decrease their discomfort respectively (median value was 6 cmH2O, range 4–8 cmH2O). An arterial oxygen saturation ranging between 90% and 95% was obtained with oxygen supply by means of an adequate FiO2 setting, NIV was started directly in the emergency department by the respiratory physician on call. Patients were then transferred (average time 2.4 ± 2.1 h) to the medical ward, where four beds may be monitored and are utilised for very critically ill patients. NIV was always prescribed and started by the attending physician. The nurses were in charge to fix the interfaces and to monitor the patients. NIV was applied intermittently, for periods of at least 4 h, with a minimal duration of 8 h per day, or continuously in case of hypercapnic coma and was maintained until improvement of clinical signs and ABG parameters were obtained. During NIV treatment in absence of clinical worsening, both in day and night-time, each patient was examined every 30 min by the attending nurses and every hour by the attending physician, whereas arterial blood pressure, oxygen saturation, respiratory rate and electrocardiogram were continuously monitored. NIV was discontinued when considered clinically indicated (see Measurements section). Since we started the use of NIV in our unit several years ago, our medical and nursing staff received a specific training for NIV delivery with periodic retraining by a chest physician from our unit. The median nurse/patient ratio in our unit is equal to 1:12. Lacking an ICU, the decision to intubate the patient was taken by the attending anaesthetist (24 h on duty) according to our hospital guidelines (i.e. respiratory arrest, gasping for air, deterioration or no improvement of ABG after 2 h of NIV, sensorium deterioration, severe dyspnoea with sign of incipient muscle fatigue). The adoption of limits on life support and treatment (e.g. do not intubation order) was left to patient’ or his relatives’ decision, in accordance with the anaesthesiologist, because no specific Italian law regulates this topic. Intubated patients were eventually transferred to our ‘back-up’ RICU. Measurements The data recorded at hospital admission were age, sex and Glasgow coma Scale at admission. Number and types of acute and chronic non-respiratory comorbidities were defined, according to the CI,10 ABG levels at admission and within 2 h, 24 h, 48 h after NIV start and at discharge, as well as the length of in-hospital stay and in-hospital mortality. The following pathological conditions were considered as causes of acute RF in the enrolled patients: (i) acute exacerbations of COPD; (ii) cardiogenic pulmonary oedema or congestive heart failure; (iii) pneumonia; (iv) pneumothorax; and (v) pulmonary embolism. In accordance with previous studies, objective criteria were used to define when to start the discontinuation process of NIV: an increase in pH value ≥ 7.35, a decrease in pCO2 of >15–20% and in respiratory rate ≥20%, with oxygen saturation ≥90% in comparison with spontaneous breathing. SaO2 and ECG were continuously monitored.9 Lung function test was carried out in 70/112 of patients in the preceding year.11 Statistical analysis Continuous data were expressed as mean ± standard deviation (SD) and categorical data as count and percentages. Baseline data and characteristics of A, B and C groups of patients were compared with one-way analysis of variance and Bonferroni post-hoc test for continuous variables and with Chi-squared test for categorical data. The repeated measures analysis of variance has been performed in order to study the changes of pH, pCO2 and pO2/FiO2, across time intervals until patient hospital discharge or death. Risk factors of in-hospital all cause mortality have been assessed by univariate and multivariable logistic regression analysis. No correlated variables reaching a P-value less than 0.1 at univariate analysis were included in the multivariable analysis. All P-values refer to two-tailed tests of significance; P-values < 0.05 were considered statistically significant. Statistical analyses were performed using Stata/SE 12.1 (StataCorp LP, College Station, TX, USA). The aim of the study was to assess the feasibility of NIV to improve ABG and in-hospital outcomes in these subjects. Therefore, in this pilot study, we did not perform a power calculation. Results The flow chart of the study is shown in Figure 1. A total of 112 COPD patients with hypercapnic RF, meeting predefined inclusion criteria was enrolled in the trial and then divided into three groups according to the level of their acidosis. Among the COPD patients, who were excluded by the study, 15 refused NIV, 39 had pH ≥ 7.35 and were treated with only medical therapy, whereas four required immediate intubation and were © 2015 Royal Australasian College of Physicians 529 Fiorino et al. Figure 1 The flow chart of the study. 246 patients with acute respiratory failure 76 patients without COPD 15 patients refused NIV 170 patients with COPD 39 patients with pH≥7.35 treated with medical therapy 112 patients meeting criteria for NIV NIV failure in 20 patients (20 deaths, no ETI) 4 patients required immediate intubation NIV success in 92 patients transferred. Baseline characteristics of enrolled patients and causes of acute RF are reported in Table 1. Obviously the severity of hypercapnia was significantly worse in the more acidotic group together with the level of consciousness. Numbers and types of acute and chronic comorbidities, according to the Charlson Index, are shown in Table 2. Overall the number of chronic comorbidities did not differ between A, B and C groups. All patients were ventilated at least one night after their in-hospital admission. Patients who responded initially well to NIV were 101 of 112 (first few hours), but six of them deteriorated their pH after 48 h of NIV, and three died during NIV because of stroke (n.2) and myocardial infarction (n.1) Eighty-two per cent (92/112) of patients were therefore discharged alive and considered NIV treated with success: 42/55 (76%) in group A, 26/31 (84%) in group B, 24/26 (92%) in group C. None of these patients was considered intolerant to NIV. Overall 20/112 (18%) subjects died (NIV failure): 13 in group A, five in group B and two in group C. (P = 0.21). None of them required ETI because eight had a ‘do not intubation’ order (three patients discontinued NIV for intolerance), whereas, in the remaining 12 (four subjects discontinued NIV for intolerance), ETI was considered inappropriate by the attending anaesthetist, according to our hospital guidelines, because it was considered futile. The causes of death in these patients were: stroke (two patients in group A), myocardial infarction (one in group A), congestive heart failure (four in group A, four in group B and one in group C), refractory hypoxia due to pneu- monia (six in group A, one in group B and one in group C) and are reported in Table 3. Table 4 depicts the changes in ABG during the time course in the patients of the three groups. A progressive improvement of arterial pH and pCO2 levels were observed in the subjects of the three groups (Fig. 2). Pneumonia was the cause of in-hospital admission in 29/112 (26%) patients (16 in patients with pH < 7.26, eight in patients with pH between 7.26 and 7.299 and five patients with pH ≥ 7.30, P = 0.64); 8/29 individuals with pneumonia died versus 12/83 without pneumonia (P = 0.19). None of our patients developed pneumonia during their in-hospital stay. The left side of Table 5 shows the results of the univariate analysis to predict the NIV failure (NIVF). Remarkably, renal failure was not entered into the multivariable model due to the very strong association with in-hospital survival. Only age and GCS had an increased risk of NIVF, whereas, the prevalence of diabetes was higher in subjects with a better clinical outcome, although this difference was not significant (P = 0.08). Interestingly, the presence of comorbidities, pneumonia and Charlson Index were not associated with an increased probability of death in our study. The right side of Table 5 illustrates the results of the multivariate analysis: age and GCS were independently associated with NIVF and/or death, whereas a history of diabetes was associated with a better trend in clinical outcome. In-hospital stay was similar in the three groups (14.1 ± 10.71 in group A vs 16.6 ± 11.51 days in group B vs 14.6 ± 6.8, P = 0.52). © 2015 Royal Australasian College of Physicians 530 COPD: non-invasive ventilation Table 1 Mean (SD) demographic and clinical characteristics of enrolled COPD patients with causes of acute respiratory failure, subdivided according to pH arterial blood (pH < 7.26, pH between 7.26–7.299 or pH ≥ 7.30) Characteristics at enrolment Age (years) Sex (M/F) Glasgow Coma Scale Respiratory rate (breaths/min) Charlson Index PaO2/FiO2 PaCO2 (mmHg) Length of in-hospital stay Bicarbonate Patients with pH < 7.26 (group 1): 55 Patients with pH between 7.26–7.299 (group 2): 31 Patients with pH ≥ 7.30 (group 3): 26 P-value 80.8 ± 8.3 24/31 10.6 ± 3.0* 32.3 ± 3.6 3.54 ± 1.27 244.4 ± 93.9 84.7 ± 21.9*§ 16.6 ± 11.5 29.9 ± 7.7 80.3 ± 9.4 12/19 12.0 ± 2.6 31.2 ± 2.2 3.48 ± 1.41 230.3 ± 66.3 66.3 ± 13.4 14.1 ± 10.71 31.8 ± 11.8 78.6 ± 9.9 15/11 13.0 ± 1.8 30.4 ± 3.8 2.23 ± 1.06 221.8 ± 69.2 65.6 ± 10.0 14.6 ± 6.8 33.8 ± 4.9 0.6 0.33 0.0009 0.06 0.0001 0.47 0.0001 0.52 0.15 Causes of ARF Acute exacerbations of COPD Pneumonia Congestive heart failure/cardiogenic pulmonary oedema Pulmonary embolism Pneumothorax 22 16 15 2 0 14 8 8 1 0 9 5 11 1 0 0.85 Number of comorbidities 1 2 3 4 5 6 2 14 14 19 6 0 1 8 8 11 2 1 1 5 11 6 2 1 0.85 Bonferroni multiple-comparison test: *P < 0.05 group 1 versus group 3. §P < 0.05 group 1 versus group 2. ARF, acute respiratory failure; COPD, chronic obstructive pulmonary disease. Discussion To our knowledge, our prospective observational pilot study reports, for the first time in a rural hospital, the feasibility and effectiveness of NIV in improving the outcome of COPD patients with moderate to severe acidosis (pH < 7.35) outside a protected environment. Based on the data obtained in the present investigation, with the assumption to have an expected proportion of death equal to 10% in the subset of patients at lower risk (group C) and 25% in the subsets of patients at higher risk, we need to enlist about 150 patients per group. In the past few years, NIV use has been increased worldwide, and it has become the ‘standard of care’ for the treatment of most episodes of acute exacerbations in COPD-hospitalised patients.12,13 A recent study performed in the United States over a time span of 11 years, with the aim of assessing the prevalence and trends of NIV for acute COPD using data from the Healthcare Cost and Utilisation Project’s Nationwide Inpatient Sample, has shown that the use of this type of respiratory support has surpassed that of invasive mechanical ventilation.14 Data from this investigation did not allow depiction of the location where patients were treated or their severity at admission. However, it is very likely that not all the 612.000 patients requiring mechanical support were ventilated in a protected environment like an ICU or RICU, and that a subset of individuals was also admitted nationwide in tertiary care hospitals. Most of the studies published in the literature were either conducted by an experienced team and/or in large hospitals with an ICU, and this may not reflect the ‘daily life’ situation of most of the rural or small district hospitals. The International Consensus Conference of NIV dated back in 200015 was not specific in defining the ideal location according to patients’ severity since it was stated that the optimal environment depends on the capacity for adequate monitoring, staff skill and experience. In a multicentre randomised study, Plant et al.8, compared NIV with conventional medical therapy to treat early an episode of ARF in COPD patients, using a ‘simple’ NIV ventilator, minimal monitoring and with a median 1:11 patient/nurses ratio. NIV was initiated and maintained by the ward staff according to a strict © 2015 Royal Australasian College of Physicians 531 Fiorino et al. Table 2 Number and types of acute and chronic comorbidities in enrolled patients, according to Charlson Index Charlson comorbidities Patients with Patients with pH Patients with pH < 7.26 between 7.26–7.299 pH ≥ 7.30 (group 1) (group 2) (group 3) Myocardial infarction history Congestive heart failure Peripheral vascular disease Cerebrovascular disease Chronic pulmonary disease Dementia Connective tissue disease Peptic ulcer disease Mild liver disease Diabetes 8 8 7 9 6 11 5 4 4 7 3 4 55 31 26 1 0 1 0 3 1 0 0 2 3 8 1 7 1 1 Charlson comorbidities Patients with Patients with pH Patients with pH < 7.26 between 7.26–7.299 pH ≥ 7.30 (group 1) (group 2) (group 3) Hemiplegia 1 1 3 Moderate or severe renal disease Diabetes with end organ damage Any tumour 7 2 1 4 1 3 7 4 1 Leukaemia 1 0 0 Lymphoma Moderate or severe liver disease Metastatic solid tumour AIDS 2 2 0 0 0 1 0 0 0 0 0 0 AIDS, acquired immune deficiency syndrome. protocol and after extensive training. Using prospectively defined criteria, NIV reduced the need for ETI and hospital mortality. However, in a subgroup analysis, patients with a pH < 7.30 after 4 h of therapy reported a prognosis worse than that seen in comparable studies conducted in the ICU and not better than in the conventional treatment group. This study raised the concern that NIV could not be safely used in the presence of moderate to severe acidosis outside a protected location. For example in the NIV guidelines, the British Thoracic Society confirmed that ‘patients with more severe acidosis (pH < 7.30) should be managed in a higher dependency area such as a high dependency unit or ICU, as should those in whom improvement in clinical state and arterial blood gas tensions is not seen after 1–2 h of NIV on a respiratory ward’.16 Interestingly in the same Country (UK) a survey on more than 200 units revealed that NIV was initiated in several non-ICU locations, including the emergency department (54.6% of hospitals), respiratory wards (51.4%) and general medical wards (18.8%), but once more there was no mention about the severity of the episode of ARF.17 To our knowledge, the only two large-sized investigations that tried to assess the percentage and clinical outcome of patients with severe respiratory failure, who were treated with NIV outside the wall of a protected location on the basis of degree of acidosis observed at hospital admission, were performed in UK and Canada. The first one18 was an audit on 232 hospital units obtaining data on 9716 patients, 20% of those with gases recorded on admission were acidotic and among the 1077 receiving NIV, 55% had a pH < 7.26. Hospital mortality Table 3 Causes of death in the three groups of patients, according to pH arterial blood (pH < 7.26, pH between 7.26–7.299 or pH ≥ 7.30) Acute myocardial infarction Acute ischaemic stroke Pneumonia Congestive heart failure Patients with pH < 7.26 (group 1): 55 Patients with pH between 7.26–7.299 (group 2): 31 Patients with pH ≥ 7.30 (group 3): 26 P-value 1 2 6 (2 patients with NIV early and 1 with NIV late failure) 4 (2 patients with NIV early and 1 with NIV late failure) 0 0 1 (1 subject with NIV late failure) 0 0 1 (1 subject with NIV late failure) 0.59 0.35 0.31 4 (1 patient with NIV early and 1 with NIV late failure) 1 (1 subject with NIV late failure) 0.44 NIV, non-invasive. © 2015 Royal Australasian College of Physicians 532 COPD: non-invasive ventilation Table 4 Mean ± SD of arterial blood gas values of the patients with acute exacerbations of COPD pH P‡ = 0.0001 pCO2 P‡ = 0.0001 PO2/FiO2 P‡ = 0.37 Bicarbonate Admission 2–6 h 24 h 48 h At discharge P-value† Group A Group B Group C 7.17 ± 0.06 7.28 ± 0.01 7.31 ± 0.01 7.27 ± 0.08* 7.35 ± 0.05* 7.36 ± 0.04* 7.34 ± 0.09* 7.38 ± 0.05* 7.39 ± 0.05* 7.40 ± 0.06* 7.39 ± 0.09* 7.40 ± 0.04* 7.43 ± 0.05* 7.44 ± 0.05* 7.42 ± .04* 0.000 Group A Group B Group C 84.7 ± 21.9 66.3 ± 13.4 65.6 ± 10.0 69 ± 18.5* 57.2 ± 12.3* 60.6 ± 11.7* 59.7 ± 17* 55.3 ± 11.2* 59.8 ± 10.4* 55.2 ± 116.4* 55.1 ± 14.4* 56.5 ± 8.0* 47.6 ± 9* 46.9 ± 6.6* 52.2 ± 8.4* 0.000 Group A Group B Group C 244.4 ± 93.9 230.3 ± 66.3 221.8 ± 69.2 244.6 ± 84.1 254.9 ± 95.5 241.5 ± 63.9 270.3 ± 89.4 263.5 ± 65.1 239.2 ± 61.2 283.2 ± 87.2 292.8 ± 74.7* 296.6 ± 98.9* 312.1 ± 75.6* 327.3 ± 82.8* 303.6 ± 44.4* 0.000 Group A Group B Group C 29.9 ± 7.7 31.8 ± 11.8 33.8 ± 4.9 31.0 ± 6.8 32.0 ± 8.1 35.1 ± 4.5 32.0 ± 6.9 32.5 ± 6.2 36.1 ± 4.3 33.7 ± 7.2 32.6 ± 6.4 35.6 ± 3.8 32.3 ± 5.8 32.5 ± 5.6 34.6 ± 4.9 0.226 P‡ = 0.0001 Repeated measures analysis of variance. *<0.05 in comparison to admission. †From testing among time intervals. ‡From testing among groups A, B and C. COPD, chronic obstructive pulmonary disease. was 25% in these ventilated patients, and only 5% of all acidotic patients in only 91 of 232 secondary care centres received ETI. These data suggest that a large number of units do not have in their hospitals ICU availability or receive adequate critical care support. The second study19 performed in a Canadian tertiary care hospital showed that 13% and 23% of their COPD or Cardiogenic Pulmonary Oedema patients received NIV in the ward general or the observation ward respectively. Indeed, 23 of 68 patients had a baseline pH ≤ 7.25 prior to NIV initiation, 17 of whom had a pH from 7.15 to 7.24. Of these patients, 16 improved after treatment, suggesting the feasibility of NIV outside a protected area even in the case of severe acidosis. Another interesting approach to treat patients with life threatening ARF is that proposed by Cabrini et al.20 that demonstrated how, under the supervision of a Medical Emergency Team in our institution, NIV could be applied in a wide variety of settings, outside the ICU, with a high success rate and with few complications. Some years ago, a previous study carried out in an ED had also suggested that NIV is effective in the treatment of patients with severe acidosis, due to acute hypercapnic COPD.21 Our study systematically showed the feasibility of NIV even in patients with severe acidosis hospitalised in a general ward with minimal instrumentation and monitoring, and with a patient : nurse rate similar to what was described by Plant et al.8 However, it is important, to describe better the environment where this study was conducted. The rural hospital of Budrio is located in the bigger Bologna area, serving alone a total of 100 000 inhabitants, and the distance from the referring RICU is 15 km that can be usually covered, in the case of need in <15 min by ambulance. The Budrio’s hospital team has three pulmonologists in its staff and a nursing team that initiated the use of NIV a decade ago. In 2011, the hospital initiated a strict collaboration with the Respiratory and Critical Care Unit of the Sant’Orsola Malpighi Hospital, which included formal training of nurses and doctors not only on the use of NIV ventilators and interfaces, but also life supporting manoeuvres. The encouraging data obtained in this study should therefore not be generalised but placed in this particular context. In fact, the about-20% rate of NIV failure is in keeping with most of the randomised controlled trial (RCT) studies performed with a similar degree of acidosis. Rather surprisingly though, we did not observe any statistical difference between the three groups of patients divided according to their severity of pH. For example, in patients with a mean pH of 7.17, Squadrone et al.22 reported a higher (>50%) failure rate than that reported in group A of the present study (25%) with a similar initial pH. However, they did not record the number and types of comorbidities of their COPD patients. Several studies23 have showed that coexisting comorbidities have a high prevalence in patients with COPD, with percentages ranging from 40% to 95%, and that they represent independent risk factors both for death in clinically stable COPD individuals and for in-hospital mortality in COPD patients after episodes of acute exacerbation. The types © 2015 Royal Australasian College of Physicians 533 Fiorino et al. 200 250 pO2/FiO2 300 350 Figure 2 Arterial blood gases (ABG) changes (pO2/FiO2, pCO2 and pH) during the time course of the study. ( ), pH ≥ 7.3; ( ), 7.26 < pH < 7.29; ( ), pH < 7.26. 2-6 ore 24 ore 48 ore dimissione 40 50 60 pCO2 70 80 90 ingresso 2 3 4 5 1 2 3 4 5 7.1 7.2 pH 7.3 7.4 7.5 1 and number of comorbidities in our three groups of patients were very similar, and this may well explain the similar outcomes of our patients despite the higher level of acidosis and more severely compromised level of consciousness. Comorbidities have been shown to be one of the major determinants of NIV success or failure.23–25 Very few studies have considered the Charlson Index to assess the overall severity of these patients, but interestingly the mean index of our study (between 2.5 and 3.5, according to the different groups) is rather similar to that described by others and the overall NIV failure was fairly constant (around 10–15%).26,27 The question of whether management of patients with a pH < 7.30 in a non-high dependency setting has equivalent outcomes to a high dependency setting can be solved only with a RCT is very difficult to perform. © 2015 Royal Australasian College of Physicians 534 COPD: non-invasive ventilation Table 5 Predictors of in hospital mortality at logistic regression analysis Age (years) Glasgow Coma Scale pH 7.26–7.299 <7.26 Tumours Sex Charlson Index Diabetes Chronic heart failure History of myocardial infarction Cerebrovascular disease Cor pulmonale Univariate analysis OR (95% CI) P-value Multivariable analysis OR (95% CI) P-value 1.13 (1.05–1.22) 0.82 (0.69–0.97) 0.001 0.022 1.14 (1.04–1.23) 0.79 (0.66–0.96) 0.003 0.017 2.30 (0.40–13.0) 3.71 (0.77–17.8) 1.44 (0.35–5.82) 0.97 (0.37–2.57) 1.23 (0.87–1.75) 0.16 (0.02–1.24) 1.71 (0.54–5.42) 1.02 (0.31–3.44) 1.35 (0.26–7.03) 2.44 (0.41–14.37) 0.34 0.10 0.60 0.96 0.24 0.08 0.36 0.96 0.72 0.32 CI, confidence interval; OR, odds ratio. We also seek to find potential variables associated with NIV failure. This has already been the objective of several studies, but mostly performed in the ICU or RICU. Changes in ABG after 1 or 2 h, respiratory rate and lack of sensorium impairment were the most powerful predictors of success. We confirm the predictive power of ABG and the rather surprising matter of age. An increasing age was associated with an elevated risk of NIV failure. This appears to be in contrast with most of the previous studies that showed a quite high success rate in old patients, but it is of note that the average baseline pH of the studies by Benhamou et al.28 and Nava et al.29 was 7.28 and 7.30, respectively, and that the mean age was 79 years and 81 years. Hence, overall the subjects enrolled in the present study were more acidotic and older. The overall results obtained in our study may have important clinical and organisational implications. The implementation of a NIV service in a tertiary hospital without an ICU may decrease the number of urgent admissions in a large community hospital where bed availability in the critical care area, at least in some countries, may be problematic. Quite often, ICU admission is denied in old patients especially when they have a chronic illness or several comorbidities.30 The implementation of NIV in a hospital with limited resources should be carefully evaluated, depending on the geographical position, the expected number of patients to be treated in 1 year, the possibility of having a ‘back-up ICU’ in case of a patient’s deterioration, dedicated equipment and most important, adequate training for the doctors and nurses to bring together, as in our case, an enthusiastic team of motivated people. In our hospital, we periodically meet (every 3 months) for an audit aimed to update knowledge and to discuss the problems that occurred in that time frame. Nurses and doctors participate in national and international courses on NIV. Lastly, we have specific protocols for monitoring patients’ vital signs and tolerance and to avoid nasal or skin abrasions. Our study presents important limitations. In this study, we did not record the effective hours of ventilation during nighttime, but it has been recently shown that the amount of time that NIV is effectively applied in ‘every day clinical practice’ is greater overnight than during the day, with air leaks, disconnections and desaturations not different between day and night.31 A relatively small number of patients was enrolled in a single centre for a limited amount of time (1 year). Indeed, despite the anaesthesiologist on duty who should theoretically follow the internal guidelines for intubation, it is well possible that other factors may have influenced his/her decision, such as the patient’s refusal and severity/prognosis of related diseases. Therefore, all these factors raise the possibility of a type 2 error. However, at least from a general point of view, our study has the merit to represent a snapshot of the ‘every day clinical practice’ in a rural hospital, where usually RCT are not performed. Conclusion Our pilot study confirms the hypothesis that NIV is a feasible and effective treatment also for patients with severe forms of acute exacerbations of COPD, admitted to a general ward of a rural hospital without dedicated critical care beds. However, the data need to be confirmed in larger studies and in different geographical locations. © 2015 Royal Australasian College of Physicians 535 Fiorino et al. Acknowledgements We are indebted to our nursing staff: I. Alberio, M. Baccarini, M. Benetti, A. Brcanija, L. Carini, G. Cassini, D. Dani, M. Dudojc, S. Francavilla, E. Leonelli, T. Leonetti, C. Paternuosto, B. Morelli, N. Menandro, P. Passerò, M. R. Pesce, O. Riccio, M. Skrzynecka, C. Testagrossa, I. Turturiello, M. Vetrone, F. Caruso. References 1 Vincent JL, Sakr Y, Ranieri VM. Epidemiology and outcome of acute respiratory failure in intensive care unit patients. Crit Care Med 2003; 31(Suppl): S296–9. 2 Divo M, Cote C, de Torres JP, Casanova C, Marin JM, Pinto-Plata V et al. Co-morbidities and risk of mortality in pts with chronic obstructive pulmonary disease. Am J Resp Crit Care Med 2012; 186: 155–61. 3 Chatila WM, Thomashow BM, Minai OA, Criner GJ, Make BJ. Comorbidities in chronic obstructive pulmonary disease. Proc Am Thorac Soc 2008; 5: 549–55. 4 Ambrosino N, Foglio K, Rubini F, Clini E, Nava S, Vitacca M. Non-invasive mechanical ventilation in acute respiratory failure due to chronic obstructive pulmonary disease: correlates for success. Thorax 1995; 50: 755–7. 5 Confalonieri M, Garuti G, Cattaruzza MS, Osborn JF, Antonelli M, Conti G et al. A chart of failure risk for noninvasive ventilation in patients with COPD exacerbation. Eur Respir J 2005; 25: 348–55. 6 Balami JS, Packham SM, Gosney MA. Non-invasive ventilation for respiratory failure due to acute exacerbations of chronic obstructive pulmonary disease in older patients. Age Ageing 2006; 35: 75–9. 7 Fiorino S, Detotto E, Battilana M, Bacchi-Reggiani L, Moretti R, Benfenati F et al. Severe exacerbations of chronic obstructive pulmonary disease: management with noninvasive ventilation on a general medicine ward. Ital J Med 2010; 4: 173–8. 8 Plant PK, Owen JL, Elliott MW. Early use of non-invasive ventilation for acute 9 10 11 12 13 14 15 The authors thank Dr Simonetta Righi, Biblioteca Centralizzata, Policlinico S. Orsola-Malpighi, Università di Bologna, Bologna, Italy for her support in the scientific bibliography searches and Dr Laura Pontoriero, Unità di Cura Materno-Infantile, Distretto Lametino, A. S. P. Catanzaro, Italy for her assistance in the English editing of our manuscript. exacerbations of chronic obstructive pulmonary disease on general respiratory wards: a multicentre randomised controlled trial. Lancet 2000; 355: 1931–5. Moretti M, Cilione C, Tampieri A, Fracchia C, Marchioni A, Nava S. Incidence and causes of non-invasive mechanical ventilation failure after initial success. Thorax 2000; 55: 819–25. Charlson ME, Pompei P, Ales KL, MacKenzie CR. A new method of classifying prognostic comorbidity in longitudinal studies: development and validation. J Chronic Dis 1987; 40: 373–83. Miller MR, Hankinson J, Brusasco V, Burgos F, Casaburi R, Coates A et al. ATS/ERS Task Force. Standardisation of spirometry. Eur Respir J 2005; 26: 319–38. Groenewegen KH, Schols AM, Wouters EF. Mortality and mortality-related factors after hospitalization for acute exacerbation of COPD. Chest 2003; 124: 459–67. Bustamante-Fermosel A, De Miguel-Yanes JM, Duffort-Falcó M, Muñoz J. Mortality-related factors after hospitalization for acute exacerbation of chronic obstructive pulmonary disease: the burden of clinical features. Am J Emerg Med 2007; 25: 515–22. Stefan MS, Shieh MS, Pekow PS, Rothberg MB, Steingrub JS, Lagu T et al. Epidemiology and outcomes of acute respiratory failure in the United States, 2001 – 2009: a national survey. J Hosp Med 2013; 8: 76–82. International Consensus Conference Committee. International Consensus Conferences in Intensive Care Medicine: noninvasive positive pressure ventilation in acute respiratory failure. Am J Respir Crit Care Med 2001; 163: 283–91. 16 British Thoracic Society Standards of Care Committee. Non-invasive ventilation in acute respiratory failure. Thorax 2002; 57: 192–211. 17 Sulaiman MI, Rodger KA, Hawkins M. A survey of the use of non invasive positive pressure ventilation in critical care units in the United Kingdom. Am J Respir Crit Care Med 2004; 169: A522. 18 Roberts CM, Stone RA, Buckingham RJ, Pursey NA, Lowe D, National Chronic Obstructive Pulmonary Disease Resources and Outcomes Project Implementation Group. Acidosis, non-invasive ventilation and mortality in hospitalised COPD exacerbations. Thorax 2011; 66: 43–8. 19 Paus-Jenssen ES, Reid JK, Cockcroft DW, Laframboise K, Ward HA. The use of noninvasive ventilation in acute respiratory failure at a tertiary care center. Chest 2004; 126: 165–72. 20 Cabrini L, Moizo E, Nicelli E, Licini G, Turi S, Landoni G. Noninvasive ventilation outside the intensive care unit from the patient point of view: a pilot study. Respir Care 2012; 57: 704–9. 21 Crummy F, Buchan C, Miller B, Toghill J, Naughton MT. The use of noninvasive mechanical ventilation in COPD with severe hypercapnic acidosis. Respir Med 2007; 101: 53–61. 22 Squadrone E, Frigerio P, Fogliati C, Gregoretti C, Conti G, Antonelli M et al. Noninvasive vs invasive ventilation in COPD patients with severe acute respiratory failure deemed to require ventilatory assistance. Intensive Care Med 2004; 30: 1303–10. 23 Lindenauer PK, Stefan MS, Shieh MS, Pekow PS, Rothberg MB, Hill NS. Outcomes associated with invasive and noninvasive ventilation among patients hospitalized with exacerbations of chronic obstructive pulmonary disease. JAMA Intern Med 2014; 174: 1982–93. © 2015 Royal Australasian College of Physicians 536 COPD: non-invasive ventilation 24 Pacilli AM, Valentini I, Carbonara P, Marchetti A, Nava S. Determinants of noninvasive ventilation outcomes during an episode of acute hypercapnic respiratory failure in chronic obstructive pulmonary disease: the effects of comorbidities and causes of respiratory failure. Biomed Res Int 2014; 2014: 976783. 25 Walkey AJ, Wiener RS. Use of noninvasive ventilation in patients with acute respiratory failure, 2000–2009: a population-based study. Ann Am Thorac Soc 2013; 10: 10–17. 26 Lemyze M, Mallat J, Nigeon O, Barrailler S, Pepy F, Gasan G et al. Rescue therapy by switching to total face mask after failure of face mask-delivered noninvasive ventilation in do-not-intubate patients in acute respiratory failure. Crit Care Med 2013; 41: 481–8. 27 Carrillo A, Ferrer M, Gonzalez-Diaz G, Lopez-Martinez A, Llamas N, Alcazar M et al. Noninvasive ventilation in acute hypercapnic respiratory failure caused by obesity hypoventilation syndrome and chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2012; 186: 1279–85. 28 Benhamou D, Muir JF, Melen B. Mechanical ventilation in elderly patients. Monaldi Arch Chest Dis 1998; 53: 547–51. 29 Nava S, Grassi M, Fanfulla F, Domenighetti G, Carlucci A, Perren A et al. Non-invasive ventilation in elderly patients with acute hypercapnic respiratory failure: a randomised controlled trial. Age Ageing 2011; 40: 444–50. 30 Evans TW, Nava S, Mata GV, Guidet B, Estenssoro E, Fowler R et al. Critical care rationing: international comparisons. Chest 2011; 140: 1618–24. 31 Olivieri C, Carenzo L, Vignazia GL, Campanini M, Pirisi M, Della Corte F et al. Does noninvasive ventilation delivery in the ward provide early effective ventilation? Respir Care 2015; 60: 6–11. Prevalence and significance of CYP2C19*2 and CYP2C19*17 alleles in a New Zealand acute coronary syndrome population P. D. Larsen,1,2 L. R. Johnston,1,3 A. Holley,1,3 A. C. La Flamme,3 L. Smyth,4 E. W. Chua,4 M. A. Kennedy4 and S. A. Harding1,5 1 Wellington Cardiovascular Research Group and 5Cardiology Department, Wellington Hospital, 2Department of Surgery and Anaesthesia, University of Otago, 3School of Biological Sciences, Victoria University of Wellington, Wellington and 4Carney Centre for Pharmacogenomics, University of Otago, Christchurch, New Zealand Key words platelet activation/drug effect, acute coronary syndrome, ticlopidine/*analogue and derivative, ticlopidine/therapeutic use, ethnicity. Correspondence Peter D. Larsen, University of Otago, PO Box 7343, Wellington, New Zealand. Email: [email protected] Received 27 October 2014; accepted 4 January 2015. doi:10.1111/imj.12698 Abstract Background: High on-treatment platelet reactivity has been associated with poor outcomes following acute coronary syndromes (ACS). Both the loss of function CYP2C19*2 allele and the gain of function CYP2C19*17 allele along with a range of clinical characteristics have been associated with variation in the response to clopidogrel. Aim: The study aims to examine the frequency of CYP2C19 variants and understand the factors associated with on-treatment platelet reactivity in a New Zealand ACS population. Methods: We prospectively enrolled 312 ACS patients. We collected clinical characteristics and measured on-treatment platelet reactivity using two validated point-of-care assays, VerifyNow and Multiplate. DNA was extracted and CYP2C19*2 and *17 alleles were identified using real-time polymerase chain reaction. Results: CYP2C19*2 or CYP2C19*17 alleles were observed in 101 (32%) and 106 (34%) of patients, respectively, with significant differences in distribution by ethnicity. In Maori and Pacific Island patients, 47% (confidence interval (CI) 31–63%) had CYP2C19*2 and 11% (CI 4–19%) CYP2C19*17 compared with 26% (CI 19–32%) and 41% (CI 32–49%) in white people. Carriage of CYP2C19*2 alleles was associated with higher levels of platelet reactivity measured by either assay, but we observed no relationship between platelet reactivity and CYP2C19*17. In multivariate analysis diabetes, clopidogrel dose and CYP2C19*2 status were all significant independent predictors of platelet reactivity. Conclusions: Both CYP2C19*2 and *17 were common in a New Zealand ACS population, with CYP2C19*2 observed in almost half the Maori and Pacific Island patients. CYP2C19*2, diabetes and clopidogrel dose were independent contributors to on-treatment platelet reactivity. © 2015 Royal Australasian College of Physicians 537 Larsen et al. Introduction There is considerable variability in the level of platelet inhibition observed in patients treated with clopidogrel and aspirin following acute coronary syndromes (ACS).1–3 Patients with high levels of platelet reactivity on clopidogrel have an increased risk of death, myocardial infarction and stent thrombosis.4,5 In a New Zealand context, we have previously demonstrated that high levels of platelet reactivity are common, particularly in Maori and Pacific Island patients.2 Previous studies have suggested that the variability in clopidogrel’s pharmacodynamics is multifactorial in origin. Clinical variables, such as diabetes and smoking,6 drug interactions including those with proton pump inhibitors,7 functional genetic polymorphisms, most importantly those in the hepatic CYP2C19 enzyme,8 and variation in the level of pretreatment platelet reactivity,9 have all been implicated in contributing to the variability in the response to clopidogrel. CYP2C19 is one of the enzymes involved in converting clopidogrel to its active metabolite. The CYP2C19*2 allele is a loss of function (LOF) variant associated with reduced blood levels of the active metabolite, while the *17 allele is a gain of function variant associated with higher levels of the active metabolite.8,10 CYP2C19*2 has been associated with an increased risk of adverse cardiovascular outcomes.8,10,11 Understanding the frequency of the CYP2C19 variants in a New Zealand ACS population and how this relates to on-treatment levels of platelet reactivity is important in determining optimal antiplatelet therapy in this population. Methods Patient population Patients presenting to Wellington Regional Hospital with ACS between January and December 2012 were eligible for inclusion in the study if there was an invasive approach (coronary angiography ± percutaneous coronary intervention (PCI)) planned. All participants were adequately pretreated with aspirin and clopidogrel. To ensure the necessary statistical power to assess the impact of ethnicity, we recruited 282 ACS patients (232 white people, 40 Maori and Pacific Islanders) and enriched the population with an additional 30 Maori and Pacific Island ACS patients. Exclusion criteria included a platelet count Funding: This work was supported by research grants from the Heart Foundation and from the Capital and Coast District Health Board. Conflict of interest: None. less than 100 × 109/L, known platelet function disorder, administration of a fibrinolytic agent within 24 h of enrolment, use of a glycoprotein IIb/IIIa receptor antagonist within 7 days, or administration of an oral antiplatelet agent other than aspirin or clopidogrel within 2 weeks of enrolment. The study was reviewed and approved by the Lower Regional South Ethics Committee (LRS/11/09/035). All patients provided written informed consent. Definitions An ACS was defined as symptoms suggestive of myocardial ischaemia lasting >10 min and either troponin elevation or ≥1 mm of new ST segment deviation or T wave inversion on an electrocardiogram in at least two contiguous leads.12 Adequate pretreatment was defined as chronic therapy (≥7 days) with aspirin (≥75 mg) and clopidogrel (≥75 mg), and/or loading with aspirin ≥300 mg at least 2 h and clopidogrel ≥300 mg at least 6 h prior to enrolment. The clopidogrel dose was defined as ‘high’ if patients had received a 600 mg loading dose followed by a 150 mg daily maintenance dosing. Intermediate dose was defined as either a 600-mg loading dose followed by 75-mg daily maintenance dose, or a 300-mg loading dose coupled with 150 mg maintenance dose. Low dose was defined as a 300-mg loading dose followed by 75-mg daily maintenance dose or chronic therapy with 75-mg daily of clopidogrel. Platelet function testing Blood samples for platelet function testing were taken prior to angiography. On average, this was 4 ± 2 days after hospital presentation with ACS. The level of on-treatment platelet reactivity was quantified using the VerifyNow P2Y12 assay (Accumetrics, San Diego, CA, USA) and the Multiplate analyser (Dynabyte, Munich, Germany), both of which have been shown to be predictive of clinical outcomes.4,5 The VerifyNow P2Y12 assay, a turbidimetric-based optical detection system, was used according to the manufacturer’s instructions. This device uses fibrinogen-coated microbeads, an agonist of adenosine diphosphate (20 mM ADP), and light transmittance through whole blood, to measure platelet agglutination. An optical signal, reported as P2Y12 reaction units (PRU), was recorded. The Multiplate analyser is a multiple electrode impedance aggregometer that assesses platelet function in whole blood as previously described.13 Briefly, whole blood was added to the test cuvettes, diluted (1:2 with 0.9% NaCl solution), stirred and warmed to 37°C. ADP was added to a final concentration of 6.4 mM, and aggregation was then continuously recorded for 6 min. © 2015 Royal Australasian College of Physicians 538 CYP2C19*2 in acute coronary syndromes Aggregation values are quantified as area under the aggregation curve expressed as aggregation units × minutes (AU). All material used for platelet function testing was obtained from the manufacturer (Dynabyte). High on-treatment platelet reactivity (HPR) was defined as >208 PRU for VerifyNow and >47AU for Multiplate measurement, while low on-treatment platelet reactivity (LPR) was defined as <85PRU for VerifyNow and <19AU for Multiplate measurement of platelet reactivity.14 Genotyping Genomic DNA was isolated from EDTA blood, followed by identification of CYP2C19*2, and *17 using validated real-time polymerase chain reaction (PCR) highresolution melting assays. The assay for CYP2C19*2 was based on the method described by Temesvari et al.15 For testing the presence of CYP2C19*17, a 62-base-pair PCR product was amplified with 0.2 μM each of the primers AAATTTGTGTCTTCTGTTCTCAAA and TGCCCATCGTG GCGCATTAT,16 in a 10-μL reaction mixture containing 1× reaction buffer B1, 1.5 mM Mg2+, 0.2 mM of each dNTP, 1.5 mM SYTO 9 Green Fluorescent Nucleic Acid Stain (Life Technologies, Carlsbad, CA, USA), 0.5 U of HOT FIREPol DNA Polymerase (Solis BioDyne, Tartu, Estonia), and 50 ng of input DNA. Thermal cycling was preceded by 95°C for 10 min, then 45 cycles of 95°C for 10 s, 52°C for 15 s and 72°C for 15 s. High-resolution melting profile was obtained by initial heating at 95°C for 15 s, re-annealing at 55°C for 15 s, and final denaturation with gradual heating to 95°C, during which fluorescence data were collected every 0.1°C. CYP2C19*2 and *17 genotyping for most samples was performed twice. Ambiguous genotype calls were resolved by Sanger sequencing or restriction digest. Statistical analysis Data are presented as mean (SD) for continuous variables that were normally distributed and as counts (%) for categorical variables. Differences in platelet reactivity by genotype were examined using analysis of variance. In univariate analysis using student t test, analysis of variance and correlation, we identified the factors associated with at least one of the platelet function assay measurements at P < 0.10. These variables were then examined using multivariate linear regression analysis with calculation of the adjusted β coefficient and coefficient of determination (R2) to identify the independent contribution of each to the inter-individual variability in on-treatment platelet reactivity as measured with the Multiplate assay and the VerifyNow assay. Results Of the 312 patients enrolled in the study, 58 (18%) presented with ST-segment elevation myocardial infarction, 239 (77%) with non-ST segment elevation myocardial infarction and 15 (5%) with unstable angina. The mean age of the population was 63 (±10) years old, and 225 (72%) were male. The majority (237, 76%) of the population were white people, with 70 (22%) of the patients identifying as Maori or of Pacific Island descent. There were 101 patients (32%) with carriage of at least one CYP2C19*2 allele, and this more likely in Maori and Pacific Island patients than white people (47%, confidence interval (CI) 31–63% compared with 26% CI 19–32%). There were 106 patients (34%) with at least one CYP2C19*17 allele. Maori and Pacific Island patients were less likely than white people to have a CYP2C19*17 allele (11% CI 4–19% compared with 41% CI 32–49%). We examined platelet reactivity by CYP2C19*2 status (Fig. 1), and the presence of the CYP2C19*17 allele (Fig. 2). The presence of the CYP2C19*2 allele was associated with significant differences in platelet reactivity with both platelet function assays. VerifyNow levels of platelet reactivity were 174 (93), 210 (81) and 224 (68) PRU in the no CYP2C19*2 alleles, 1 allele and 2 CYP2C19*2 alleles groups respectively (P = 0.001). Bonferroni’s multiple comparison showed significant differences between no and 1 CYP2C19*2 allele groups, but not between the other pairs. Multiplate levels of platelet reactivity were 39 (23), 43 (23) and 64 (41) AU in the no CYP2C19*2 alleles, 1 allele and 2 CYP2C19*2 alleles groups respectively (P = 0.0003). Bonferroni’s multiple comparison showed significant differences between 2 CYP2C19*2 alleles and both 1 allele and no CYP2C19*2 alleles, but not between the 1 allele and no CYP2C19*2 alleles groups. There were no significant differences in platelet reactivity measured by either assay and the presence of the CYP2C19*17 allele. On the basis of VerifyNow measurement, 138 (44%) had HPR, and this was associated with CYP2C19*2 allele carriage, with an observed rate of 26% in no CYP2C19*2, 54% with 1 CYP2C19*2 allele and 70% with 2 CYP2C19*2 alleles (P = 0.01, chi-squared test). Multiplate measurements led to the classification of 116 (37%) of the patients as having HPR, and this was also associated with CYP2C19*2 allele carriage, with a rate of 32% in the no CYP2C19*2 allele group, 44% with one allele and 58% with two CYP2C19*2 alleles (P = 0.03, chi-squared test). LPR was observed in 53 (17%) and 56 (18%) patients assessed by VerifyNow and Multiplate criteria, respectively, and this did not differ by CYP2C19*17 allele status with either assay (P = 0.95 and P = 0.69, respectively, for VerifyNow and Multiplate assays, chi-squared test). © 2015 Royal Australasian College of Physicians 539 Larsen et al. Figure 1 Individual values (n = 312) for on-treatment platelet reactivity stratified by CYP2C19*2 allele carriage as measured with VerifyNow P2Y12 assay on the left and Multiplate ADP assay on the right. Differences in platelet reactivity were measured using analysis of variance. Mean and standard deviation for each group are represented by the bars. We examined clinical characteristics of the groups by CYP2C19*2 allele status (Table 1). There were significant differences in ethnicity between the three groups, with higher rates of Maori and Pacific Island patients in 1 allele and 2 CYP2C19*2 alleles groups. There were also significantly more diabetic patients in the 2 CYP2C19*2 alleles group (0.02). There were no other significant differences between the three groups. Figure 2 Individual values (n = 312) for on-treatment platelet reactivity stratified by CYP2C19*17 allele carriage as measured with VerifyNow P2Y12 assay on the left and Multiplate ADP assay on the right. Differences in platelet reactivity were measured using analysis of variance. Mean and standard deviation for each group are represented by the bars. © 2015 Royal Australasian College of Physicians 540 CYP2C19*2 in acute coronary syndromes Table 1 Patient characteristics stratified by CYP2C19*2 status No CYP2C19*2 alleles n = 211 1 CYP2C19*2 allele n = 84 2 CYP2C19*2 alleles n = 17 P-value 62 (11) 158 (75) 30 (5) 62 (11) 58 (69) 30 (5) 62 (11) 9 (53) 30 (6) 0.66 0.11 0.82 170 (81) 37 (18) 4 (2) 55 (65) 25 (30) 4 (5) 7 (41) 8 (47) 2 (12) 0.001 146 (69) 144 (68) 52 (25) 42 (20) 54 (65) 52 (62) 18 (21) 14 (17) 13 (77) 13 (77) 9 (53) 4 (23) 0.54 0.40 0.02 0.73 66 (31) 37 (18) 13 (6) 24 (29) 13 (15) 6 (7) 3 (18) 2 (12) 2 (12) 0.47 0.76 0.67 67 (32) 72 (34) 90 (42) 53 (25) 32 (15) 10 (4) 56 (26) 30 (36) 26 (31) 38 (45) 15 (18) 16 (19) 2 (2) 18 (21) 8 (47) 5 (30) 7 (41) 2 (12) 1 (6) 0 (0) 5 (30) 0.39 0.82 0.97 0.22 0.49 0.44 0.61 32 (15) 170 (81) 9 (4) 23 (27) 57 (68) 4 (5) 3 (17) 12 (70) 2 (12) 0.09 105 (81) 225 (69) 93 (84) 224 (54) 108 (90) 263 (82) 0.83 0.08 96 (45) 53 (25) 62 (30) 48 (57) 12 (14) 24 (29) 11 (65) 4 (23) 2 (12) 0.11 Age (years) Male, n (%) BMI Ethnicity European Maori/Pacific Island Other Risk factors Hypertension Dyslipidaemia Diabetes Current smoker Medical history Previous MI Previous PCI Previous CABG Admission medications ACE inhibitor Beta-blocker Statin Ca channel antagonist Diuretic SSRI PPI Clinical presentation STEMI NSTEMI Unstable angina Laboratory data Creatinine (μmol/L) Platelet count (109/L) Clopidogrel dose Low dose Intermediate dose High dose ACE, angiotensin-converting enzyme; BMI, body mass index; CABG, coronary artery bypass graft; MI, myocardial infarction; NSTEMI, non-ST segment elevation myocardial infarction; PCI, percutaneous coronary intervention; PPI, proton pump inhibitor; SSRI, selective serotonin reuptake inhibitor; STEMI, ST-segment elevation myocardial infarction. There were 14 variables that had a univariate relationship with either Multiplate or VerifyNow measured platelet reactivity at P < 0.10, and these were included in the multivariate analysis shown in Table 2. CYP2C19*2 status, platelet count, diabetes and clopidogrel dose were all significant independent predictors of Multiplate measured platelet reactivity, while genotype, male gender, diabetes and clopidogrel dose were predictors of VerifyNow measured platelet reactivity. The proportion of platelet reactivity predicted on the basis of CYP2C19*2 alone was low for both assays (Table 3), but improved the overall predictive value above the use of clinical variables alone for each assay. Discussion Both CYP2C19*2 and *17 had high prevalence in a New Zealand ACS population. The frequency of these polymorphisms differed significantly in Maori and Pacific Island patients when compared with white people, with higher CYP219*2 and lower CYP2C19*17 frequency in Maori and Pacific Island patients. CYP2C19*2 alleles had a modest impact on platelet reactivity, with diabetes and clopidogrel dose having a greater influence. Clinical factors and genotype combined only explained 20–21% of the observed variance in on-treatment platelet reactivity. The observed frequency of CYP2C19*2 and *17 alleles in this study were 32% and 34% respectively. The percentage of patients with CYP2C19*2 and *17 alleles in the white people subpopulation, 26% and 41% respectively, was within the range of previous studies, where 10–28% with CYP2C19*27,8,17 and 21–41% with CYP2C19*178,18,19 have been described. The proportion of Maori and Pacific Island patients with CYP2C19*2 was 47%. The only previous study to examine the incidence of CYP2C19*2 in © 2015 Royal Australasian College of Physicians 541 Larsen et al. Table 2 Contribution to on-treatment platelet reactivity Multiplate ADP assay CYP2C19*2 alleles BMI Male gender Ethnicity Hypertension Diabetes Creatinine Dyslipidemia Platelet count Clopidogrel dose ACE inhibitor Beta-blocker Diuretic Statin PPI VerifyNow P2Y12 assay βadj (95% CI) P-value βadj (95% CI) P-value 7.1 (2.6 to 11.6) 0.08 (−0.4 to 0.6) 2.8 (−3.3 to 9.5) −2.2 (−8.5 to 4.0) −5.0 (−11.8 to 1.7) 6.5 (0.1 to 13.7) −0.1 (−0.3 to 0.1) 2.2 (−4.4 to 8.9) 0.1 (0.07 to 0.15) −3.6 (−6.9 to −0.5) 5.0 (−1.0 to 11.3) 1.9 (−4.2 to 8.0) 0.5 (−6.4 to 7.5) 5.1 (−1.3 to 11.5) 0.4 (−6.0 to 6.9) 0.002 0.75 0.36 0.47 0.15 0.05 0.57 0.51 0.001 0.02 0.10 0.54 0.87 0.12 0.90 25.9 (9.7 to 42.2) 1.3 (−0.5 to 3.2) −26.3 (−48.5 to −4.0) −4.1 (−26.5 to 18.3) 1.3 (−22.8 to 25.0) 40.9 (16.9 to 64.9) −0.04 (−0.1 to 0.03) 15.1 (−8.9 to 39.2) −0.1 (−0.2 to 0.13) −15.4 (−26.9 to −3.8) 10.6 (−11.3 to 32.6) 11.8 (−10.1 to 33.7) −8.8 (−33.6 to 16.1) 2.0 (−21.0 to 25.0) 17.8 (−5.4 to 41.0) 0.002 0.16 0.02 0.71 0.95 0.001 0.26 0.21 0.84 0.009 0.34 0.29 0.49 0.87 0.13 Adjusted B coefficients with 95% CI for on-treatment platelet reactivity in a multivariate linear regression model. BMI, body mass index; CI, confidence interval; PPI, proton pump inhibitor. Maori reported results in terms of allele frequency rather than proportion of patients carrying the allele. Using this measure, Lea et al. reported a frequency of 24%,20 and our calculated frequency was similar at 29%. This is the first study that we are aware of to examine the prevalence of CYP2C19*17 in Maori and Pacific Island patients, where only 11% demonstrated this allele. Several previous studies have demonstrated striking differences in the proportion of patients with CYP2C19 variants.8 Within a Japanese cohort CYP2C19*2 was observed in more than 57% of patients.3 A Korean study reported 44% of patients had CYP2C19*2.21 This level of variance between populations in a genotype known to affect responsiveness to a commonly used drug and to be associated with poor clinical outcomes highlights the importance of examining clinically relevant genotypes in a New Zealand population. Table 3 Percentage of the variability in on-treatment platelet reactivity explained Multiplate ADP assay CYP2C19*2 alleles Clinical variables† LOF alleles and clinical variables VerifyNow P2Y12 assay R2 (%) P-value R2 (%) P-value 3 18 20 0.001 0.0001 0.0001 4 18 21 0.0001 0.0001 0.0001 The percentage of the variability in on-treatment platelet reactivity explained was defined as the coefficient of determination (R2). †Clinical variables included were the 14 variables listed in Table 2, all of which had univariate associations with platelet reactivity with at least one of the assays at P ≤ 0.10. LOF, loss of function. The high prevalence of diabetes in Maori and Pacific Island patients2 contributed to the high rate of diabetes in the 2 CYP2C19*2 alleles group. Our previous observation that on-treatment platelet reactivity was higher in Maori and Pacific Island patients2 did not include genetic analysis, and so did not allow us to examine CYP2C19*2 alleles and diabetes as covariates along with ethnicity. All three were univariate predictors of platelet reactivity in the current study. However, in the multivariate analysis, only diabetes and CYP2C19*2 alleles but not ethnicity were independent contributors to platelet reactivity, suggesting that the ethnic differences are largely driven by these factors. The observed relationship between diabetes and platelet reactivity is consistent with previous reports.6,7,22 Similarly, lower doses of clopidogrel leading to lower levels of active metabolite have been previously described as a significant contributor to on-treatment platelet reactivity, as observed in our cohort.7 The two different platelet function assays produced slightly different models accounting for platelet reactivity. Platelet count was associated with platelet reactivity measured with the Multiplate system. Previous studies have reported a relationship between platelet count and platelet reactivity.7 The Multiplate assay is known to be sensitive to platelet count,23 but whether this reflects a more accurate assessment of how platelets behave in blood or is an artefact of measurement is unclear. Male gender has also been previously associated with higher levels of platelet reactivity,7 consistent with the results from the VerifyNow assay in our study. © 2015 Royal Australasian College of Physicians 542 CYP2C19*2 in acute coronary syndromes A large meta-analysis examining CYP2C19*2 allele carriage reported a significant increased risk of the composite end–point of cardiovascular death, myocardial infarction and stroke associated with this allele.11 Several studies have similarly reported a relationship between HPR and death, myocardial infarction, and stent thrombosis.1,5,24 The findings of these studies raise the possibility that the high prevalence of CYP2C19*2 in Maori and Pacific Island patients observed here, and the previously described high rate of HPR in Maori and Pacific Island patients,2 may contribute to the poor outcomes observed in this patient group. We did not observe a relationship between CYP2C19*17 and platelet reactivity in the current study, despite a high prevalence of this allele. Larger studies than ours have reported a lower rate of platelet reactivity in patients with this genotype and an associated increased bleeding risk,19,25 suggesting that our failure to observe any relationship here may be due to a lack of statistical power. However, there are large studies that have failed to demonstrate a relationship between CYP2C19*17 and bleeding risk.26 Alternative antiplatelet therapies are now available. Ticagrelor and prasugrel are more potent P2Y12 receptor antagonists, both of which have been associated with improved clinical outcomes in ACS patients.27,28 Switching from clopidogrel to prasugrel2 or ticagrelor29 effectively reduces the rate of HPR, while simply increasing the dose of clopidogrel appears to be a less effective strategy.30 In substudies from both PLATO31 and TRITON-TIMI 38,32 the adverse event rate was significantly higher in the clopidogrel arm of the trials in subgroups with CYP2C19*2 alleles. While a significant benefit remained for ticagrelor compared with clopidogrel in those without LOF alleles,31 there was no difference in the event rate between those without LOF alleles treated with clopidogrel compared with those treated with prasugrel.32 These studies raise the possibility that at least a portion of the benefits associated with prasugrel and ticagrelor could be achieved through a tailored strategy based on genotype. Given that clinical characteristics, medications and genotype combined in this study to predict only 20% of the measured platelet reactivity, it would appear that there is considerable additional information that can be gained from platelet function testing. However, it is not currently clear how this information should best be used. Tailored therapy driven by platelet function testing has not been successful to date. The three largest randomised trials using platelet function testing to tailor antiplatelet therapy, the GRAVITAS trial,33 the ARCTIC study34 and the TRIGGER-PCI trial,35 all failed to demonstrate any benefit from this approach. In the GRAVITAS study, patients with high levels of platelet function were given higher dose of clopidogrel33 rather than a more potent P2Y12 receptor antagonist, and this strategy has limited effectiveness. This was also the case for the majority of the ARCTIC study, with only 3.3% of patients switched to prasugrel.34 The TRIGGER-PCI trial was halted early due to a lower than expected event rate, suggesting that it was not going to be adequately powered.35 A relatively small (n = 600) randomised controlled trial that personalised antiplatelet therapy on the basis of CYP2C19 genotype demonstrated that this approach reduced MACE at 6 months in a Chinese population.36 This suggests that using CYP2C19 status rather than phenotype to direct therapy may have merit. In the New Zealand environment, currently both clopidogrel and ticagrelor are available and being used to treat patients with ACS. Given that nearly half the Maori and Pacific Island patients in this study had a CYP2C19*17 allele and we previously observed just over half had HPR,2 it is reasonable to suggest that Maori and Pacific Island patients with ACS are likely to have an increased benefit from the use of ticagrelor and should be preferentially treated with this agent. There are several limitations to this study. The sample size of 312 patients was relatively small, and as a consequence our power to observe significant contributors within a multivariate model was limited. This is seen in the reasonably large CI around the βadj coefficients in Table 2. Platelet function testing was performed prior to angiography. The time between symptom onset, presentation and loading with antiplatelet agents will have varied in the population, and we cannot exclude the possibility that this contributes to the variance in on-treatment platelet reactivity observed. We have not measured platelet reactivity prior to treatment, and so cannot examine how this relates to on-treatment variability. Other clinical variables that may contribute to platelet reactivity, such as left ventricular function, were not routinely measured. We have combined Maori and Pacific Island patients into a single ethnic group within this study, and this may be inappropriate as there may be significant differences between Maori and Pacific Island patients in terms of the frequency of CYP2C19 alleles. Conclusion Both CYP2C19*2 and *17 had high prevalence in a New Zealand ACS population, and CYP2C19*2 was observed in almost half the Maori and Pacific Island patients. While CYP2C19*2 demonstrated a modest contribution to the observed levels of platelet reactivity, we did not detect a relationship between CYP2C19*17 and platelet reactivity. Diabetes and clopidogrel dose were the most significant © 2015 Royal Australasian College of Physicians 543 Larsen et al. contributors to on-treatment platelet reactivity, but 80% of the observed variance in platelet reactivity was not accounted for. References 1 Geisler T, Schaeffeler E, Dippon J, Winter S, Buse V, Bischofs C et al. CYP2C19 and nongenetic factors predict poor responsiveness to clopidogrel loading dose after coronary stent implantation. Pharmacogenomics 2008; 9: 1251–9. 2 Johnston LR, Larsen PD, La Flamme AC, Michel JM, Simmonds MB, Harding SA. Suboptimal response to clopidogrel and the effect of prasugrel in acute coronary syndromes. Int J Cardiol 2013; 167: 995–9. 3 Nagashima Z, Tsukahara K, Morita S, Endo T, Sugano T, Hibi K et al. Platelet reactivity in the early and late phases of acute coronary syndromes according to cytochrome P450 2C19 phenotypes. J Cardiol 2013; 62: 158–64. 4 El Ghannudi S, Ohlmann P, Meyer N, Wiesel ML, Radulescu B, Chauvin M et al. Impact of P2Y12 inhibition by clopidogrel on cardiovascular mortality in unselected patients treated by percutaneous coronary angioplasty: a prospective registry. JACC Cardiovasc Interv 2010; 3: 648–56. 5 Sibbing D, Braun S, Morath T, Mehilli J, Vogt W, Schˆmig A et al. Platelet reactivity after clopidogrel treatment assessed with point-of-care analysis and early drug-eluting stent thrombosis. J Am Coll Cardiol 2009; 53: 849–56. 6 Morel O, Kessler L, Ohlmann P, Bareiss P. Diabetes and the platelet: toward new therapeutic paradigms for diabetic atherothrombosis. Atherosclerosis 2010; 212: 367–76. 7 Bouman HJ, Harmsze AM, van Werkum JW, Breet NJ, Bergmeijer TO, Ten Cate H et al. Variability in on-treatment platelet reactivity explained by CYP2C19*2 genotype is modest in clopidogrel pretreated patients undergoing coronary stenting. Heart 2011; 97: 1239–44. 8 Scott SA, Sangkuhl K, Gardner EE, Stein CM, Hulot JS, Johnson JA et al. Clinical pharmacogenetics implementation consortium guidelines for cytochrome P450-2C19 (CYP2C19) genotype and 9 10 11 12 13 14 15 16 clopidogrel therapy. Clin Pharmacol Ther 2011; 90: 328–32. Gurbel PA, Bliden KP, Hiatt BL, O’Connor CM. Clopidogrel for coronary stenting: response variability, drug resistance, and the effect of pretreatment platelet reactivity. Circulation 2003; 107: 2908–13. Scott SA, Sangkuhl K, Stein CM, Hulot JS, Mega JL, Roden DM et al. Clinical Pharmacogenetics Implementation Consortium guidelines for CYP2C19 genotype and clopidogrel therapy: 2013 update. Clin Pharmacol Ther 2013; 94: 317–23. Mega JL, Simon T, Collet JP, Anderson JL, Antman EM, Bliden K et al. Reduced-function CYP2C19 genotype and risk of adverse clinical outcomes among patients treated with clopidogrel predominantly for PCI a meta-analysis. JAMA 2010; 304: 1821–30. Thygesen K, Alpert JS, Jaffe AS, Simoons ML, Chaitman BR, White HD et al. Third universal definition of myocardial infarction. Circulation 2012; 126: 2020–35. Johnston LR, Larsen PD, La Flamme AC, Harding SA. Methodological considerations for the assessment of ADP induced platelet aggregation using the Multiplate(R) analyser. Platelets 2013; 24: 303–7. Tantry US, Bonello L, Aradi D, Price MJ, Jeong YH, Angiolillo DJ et al. Consensus and update on the definition of on-treatment platelet reactivity to adenosine diphosphate associated with ischemia and bleeding. J Am Coll Cardiol 2013; 62: 2261–73. Temesvari M, Paulik J, Kobori L, Monostory K. High-resolution melting curve analysis to establish CYP2C19 *2 single nucleotide polymorphism: comparison with hydrolysis SNP analysis. Mol Cell Probes 2011; 25: 130–3. Santos PC, Soares RA, Santos DB, Nascimento RM, Coelho GL, Nicolau JC et al. CYP2C19 and ABCB1 gene polymorphisms are differently distributed according to ethnicity in the Brazilian general population. BMC Med Genet 2011; 12: 13. 17 Brackbill ML, Kidd RS, Abdoo AD, Warner JG, Harralson AF. Frequency of CYP3A4, CYP3A5, CYP2C9, and CYP2C19 variant alleles in patients receiving clopidogrel that experience repeat acute coronary syndrome. Heart Vessels 2009; 24: 73–8. 18 Cuisset T, Loosveld M, Morange PE, Quilici J, Moro PJ, Saut N et al. CYP2C19*2 and *17 alleles have a significant impact on platelet response and bleeding risk in patients treated with prasugrel after acute coronary syndrome. JACC Cardiovasc Interv 2012; 5: 1280–7. 19 Sibbing D, Koch W, Gebhard D, Schuster T, Braun S, Stegherr J et al. Cytochrome 2C19*17 allelic variant, platelet aggregation, bleeding events, and stent thrombosis in clopidogrel-treated patients with coronary stent placement. Circulation 2010; 121: 512–18. 20 Lea RA, Roberts RL, Green MR, Kennedy MA, Chambers GK. Allele frequency differences of cytochrome P450 polymorphisms in a sample of New Zealand Maori. N Z Med J 2008; 121: 33–7. 21 Jeong YH, Tantry US, Kim IS, Koh JS, Kwon TJ, Park Y et al. Effect of CYP2C19*2 and *3 loss-of-function alleles on platelet reactivity and adverse clinical events in East Asian acute myocardial infarction survivors treated with clopidogrel and aspirin. Circ Cardiovasc Interv 2011; 4: 585–94. 22 Siller-Matula JM, Lang IM, Neunteufl T, Kozinski M, Maurer G, Linkowska K et al. Interplay between genetic and clinical variables affecting platelet reactivity and cardiac adverse events in patients undergoing percutaneous coronary intervention. PLoS ONE 2014; 9: e102701. 23 Hanke AA, Roberg K, Monaca E, Sellmann T, Weber CF, Rahe-Meyer N et al. Impact of platelet count on results obtained from multiple electrode platelet aggregometry (MultiplateTM). Eur J Med Res 2010; 15: 214–19. 24 Price MJ, Endemann S, Gollapudi RR, Valencia R, Stinis CT, Levisay JP et al. Prognostic significance of © 2015 Royal Australasian College of Physicians 544 CYP2C19*2 in acute coronary syndromes 25 26 27 28 29 post-clopidogrel platelet reactivity assessed by a point-of-care assay on thrombotic events after drug-eluting stent implantation. Eur Heart J 2008; 29: 992–1000. Harmsze AM, van Werkum JW, Hackeng CM, Ruven HJT, Kelder JC, Bouman HJ et al. The influence of CYP2C19*2 and*17 on on-treatment platelet reactivity and bleeding events in patients undergoing elective coronary stenting. Pharmacogenet Genom 2012; 22: 169–75. Simon T, Verstuyft C, Mary-Krause M, Quteineh L, Drouet E, Meneveau N et al. Genetic determinants of response to clopidogrel and cardiovascular events. N Engl J Med 2009; 360: 363–75. Wallentin L, Becker RC, Budaj A, Cannon CP, Emanuelsson H, Held C et al. Ticagrelor versus clopidogrel in patients with acute coronary syndromes. N Engl J Med 2009; 361: 1045–57. Wiviott SD, Braunwald E, McCabe CH, Montalescot G, Ruzyllo W, Gottlieb S et al. Prasugrel versus clopidogrel in patients with acute coronary syndromes. N Engl J Med 2007; 357: 2001–15. Alexopoulos D, Galati A, Xanthopoulou I, Mavronasiou E, Kassimis G, Theodoropoulos KC et al. Ticagrelor versus prasugrel in acute coronary syndrome patients with high on-clopidogrel platelet reactivity following percutaneous coronary intervention: a pharmacodynamic study. J Am Coll Cardiol 2012; 60: 193–9. 30 Sardella G, Calcagno S, Mancone M, Palmirotta R, Lucisano L, Canali E et al. Pharmacodynamic effect of switching therapy in patients with high on-treatment platelet reactivity and genotype variation with high clopidogrel Dose versus prasugrel: the RESET GENE trial. Circ Cardiovasc Interv 2012; 5: 698–704. 31 Wallentin L, James S, Storey RF, Armstrong M, Barratt BJ, Horrow J et al. Effect of CYP2C19 and ABCB1 single nucleotide polymorphisms on outcomes of treatment with ticagrelor versus clopidogrel for acute coronary syndromes: a genetic substudy of the PLATO trial. Lancet 2010; 376: 1320–8. 32 Mega JL, Close SL, Wiviott SD, Shen L, Walker JR, Simon T et al. Genetic variants in ABCB1 and CYP2C19 and cardiovascular outcomes after treatment with clopidogrel and prasugrel in the TRITON-TIMI 38 trial: a pharmacogenetic analysis. Lancet 2010; 376: 1312–19. 33 Price MJ, Berger PB, Teirstein PS, Tanguay JF, Angiolillo DJ, Spriggs D et al.. Standard- vs high-dose clopidogrel based on platelet function testing after percutaneous coronary intervention: the GRAVITAS randomized trial. JAMA 2011; 305: 1097–105. 34 Collet JP, Cuisset T, Range G, Cayla G, Elhadad S, Pouillot C et al. Bedside monitoring to adjust antiplatelet therapy for coronary stenting. N Engl J Med 2012; 367: 2100–9. 35 Trenk D, Stone GW, Gawaz M, Kastrati A, Angiolillo DJ, Muller U et al. A randomized trial of prasugrel versus clopidogrel in patients with high platelet reactivity on clopidogrel after elective percutaneous coronary intervention with implantation of drug-eluting stents results of the TRIGGER-PCI (testing platelet reactivity in patients undergoing elective stent placement on clopidogrel to guide alternative therapy with prasugrel) study. J Am Coll Cardiol 2012; 59: 2159–64. 36 Xie X, Ma YT, Yang YN, Li XM, Zheng YY, Ma X et al. Personalized antiplatelet therapy according to CYP2C19 genotype after percutaneous coronary intervention: a randomized control trial. Int J Cardiol 2013; 168: 3736–40. © 2015 Royal Australasian College of Physicians 545 Safety of coadministration of ezetimibe and statins in patients with hypercholesterolaemia: a meta-analysis L. Luo, X. Yuan, W. Huang, F. Ren, H. Zhu, Y. Zheng and L. Tang Department of Nephrology, The Second Affiliated Hospital of Chongqing Medical University, Chongqing, China Key words ezetimibe, statin, hypercholesterolaemia, adverse event, meta-analysis. Correspondence Lin Tang, Department of Nephrology, The Second Affiliated Hospital of Chongqing Medical University, Chongqing 400010, China. Email: [email protected] Received 20 October 2014; accepted 19 December 2014. doi:10.1111/imj.12706 Abstract Background: Hypercholesterolaemia is a pivotal risk factor for cardiovascular and cerebrovascular disease and is treated with many effective lipid-lowering agents. Statins are often used alone or in combination with ezetimibe. Combination therapy is more effective because of its complementary approach, which has major benefits for patients with unmanageable lipid levels. Extensive application of combination therapy has resulted in an increased incidence of side-effects, which has raised our concern. Aim: To evaluate the evidence associated with the safety of coadministration of ezetimibe with statins. Methods: Three electronic databases were searched (PubMed, EMBASE and Cochrane Library) from January 2002 to October 2014. Two independent reviewers critically identify randomised controlled trials (RCT), extracted the data and assessed trial quality. A total ot 20 RCT met inclusion criteria, including 14 856 patients. A fixed-effects model was used for meta-analysis to assess the safety of combination therapy. Results: Coadministration of ezetimibe and statins did not result in significant increases in total adverse events (30% vs 29%, P = 0.34), serious adverse events (2% vs 1.6%, P = 0.81), treatment discontinuations (3.5% vs 2.9%, P = 0.22), gastrointestinal adverse events (5% vs 4%, P = 0.08), allergic reactions or rashes (0.9% vs 1.3%, P = 0.33), creatine kinase > 10 × upper limit of normal (ULN) (0.2% vs 0.2%, P = 0.86), alanine aminotransferase > 3 × ULN (0.5% vs 0.4%, P = 0.96) and aspartate aminotransferase > 3 × ULN (0.4% vs 0.4%, P = 0.58). Conclusion: The incidence of adverse events was similar between ezetimibe–statin combination therapy and statin monotherapy; thus, we recommend combination therapy for patients with hypercholesterolaemia at high risk for cardiovascular and cerebrovascular disease. Introduction Statins are inhibitors of hydroxymethylglutaryl-CoA (HMG-CoA) reductase, which lowers cholesterol through inhibiting the sterol biosynthetic pathway and are first-line lipid-altering medications.1 Ezetimibe is a cholesterol-absorption inhibitor that potently and selectively reduces intestinal absorption of dietary and biliary cholesterol, which is an option for patients with hypercholesterolaemia.2 The complementary mechanisms of action of statins and ezetimibe have greater lipidaltering efficacy than either agent alone, which is an Funding: This work was supported by a grant from the National Natural Science Foundation of China (No. 81200519; L. Tang). Conflict of interest: None. option for patients at high cardiovascular and cerebrovascular risk whose lipid levels do not reach the recommended standard of the National Cholesterol Education Program Adult Treatment Panel (NCEP ATP) III.3 However, in addition to lipid-modifying efficacy, the safety of coadministration of ezetimibe with statins has been a major concern. This meta-analysis aimed to examine critically the evidence for safety by analysing trials comparing ezetimibe– statin combination therapy with statin monotherapy. Methods We searched PubMed, EMBASE and Cochrane Library databases from January 2002 to October 2014, using the following terms ‘ezetimibe’, ‘zetia’, ‘ezetrol’, ‘statin’, © 2015 Royal Australasian College of Physicians 546 Safety of ezetimibe and statins ‘simvastatin’, ‘atorvastatin’, ‘rosuvastatin’, ‘lovastatin’, ‘pravastatin’, ‘cerivastatin’, ‘fluvastatin’, ‘hyperlipidaemia’, ‘dyslipidaemia’ and ‘hypercholesterolaemia’. The language was limited to English. Studies were included if they met the following criteria: (i) double-blind RCT; (ii) patients >18 years of age diagnosed with hypercholesterolaemia, whose lowdensity lipoprotein cholesterol (LDL-C) levels were above NCEP ATP III guidelines;4 (iii) comparison of safety of coadministation of ezetimibe and statins versus statins monotherapy; and (iv) treatment duration >4 weeks. Any disagreement about the inclusion of an article was resolved by discussion. Identified articles were screened to ensure that they met the predetermined inclusion criteria. Titles were reviewed initially, followed by abstracts and then full-text publications. Detailed information of whole articles was acquired by two reviewers independently. The detailed data were extracted as follows: study characteristics (first author’s name, publication year, number of participants), invention and control measures (type and dosage of active drug, duration of follow up), individual characteristics (number of patients with hypertension or diabetes mellitus) and outcome indicators (numbers of serious adverse events, treatment discontinuations, allergic reactions or rashes, patients with alanine aminotransferase (ALT) >3 × upper limit of normal (ULN), patients with aspartate aminotransferase (AST) >3 × ULN, gastrointestinal adverse events and patients with creatine kinase (CK) >10 × ULN. We put the Cochrane Risk of Bias tool into effect, including assessing random sequence generation; allocation concealment; participant, personnel and outcome assessor blinding; incomplete outcome data; selective outcome reporting; and other bias. In addition, risk of bias was not used as an exclusion criterion for individual studies in the meta-analysis. The risk of bias was demonstrated graphically: blank means not clear; red means high risk, and green means low risk; that is, the greener the graph, the higher quality the trials. For evaluation of safety, we analysed the total number of adverse events, and the numbers of serious adverse events, treatment discontinuations, allergic reactions or rashes, patients with ALT >3 × ULN, patients with AST >3 × ULN, gastrointestinal adverse events, and patients with CK >10 × ULN in each group, and compared the values between the two groups. The statistical analysis was performed by Software Review Manager 5.2 (Cochrane Collaboration, Oxford, UK). To assess heterogeneity for RCT, χ2 test and its results, P value and I2 statistics were analysed to assess the incidence of adverse events. Fixed-effects models were used for the meta-analysis. The P values were two tailed, and statistical significance was set at P = 0.05. Results A flow diagram of the selection process for the metaanalysis is shown in Figure 1. A total of 568 studies was hit initially, and 49 articles were retrieved for evaluation at length; and finally, 20 RCT that satisfied the inclusion criteria were analysed. The characteristics of these 20 studies are listed in Table 1.5–24 The quality of the reporting is shown in Figure 2; 13 trials had complete information for assessing randomisation, and five trials had adequate blinding. Results of the quality assessment for individual studies are shown in Figure 3. Total adverse events were reported in 16 studies, with 1165 events occurring in 3856 patients (30%) treated with ezetimibe and statins, compared with 1198 events in 4171 patients (29%) treated with statins alone. There was no significant difference in the two arms (95% confidence interval (CI), 0.85–1.06; P = 0.34; I2 = 0%), as shown in Figure 4. In the subgroup analysis of ezetimibe with atorvastatin, incidence of total adverse events in the combination therapy and statin monotherapy arms was 568 citations reviewed 209 excluded for duplication 359 potentially relevant studies 149 excluded for title 210 abstracts reviewed 164 excluded based on abstracts 46 full-text articles reviewed 20 randomised controlled trials included in the meta-analysis 3 additional trials 29 excluded after full article review 2 not relevant 3 with other medications agents 2 studies on the same population 2 with unavailable extracted data 3 cross-over tails 5 post-hoc analysis 2 pooled analysis 2 extension studies 3 without NCEP ATPIII 5 no full text Figure 1 Flow diagram of screening process for studies included in the meta-analysis. NCEP ATP III, National Cholesterol Education Program Adult Treatment Panel III. © 2015 Royal Australasian College of Physicians 547 Luo et al. Table 1 Characteristics of included studies. Study Participants Duration Intervention E+S Ballantyne et al. 20035 Melani et al. 20037 Kerzner et al. 20036 Feldman et al. 20049 Bays et al. 20048 Goldberg et al. 200410 Cruz-Fernandez et al. 200513 Barrios et al. 200512 Ballantyne et al. 200511 Farnier et al. 200514 Catapano et al. 200615 Zubaid et al. 200818 Conard et al. 200816 Leiter et al. 200817 Robinson et al. 200920 Farnier et al. 200919 Foody et al. 201022 Averna et al. 201021 Bays et al. 201123 Hing Ling et al. 201224 PHC PHC PHC HC PHC PHC HC, CHD PHC, CHD or AS HC HC, CHD HC PHC, CAD HC HC MS, HC HC HC HC, CHD HC PHC 12 w 12 w 12 w 6w 12 w 12 w 6w 6w 6w 6w 6w 6w 6w 6w 6w 6w 12 w 6w 6w 6w Hypertension S DM E+S S E+S S Dose (mg) num Dose (mg) num num num num num E10+A10,20,40,80 E10+P10,20,40 E10+L10,20,40 E + S10,20,40 E + S10,20,40,80 E + S10,20,40,80 E10+A10,20 E10+S20 E + S10,20,40,80 E + S10,20 E10+S20,40,80 E10+S20 E10+A20 E10+A40 E10+S20,S40 E10+S20 E10+S20,S40 E10+S20 E10+R5,R10 E10+S40 255 204 192 457 609 353 220 221 951 181 1474 74 98 288 457 314 516 60 221 120 A10,20,40,80 P10,20,40 L10,20,40 S20 S10,20,40,80 S10,20,40,80 A10,20 A20 A10,20,40,80 S10,20 R10,20,40 S20 A40 A80 A10,20,40 R10 A10,20,40 S40 R10,R20 A40 248 205 220 253 622 349 230 214 951 191 1477 70 98 291 686 304 773 60 219 130 85 66 53 NR NR NR 127 141 NR NR NR 29 89 266 NR 203 NR NR NR NR 80 64 64 NR NR NR 124 116 NR NR NR 30 87 273 NR 189 NR NR NR NR 17 11 12 NR NR NR 38 59 NR 22 NR 21 NR 155 236 95 NR 77 NR 42 11 14 19 NR NR NR 41 53 NR 37 NR 26 NR 153 381 78 NR 97 NR 45 num, number; PHC, primary hypercholesterolaemia; HC, hypercholesterolaemia; CHD, coronary heart disease; CAD, coronary artery disease; DM, diabetes mellitus; MS, metabolic syndrome; AS, atherosclerosis; E, ezetimibe; S, simvastatin; A, atorvastatin; R, rosuvastatin; L, lovastatin; P, pravastatin; F, fluvastatin; w, week; NR, not reported. 27.6% and 27.7%, respectively, which did not represent a significant difference (95% CI, 0.77–1.19; P = 0.69; I2 = 0%) (Fig. 4). In the subgroup analysis of simvastatin, four trials reported the occurrence of total adverse events during follow up. There were no treatment differences in the proportion of patients reporting total adverse events in both groups (95% CI, 0.65–1.10; P = 0.22; I2 = 0%) (Fig. 4). This lack of significance persisted in the subgroup analysis of other statins (95% CI, 0.85–1.13; P = 0.75; I2 = 27%) (Fig. 4). Total adverse events were generally similar between the treatments in both groups. Eighteen studies were assessed in terms of treatment discontinuation, 169 of 4818 patients (3.5%) discon- tinued treatment with ezetimibe and statins and 148 of 5142 patients (2.9%) discontinued statins alone. There was no significant difference between combination therapy and statin monotherapy (95% CI, 0. 92–1.44; P = 0.22; I2 = 0%), as shown in Figure 5. In a subgroup analysis of atorvastatin, discontinuation in the combination therapy and atorvastatin monotherapy arms was 2.2% and 2.6%, respectively. There was no significant difference in discontinuation between the groups (95% CI, 0. 45–1.43; P = 0.46; I2 = 0%) (Fig. 5). In the subgroup analysis of simvastatin, there were six trials that reported the proportion of patients with treatment discontinuation during follow up, although there was no significant Figure 2 Risk of bias of included studies. ( ), Low risk of bias; ( ), unclear risk of bias; ( ), high risk of bias. © 2015 Royal Australasian College of Physicians 548 Other bias Selective reporting (reporting bias) Incomplete outcome data (attrition bias) Blinding of outcome assessment (detection bias) Blinding of paticipants and personnel (performance bias) Allocation concealment (selection bias) Random sequence generation (selection bias) Safety of ezetimibe and statins Averna et al. 201021 Ballantyne et al. 20035 Ballantyne et al. 200511 Barrios et al. 200512 Bays et al. 20048 Bays et al. 201123 Catapano et al. 200615 Conard et al. 200816 Cruz-Fernandez et al. 200513 Farnier et al. 200514 Farnier et al. 200919 Feldman et al. 20049 Foody et al. 201022 Goldberg et al. 200410 Hing Ling et al. 201224 Kerzner et al. 20036 Leiter et al. 200817 Melanie et al. 20037 Robinson et al. 200920 Zubaid et al. 200818 Figure 3 Risk of bias of individual studies. Blank, not clear; red, high risk; green, low risk. difference when comparing combination therapy with simvastatin monotherapy (95% CI, 0. 81–1.58; P = 0.48; I2 = 0%) (Fig. 5). This lack of significance persisted in the subgroup analysis of other statins (95% CI, 0. 95–1.94; P = 0.10; I2 = 18%) (Fig. 5). Serious adverse events were reported in 13 studies, with 76 events occurring in 3997 patients (2%) treated with ezetimibe and statins, compared with 69 events in 4301 patients (1.6%) treated with statins alone. This end point was not higher with combination therapy compared with statin monotherapy (95% CI, 0.75 – 1.45; P = 0.81; I2 = 0%), as shown in Figure 6. In the subgroup analysis of atorvastatin, incidences of serious adverse events in the combination therapy and atorvastatin monotherapy arms were 2.1% and 1.5%, respectively, although this difference was not significant (95% CI, 0. 58–3.09; P = 0.49; I2 = 0%) (Fig. 6). In the subgroup analysis of simvastatin, five trials reported the proportion of patients with serious adverse events during follow up. Both treatments had similar tolerability and safety profiles (95% CI, 0.68–1.78; P = 0.7; I2 = 0%) (Fig. 6). Incidence of serious adverse events was generally similar between treatments in the subgroup analysis of other statins (95% CI, 0. 49–1.52; P = 0.60; I2 = 38%) (Fig. 6). Nine studies were assessed for gastrointestinal adverse events. A total of 123 events occurred in 2446 patients (5%) treated with ezetimibe and statins, compared with 122 events in 2957 patients (4%) treated with statins alone. There was no significant difference between combination therapy and statin monotherapy (95% CI, 0. 97–1.63; P = 0.08; I2 = 24%), as shown in Figure 7. In the subgroup analysis of atorvastatin, the incidences of gastrointestinal adverse events in the combination therapy and atorvastatin monotherapy arms were 4% and 5% respectively, which did not represent a significant difference (95% CI, 0.51–1.35; P = 0.46; I2 = 53%) (Fig. 7). In the subgroup analysis of other statins, there were five trials that reported the occurrence of gastrointestinal adverse events during follow up. Treatment with other statins alone was associated with a significant reduction in gastrointestinal adverse events compared with combination of ezetimibe and statins (95% CI, 1.10–2.02; P = 0.01; I2 = 0%) (Fig. 7). Six trials reported allergic reactions or rashes. Seventeen events occurred in 1903 patients (0.9%) treated with ezetimibe and statins, compared with 31 events in 2391 patients (1.3%) treated with statins alone. There was no significant difference between the groups (95% CI, 0.41–1.35; P = 0.33; I2 = 0%) (Fig. 8). CK >10 × ULN, was reported in 11 studies. Eleven events occurred in 5579 patients (0.2%) treated with ezetimibe and statins, compared with 10 events in 5850 patients © 2015 Royal Australasian College of Physicians 549 Luo et al. Figure 4 Forest plots to show the incidence of total adverse events. CI, confidence interval; OR, odds ratio. (0.2%) treated with statins alone. There was no significant difference between the groups (95% CI, 0.51–2.23; P = 0.86; I2 = 0%), as shown in Figure 9. In the subgroup analysis of atorvastatin, the incidence of CK >10 × ULN in the combination therapy and statin monotherapy arms was 0.3% in both. There was no significant difference between the groups (95% CI, 0.25–2.88; P = 0.79; I2 = 0%) (Fig. 9). Both treatments had generally similar tolerability and safety profiles in the subgroup analysis of other statins (95% CI, 0.48–3.06; P = 0.68; I2 = 0%) (Fig. 9). The incidence of ALT >3 × ULN was reported in 11 studies and did not reach statistical significance when compared between the combination therapy and statin monotherapy groups (95% CI, 0.58–1.77; P = 0.96; I2 = 0%) (Fig. 10). In the subgroup analysis of atorvastatin, 6 events occurred in 629 patients (1%) treated with ezetimibe and atorvastatin, and 4 in 625 patients (0.6%) treated with atorvastatin alone. There was no significant difference between the groups (95% CI, 0.42–5.33; P = 0.54; I2 = 0%) (Fig. 10). There were generally similar rates reported for the occurrence of ALT >3 ULN in the subgroup of other statins (95% CI, 0.49–1.72; P = 0.80; I2 = 28%) (Fig. 10). Seven trials reported the proportion of patients with AST >3 × ULN. A total of 17 events occurred in 3864 patients (0.4%) treated with ezetimibe and statins, © 2015 Royal Australasian College of Physicians 550 Safety of ezetimibe and statins Figure 5 Forest plots to show the incidence of treatment discontinuation. CI, confidence interval; OR, odds ratio. compared with 16 events in 4335 patients (0.4%) treated with statins alone. There was no significant difference between the groups (95% CI, 0.61–2.39; P = 0.58; I2 = 35%) (Fig. 11). Discussion Hypercholesterolaemia is one of the risk factors for atherosclerosis and has an indirect relationship with severe complications of atherosclerosis, such as transient ischaemic attacks, acute myocardial infarction and thrombotic stroke, which can have a poor prognosis. Elevated plasma LDL-C, especially, is a major risk factor in the development and prevention of atherosclerotic coronary heart disease and cerebrovascular disease.25 Reduction in LDL-C levels in individuals with preexisting coronary heart disease has been shown to reduce cardiovascular and cerebrovascular disease morbidity and total mortality.26–28 Statins have pleiotropic activities, including lowering cholesterol level and stabilising atherosclerotic plaques on the blood vessel walls, which can help to prevent © 2015 Royal Australasian College of Physicians 551 Luo et al. Figure 6 Forest plots to show the incidence of serious adverse events. CI, confidence interval; OR, odds ratio. ischaemic events.29 Statins have also made a major contribution to the treatment of hypercholesterolaemia and play a key role in comprehensive strategies for treating cardiovascular diseases in the 21st century. In addition, statins are the most commonly prescribed lipid-lowering drugs for patients with elevated plasma LDL-C and play a major part in the reduction of cardiovascular and cerebrovascular disease morbidity. Ezetimibe has been shown to be the first selective inhibitor of cholesterol absorption by reducing overall delivery to the liver, and the mean decrease in LDL-C with ezetimibe was 19.1% versus placebo. Phase III studies have shown a mean additional decrease of LDL-C (12.1–13.8%) and increase in high-density lipoprotein cholesterol (1.4–4.5%) with ezetimibe and various statins at increasing dosages (vs pooled statins).30 Coadministration of ezetimibe and statins results in greater reductions in LDL-C, which is similar to using the highest dose of statin monotherapy. Several studies have found that when the dosage of statin is doubled, the decrease in LDL-C increases by 5–6%, along with efficacy; patients’ perceived intolerance of statin therapy increases, which is often dose related and may include elevations in blood levels of liver or muscle enzymes.31 A previous meta-analysis found that intensive-dose statin therapy was associated with an increased risk of adverse drug events, compared with moderate dose therapy.32 Many patients at high risk for coronary heart disease and cerebrovascular disease fail to © 2015 Royal Australasian College of Physicians 552 Safety of ezetimibe and statins Figure 7 Forest plots to show the incidence of gastrointestinal adverse events. CI, confidence interval; OR, odds ratio. reach LDL-C targets with statin monotherapy, and several patients cannot tolerate high doses of statins, because of dose-related adverse events.33 In addition to efficacy, safety is an important issue influencing the selection of ezetimibe for combination with a statin. Ezetimibe and statins are associated with liver function test abnormalities and can cause rhabdomyolysis and myositis. Although the incidence of adverse effects was low, the elevation of liver enzymes was observed more frequency in ezetimibe–statin combination therapy than statin monotherapy in the overall population. These rates for statin monotherapy (0.4%) Figure 8 Forest plots to show the incidence of allergic reactions or rash. CI, confidence interval; OR, odds ratio. © 2015 Royal Australasian College of Physicians 553 Luo et al. Figure 9 Forest plots to show the number of patients with creatine kinase (CK) >10 × upper limit of normal (ULN). CI, confidence interval; OR, odds ratio. and ezetimibe-statin combination therapy (1.4%) were consistent with those reported in the prescribing information.34 Based on these studies, our meta-analysis clarifies the evidence for safety from RCT comparing ezetimibe– statin combination therapy with statin monotherapy. In our study, combination therapy and monotherapy generally had a similar incidence of total adverse events (30% vs 29%, P = 0.34), serious adverse events (2% vs 1.6%, P = 0.81), treatment discontinuations (3.5% vs 2.9%, P = 0.22), gastrointestinal adverse events (5% vs 4%, P = 0.08), allergic reactions or rashes (0.9% vs 1.3%, P = 0.33), CK >10 × ULN (0.2% vs 0.2%, P = 0.86), ALT >3 × ULN (0.5% vs 0.4%, P = 0.96) and AST >3 × ULN (0.4% vs 0.4%, P = 0.58). The incidence of adverse effects with coadministration of ezetimibe and statins did not differ significantly from those with statin monotherapy. Conclusion The present meta-analysis shows that ezetimibe–statin combination therapy is tolerated as well as statin monotherapy. Our meta-analysis shows that the addition of ezetimibe to statins is safe, and the safety profile is similar between coadministration and monotherapy. Combination therapy has greater efficacy through differing mechanisms of action, can lower doses of individual drugs and alleviate adverse effects generated with high doses of single agents. Thus, we recommend combination therapy for patients with hypercholesterolaemia at high risk for cardiovascular and cerebrovascular disease. Acknowledgement The authors express their gratitude to those who provided their time and assistance for this study. © 2015 Royal Australasian College of Physicians 554 Safety of ezetimibe and statins Figure 10 Forest plots to show the number of patients with alanine aminotransferase (ALT) >3 × upper limit of normal (ULN). CI, confidence interval; OR, odds ratio. Figure 11 Forest plots to show the number of patients with aspartate aminotransferase (AST) >3 × upper limit of normal (ULN). CI, confidence interval; OR, odds ratio. © 2015 Royal Australasian College of Physicians 555 Luo et al. References 1 Sirtori CR. The pharmacology of statins. Pharmacol Res 2014; 88: 3–10. 2 Jeu L, Cheng JW. Pharmacology and therapeutics of ezetimibe (SCH 58235), a cholesterol-absorption inhibitor. Clin Ther 2003; 25: 2352–87. 3 Stein EA. An investigative look: selective cholesterol absorption inhibitors – embarking on a new standard of care. Am J Manag Care 2002; 8: S36–9, discussion S45–37. 4 Third Report of the National Cholesterol Education Program (NCEP). Expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (Adult Treatment Panel III) final report. Circulation 2002; 106: 3143–421. 5 Ballantyne CM, Houri J, Notarbartolo A, Melani L, Lipka LJ, Suresh R et al. Effect of ezetimibe coadministered with atorvastatin in 628 patients with primary hypercholesterolemia: a prospective, randomized, double-blind trial. Circulation 2003; 107: 2409–15. 6 Kerzner B, Corbelli J, Sharp S, Lipka LJ, Melani L, LeBeaut A et al. Efficacy and safety of ezetimibe coadministered with lovastatin in primary hypercholesterolemia. Am J Cardiol 2003; 91: 418–24. 7 Melani L, Mills R, Hassman D, Lipetz R, Lipka L, LeBeaut A et al. Efficacy and safety of ezetimibe coadministered with pravastatin in patients with primary hypercholesterolemia: a prospective, randomized, double-blind trial. Eur Heart J 2003; 24: 717–28. 8 Bays HE, Ose L, Fraser N, Tribble DL, Quinto K, Reyes R et al. A multicenter, randomized, double-blind, placebo-controlled, factorial design study to evaluate the lipid-altering efficacy and safety profile of the ezetimibe/simvastatin tablet compared with ezetimibe and simvastatin monotherapy in patients with primary hypercholesterolemia. Clin Ther 2004; 26: 1758–73. 9 Feldman T, Koren M, Insull W, McKenney J, Schrott H, Lewin A et al. Treatment of high-risk patients with ezetimibe plus simvastatin co-administration versus simvastatin alone to attain National Cholesterol Education Program Adult Treatment Panel III low-density lipoprotein cholesterol goals. Am J Cardiol 2004; 93: 1481–6. 10 Goldberg AC, Sapre A, Liu J, Capece R, Mitchel YB. Efficacy and safety of ezetimibe coadministered with simvastatin in patients with primary hypercholesterolemia: a randomized, double-blind, placebo-controlled trial. Mayo Clin Proc 2004; 79: 620–9. 11 Ballantyne CM, Abate N, Yuan Z, King TR, Palmisano J. Dose-comparison study of the combination of ezetimibe and simvastatin (Vytorin) versus atorvastatin in patients with hypercholesterolemia: the Vytorin Versus Atorvastatin (VYVA) study. Am Heart J 2005; 149: 464–73. 12 Barrios V, Amabile N, Paganelli F, Chen JW, Allen C, Johnson-Levonas AO et al. Lipid-altering efficacy of switching from atorvastatin 10 mg/day to ezetimibe/simvastatin 10/20 mg/day compared to doubling the dose of atorvastatin in hypercholesterolaemic patients with atherosclerosis or coronary heart disease. Int J Clin Pract 2005; 59: 1377–86. 13 Cruz-Fernandez JM, Bedarida GV, Adgey J, Allen C, Johnson-Levonas AO, Massaad R et al. Efficacy and safety of ezetimibe co-administered with ongoing atorvastatin therapy in achieving low-density lipoprotein goal in patients with hypercholesterolemia and coronary heart disease. Int J Clin Pract 2005; 59: 619–27. 14 Farnier M, Volpe M, Massaad R, Davies MJ, Allen C. Effect of co-administering ezetimibe with on-going simvastatin treatment on LDL-C goal attainment in hypercholesterolemic patients with coronary heart disease. Int J Cardiol 2005; 102: 327–32. 15 Catapano AL, Davidson MH, Ballantyne CM, Brady WE, Gazzara RA, Tomassini JE et al. Lipid-altering efficacy of the ezetimibe/simvastatin single tablet versus rosuvastatin in hypercholesterolemic patients. Curr Med Res Opin 2006; 22: 2041–53. 16 Conard SE, Bays HE, Leiter LA, Bird SR, Rubino J, Lowe RS et al. Efficacy and safety of ezetimibe added on to atorvastatin (20 mg) versus uptitration of atorvastatin (to 40 mg) in hypercholesterolemic patients at moderately high risk for coronary heart disease. Am J Cardiol 2008; 102: 1489–94. 17 Leiter LA, Bays H, Conard S, Bird S, Rubino J, Hanson ME et al. Efficacy and safety of ezetimibe added on to atorvastatin (40 mg) compared with 18 19 20 21 22 23 24 uptitration of atorvastatin (to 80 mg) in hypercholesterolemic patients at high risk of coronary heart disease. Am J Cardiol 2008; 102: 1495–501. Zubaid M, Shakir DK, Bazargani N, Binbrek A, Gopal R, Al-Tamimi O et al. Effect of ezetimibe coadministration with simvastatin in a Middle Eastern population: a prospective, multicentre, randomized, double-blind, placebo-controlled trial. J Cardiovasc Med (Hagerstown) 2008; 9: 688–93. Farnier M, Averna M, Missault L, Vaverkova H, Viigimaa M, Massaad R et al. Lipid-altering efficacy of ezetimibe/simvastatin 10/20 mg compared with rosuvastatin 10 mg in high-risk hypercholesterolaemic patients inadequately controlled with prior statin monotherapy – The IN-CROSS study. Int J Clin Pract 2009; 63: 547–59. Robinson JG, Ballantyne CM, Grundy SM, Hsueh WA, Parving HH, Rosen JB et al. Lipid-altering efficacy and safety of ezetimibe/simvastatin versus atorvastatin in patients with hypercholesterolemia and the metabolic syndrome (from the VYMET study). Am J Cardiol 2009; 103: 1694–702. Averna M, Zaninelli A, Le Grazie C, Gensini GF. Ezetimibe/simvastatin 10/20 mg versus simvastatin 40 mg in coronary heart disease patients. J Clin Lipidol 2010; 4: 272–8. Foody JM, Brown WV, Zieve F, Adewale AJ, Flaim D, Lowe RS et al. Safety and efficacy of ezetimibe/simvastatin combination versus atorvastatin alone in adults >/=65 years of age with hypercholesterolemia and with or at moderately high/high risk for coronary heart disease (the VYTELD study). Am J Cardiol 2010; 106: 1255–63. Bays HE, Davidson MH, Massaad R, Flaim D, Lowe RS, Tershakovec AM et al. Safety and efficacy of ezetimibe added on to rosuvastatin 5 or 10 mg versus up-titration of rosuvastatin in patients with hypercholesterolemia (the ACTE Study). Am J Cardiol 2011; 108: 523–30. Hing Ling PK, Civeira F, Dan AG, Hanson ME, Massaad R, De Tilleghem Cle B et al. Ezetimibe/simvastatin 10/40 mg versus atorvastatin 40 mg in high cardiovascular risk patients with primary hypercholesterolemia: a randomized, double-blind, active-controlled, © 2015 Royal Australasian College of Physicians 556 Safety of ezetimibe and statins multicenter study. Lipids Health Dis 2012; 11: 18–25. 25 LaRosa JC. Low-density lipoprotein cholesterol reduction: the end is more important than the means. Am J Cardiol 2007; 100: 240–2. 26 Pedersen TR, Kjekshus J, Berg K, Haghfelt T, Faergeman O, Faergeman G et al. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). 1994. Atheroscler Suppl 2004; 5: 81–7. 27 Heart Protection Study Collaborative Group. MRC/BHF Heart Protection Study of cholesterol lowering with simvastatin in 20 536 high-risk individuals: a randomised placebo-controlled trial. Lancet 2002; 360: 7–22. 28 Shepherd J. Preventing coronary artery disease in the West of Scotland: implications for primary prevention. Am J Cardiol 1998; 82: 57T–59T. 29 Morishita R, Tomita N, Ogihara T. HMG-Co A reductase inhibitors in the treatment of cardiovascular diseases: stabilization of coronary artery plaque. Curr Drug Targets 2002; 3: 379–85. 30 Tellier P. Ezetimibe: from pharmacology to clinical trials. Ann Endocrinol (Paris) 2003; 64: 442–7. 31 Bays H, Dujovne C. Colesevelam HCl: a non-systemic lipid-altering drug. Expert Opin Pharmacother 2003; 4: 779–90. 32 Silva M, Matthews ML, Jarvis C, Nolan NM, Belliveau P, Malloy M et al. Meta-analysis of drug-induced adverse events associated with intensive-dose statin therapy. Clin Ther 2007; 29: 253–60. 33 Daskalopoulou SS, Mikhailidis DP. Reaching goal in hypercholesterolaemia: dual inhibition of cholesterol synthesis and absorption with simvastatin plus ezetimibe. Curr Med Res Opin 2006; 22: 511–28. 34 Davidson MH, Ballantyne CM, Kerzner B, Melani L, Sager PT, Lipka L et al. Efficacy and safety of ezetimibe coadministered with statins: randomised, placebo-controlled, blinded experience in 2382 patients with primary hypercholesterolemia. Int J Clin Pract 2004; 58: 746–55. Crescentic glomerulonephritis: data from the Spanish Glomerulonephritis Registry B. Quiroga,1 A. Vega,1 F. Rivera2 and J. M. López-Gómez,1 on behalf of all members of the Spanish Registry of Glomerulonephritis 1 Hospital Gregorio Marañón, Madrid and 2Hospital General de Ciudad Real, Ciudad Real, Spain Key words age, crescentic glomerulonephritis, Goodpasture, vasculitis, registry. Correspondence Borja Quiroga, Hospital Gregorio Marañón, C/Doctor Esquerdo 46, Madrid, 28007, Spain. Email: [email protected] Received 17 November 2014; accepted 1 February 2015. doi:10.1111/imj.12725 Abstract Background: Crescentic glomerulonephritis (CGN) is a histological finding that implies rapid deterioration of renal function and can be related to different diseases, such as type 1 or anti-glomerular basement membrane antibody (Goodpasture) disease, type 2 or immune complex CGN and type 3 or pauci-immune disease. Aim: The present study describes CGN and its characteristics based on the data from the Spanish Glomerulonephritis Registry. Methods: An analysis was made of all native renal biopsies obtained from patients during 1994–2013 and classified as CGN. A patient epidemiological and clinical data questionnaire was completed by the 120 centres involved. Results: A total of 21 774 biopsies was performed, of which 2089 (8.1%) corresponded to CGN (211 type 1, 177 type 2 and 1701 type 3). Renal function was poorer in type 1 compared with types 2 and 3, and proteinuria was higher in type 2 compared to types 1 and 3. Patients diagnosed with CGN type 3 were older than those with types 1 and 2, but less hypertensive than the type 2 patients. No differences in the urine test findings were found between types 1 and 2. Microhaematuria was the most frequent feature in general, as well as in type 3 compared with types 1 and 2. The main indication for biopsy was acute renal injury. Age was the only difference between type 1 patients with and without alveolar haemorrhage (53 [33–67] vs 64 [46–73], P = 0.008). Conclusion: Although classified as the same entity, the different types of CGN have different features that must be taken into account. © 2015 Royal Australasian College of Physicians 557 Quiroga et al. Introduction Crescentic glomerulonephritis (CGN) is defined by the presence of more than 50% of glomerular crescents in a renal biopsy. These histological findings imply rapid deterioration of renal function, but can be related to different diseases with different clinical, diagnostic, treatment and prognostic features.1 There are three main types of CGN: type 1 or anti-glomerular basement membrane (GBM) antibody (Goodpasture) disease; type 2 or immune complex CGN; and type 3 or pauci-immune disease.2 Recently, a double-antibody positive disease has been accepted as CGN type 4. The disease typically manifests as impaired renal function, proteinuria (usually <3 g/day) and haematuria. Types 1 and 3 usually also show systemic symptoms.3,4 Although included within the same type of glomerulonephritis (GN), CGN is not a specific disease and can be caused by different mechanisms. Furthermore, the differences among them have not been fully described.5 At present, immunological tests, including anti-neutrophil cytoplasmic antibodies (ANCA) and anti-GBM antibodies, can help clinicians to assess patient diagnosis, relapse and treatment response. Renal biopsies are the gold standard for diagnosing kidney diseases. Histopathological data give nephrologists important information regarding not only the diagnosis but also the prognosis, with a view to making appropriate management decisions. CGN and its pathological features are very important for establishing proper management, because treatment includes aggressive drugs, such as immunosuppressive agents. In the early stages, inflammatory cells and the expression of cytokines (interleukin-1 and tumour necrosis factor alpha) are the main findings. Based on the natural history of the disease, the next step is the formation of glomerular crescents that are firstly epithelial and lead to fibrosis and irreversible renal failure.6,7 The presence of crescents in a biopsy usually implies rapid progression of the disease and also the need to decide treatment.8 Only if irreversible changes are found in the biopsy (e.g. fibrosis) should non-aggressive immunosuppressive therapy be chosen. Medical registries and networks are useful tools for describing diseases, due to the large number of centres involved and the important size of the samples. Studies of diseases that are not particularly frequent, such as GN, stand to benefit most from such registries.9 The United States, Brazil, Europe (Spain, Italy, the Czech Republic, France and Hungary) and Asia have their own biopsy registries.10–12 The Spanish Glomerulonephritis Registry has been collecting data in this regard since 1994, and now Funding: None. Conflict of interest: None. has registered over 20 000 biopsies.13–15 Thanks to the large records of biopsies, we now know that the natural history of GN exhibits a changing pattern. Immunosuppressive drugs are improving, and histological techniques supported by serum tests yield prompt results, thereby allowing treatments to be started earlier. Descriptions of these changes and the evaluation of correlations between clinical data and histological patterns are essential in order to improve outcomes in serious diseases, such as GN. Aims Based on the data of the Spanish Glomerulonephritis Registry covering the period between 1994 and 2013, the present study describes and analyses the different types on CGN, including their incidence, epidemiological data, clinical manifestations and laboratory features. Methods We analysed all native renal biopsies obtained from patients classified as corresponding to CGN and included in the Spanish Glomerulonephritis Registry between 1994 and 2013, together with the corresponding clinical indications. Each sample was analysed by pathologists from the 120 participating hospitals using specific techniques, mainly light microscopy and direct immunofluorescence (IgG, IgA, IgM, C3, C1q, fibrinogen and lightchain antibodies). For sending the biopsies to the registry (through www.senefro.org, official webpage of the Spanish Society of Nephrology) a questionnaire (available only in Spanish) was sent by the participant centres (including year, hospital, name of the sender, age of the patient, gender, renal function (serum creatinine, estimated glomerular filtration rate, proteinuria, description of the sediment), main syndrome of the patient, history of hypertension and data regarding the biopsy (number of glomeruli and main diagnosis). The registry only included the main diagnosis, so superimposed syndromes could not be identified. Also, in the registry the diagnosis was codified, but we do not have access to the pathological description. A questionnaire on the patient epidemiological and clinical data was completed. The following definitions were established: (i) acute renal injury: rapid deterioration of the glomerular filtration rate (GFR), with or without oligoanuria or rapidly progressive renal failure, including a worsening of chronic kidney disease, (ii) nephrotic syndrome: proteinuria >3.5 g/day/1.73 m2 and serum albumin <2.5 g/dL, (iii) acute nephritic syndrome, oliguric acute renal injury with oedema, haematuria and hypertension, (iv) asymptomatic urinary abnormalities: proteinuria <3.5 g/day and/or haematuria with more © 2015 Royal Australasian College of Physicians 558 Crescentic glomerulonephritis in Spain Table 1 Baseline characteristics Age (years) Gender (% males) Hypertension (%) Creatinine (mg/dL) 24-h creatinine clearance (mL/min) Proteinuria (g/day) Glomeruli (number) Total (n = 2089) CGN 1 (n = 211) CGN 2 (n = 177) CGN 3 (n = 1701) P CGN 1 vs 2 P CGN 1 vs 3 P CGN 2 vs 3 66 (52–73) 57.3 54.0 4.1 (2.5–6.9) 15 (8–30) 58 (39–71) 60.2 55.2 6.9 (3.9–10) 10 (5–20) 60 (41–72) 64.4 65.7 4.8 (3.0–7.5) 15 (7–24) 66 (55–74) 56.1 52.6 3.9 (2.3–6.2) 17 (9–32) NS NS 0.059 <0.001 0.029 <0.001 NS NS <0.001 <0.001 <0.001 0.054 0.003 0.001 0.034 1.7 (0.9–3.3) 13 (9–20) 2.0 (0.7–4.0) 13 (8–20) 3.0 (1.7–5.4) 13 (9–20) 1.6 (0.8–3.0) 14 (9–20) 0.001 0.067 <0.001 CGN, crescentic glomerulonephritis; NS, non-significant. than three red blood cells per field, in the absence of clinical manifestations, (v) arterial hypertension: blood pressure >140/90 mmHg or antihypertensive treatment irrespective of blood pressure and (vi) chronic kidney disease: persistent serum creatinine >1.5 mg/dL. The questionnaire was applied to obtain the following information: identification code, date of birth, gender, hospital, presence of hypertension and/or antihypertensive treatment, serum creatinine (mg/dL), 24-h urine creatinine clearance (mL/min), proteinuria (g/day) and urinary sediment. We also noted the main renal syndrome, the histological methods applied to the sample and the number of glomeruli obtained. CGN was defined as the presence of crescents in >50% of the glomeruli, and was classified as follows: • Type 1: accompanied by anti-glomerular basal membrane antibodies, with or without alveolar haemorrhage. • Type 2: presence of immune complexes. • Type 3: necrotising GN with or without ANCA or systemic vasculitis symptoms. As this registry exists from 1994, and no changes in definitions have been performed to avoid confusion in data, some of them are outdated. The cut-off of 50% of crescent formation for achieving the definition was due to definition of the entity in 1994.16,17 No data regarding the type of crescent are available in this registry. SPSS version 16.0 statistical package for Microsoft Windows (SPSS, Chicago, IL, USA). Statistical significance was considered for P < 0.05. Results Baseline characteristics are shown in Table 1. The frequencies of each type of CGN and the overall percentages divided into five periods of 4 years each are shown in Figure 1. Taking into account all the renal biopsies performed (n = 21 774), 8.1% (n = 2089) corresponded to CGN; 0.8% (n = 211) corresponded to type 1, 0.7% (n = 177) to type 2, and 6.5% (n = 1701) to type 3. CGN type 1 was characterised by poorer renal function than types 2 and 3. Proteinuria was higher in CGN type 2 than in types 1 and 3. In turn, patients diagnosed with CGN type 3 were older than those with types 1 and 2 disease, but less hypertensive than patients with CGN type 2. The urine test results are shown in Table 2. The most frequent characteristic in all types of CGN was microhaematuria. We found no significant differences Statistical analysis The data were entered in a Microsoft Access database. Values are expressed as the mean (SD) or median (interquartile range). The normal distribution of the samples was determined using the Kolmogorov–Smirnov test. Categorical data were compared using the chisquared test or the Fisher’s exact test, while continuous variables were compared using the Student t-test or Mann–Whitney U-test. Analysis of variance was used when several parameters of the two groups were compared. Statistical analysis was performed using the Figure 1 Evolution of the incidence of crescentic glomerulonephritis (CGN). © 2015 Royal Australasian College of Physicians 559 Quiroga et al. Table 2 Urine test findings at diagnosis Gross haematuria Microhaematuria Leukocyturia Cylindruria Telescoped sediment Normal Total (n = 2089) CGN 1 (n = 211) CGN 2 (n = 177) CGN 3 (n = 1701) P CGN 1 vs 2 P CGN 1 vs 3 P CGN 2 vs 3 334 (16%) 1170 (56%) 23 (1.1%) 23 (1.1%) 310 (14.8%) 65 (3.1%) 47 (26.3%) 83 (46.4%) 0 (0%) 3 (1.7%) 23 (12.8%) 4 (2.2%) 34 (22.5%) 71 (47%) 0 (0%) 1 (0.7%) 32 (21.2%) 4 (2.2%) 211 (14.6%) 826 (57.2%) 20 (1.4%) 12 (0.8%) 219 (15.2%) 45 (3.1%) NS NS NS NS 0.054 NS <0.001 0.006 NS NS NS NS 0.010 0.016 NS NS 0.054 NS CGN, crescentic glomerulonephritis; NS, non-significant. between CGN types 1 and 2. At diagnosis, CGN type 3 had less gross haematuria, but microhaematuria was more frequent than in the other two types. Clinical features are shown in Table 3. The main indication of biopsy was acute renal injury, followed by nephritic syndrome. At diagnosis, hypertension was more frequent as the indication of biopsy in CGN type 3 in comparison to types 1 and 2. Also, chronic kidney disease was a more frequent indication of biopsy in CGN type 3 than in type 1 disease. A comparison between Goodpasture syndrome with and without alveolar haemorrhage (Table 4) only identified differences in age (older patients presenting less alveolar haemorrhage) (P = 0.008). The results among the elderly patients were analysed, stratifying age into three groups (<65 years, 65–75 years and >75 years). We found 61.7% of the patients diagnosed with CGN type 1 to be under 65 years of age; 22.9% were between 65–75 years of age, and 7.3% were over 75 years of age. In patients with CGN type 2, 62.8% were under 65 years of age, 21.6% were between 65–75 years of age and 15.5% over 75 years of age. Lastly, among the patients who developed CGN type 3, 44.6% were under 65 years of age, 32.7% were between 65–75 years of age, and 22.6% were over 75 years of age. The differences in the distribution were statistically significant when comparing CGN type 3 with types 1 and 2 (P < 0.0001 for both). Discussion Considering the large number of biopsies included in our study, this is the largest series of CGN published to date. A total of 8.1% of the biopsies included in the Spanish Glomerulonephritis Registry corresponded to CGN. Of these cases, 10% corresponded to CGN type 1, 8% to type 2 and 81% to type 3. Considering a minimum of 10 glomeruli as adequate to the effects of diagnosis, our series presented a median of 13 (all biopsies included).18 In coincidence with previous studies,19 patients developing CGN types 1 and 2 were younger, with a median age of 58 and 60 years, respectively, when compared with type 3 (66 years). On analysing the patients stratified by age, and focusing on the elderly, we found that patients over 75 years of age developed CGN type 3 more often than the other groups. We recently published data regarding the elderly (>75 years of age), showing a higher prevalence of CGN type 3 in comparison to types 1 and 2.18 No gender differences were found between groups (56.1–64.4% were males), though males tended to be less frequent in CGN type 3.20 Since the introduction of laboratory tests to assess ANCA/anti-GBM antibodies, biopsies for establishing a diagnosis have decreased in number. In this context, biopsies are presently more relevant for defining a prognosis, quantifying epithelial and fibrotic crescents to decide whether to continue with immunosuppression Table 3 Clinical features at diagnosis Nephrotic syndrome Nephritic syndrome Hypertension Asymptomatic urinary abnormalities Acute renal failure Chronic kidney disease Others Unknown Total (n = 2089) CGN 1 (n = 211) CGN 2 (n = 177) CGN 3 (n = 1701) P CGN 1 vs 2 P CGN 1 vs 3 P CGN 2 vs 3 144 (6.9%) 346 (16.6%) 146 (7%) 3 (0.1%) 12 (6.7%) 34 (19%) 3 (1.7%) 0 (0%) 15 (9.9%) 29 (19.2%) 6 (4.0%) 0 (0%) 85 (5.9%) 232 (16.1%) 128 (8.9%) 3 (0.2%) NS NS NS NS NS NS <0.001 NS 0.051 NS 0.039 NS 112 (62.6%) 3 (1.7%) 3 (1.7%) 2 (1.1%) 84 (55.6%) 9 (6.0%) 2 (1.3%) 1 (0.7%) 820 (56.8%) 97 (6.7%) 11 (0.8%) 6 (0.4%) NS 0.072 NS NS NS <0.001 NS NS NS NS NS NS 1211 (58%) 126 (6%) 26 (1.2%) 87 (4.2%) CGN, crescentic glomerulonephritis; NS, non-significant. © 2015 Royal Australasian College of Physicians 560 Crescentic glomerulonephritis in Spain Table 4 Comparison between Goodpasture syndrome with and without alveolar haemorrhage Age (years) Gender (male) Hypertension (presence) Creatinine (mg/dL) 24-h creatinine clearance (mL/min) Proteinuria (g/day) Urine test findings Gross haematuria Microhaematuria Leukocyturia Cylindruria Telescoped sediment Normal Clinical features Nephrotic syndrome Nephritic syndrome Hypertension Asymptomatic urinary abnormalities Acute renal failure Chronic kidney disease Others With alveolar haemorrhage (n = 92) Without alveolar haemorrhage (n = 87) P 53 (33–67) 55 (64.7%) 41 (51.3%) 7 (3.5–9.9) 10 (5–19.5) 2.1 (0.7–4.5) 64 (46–73) 51 (56%) 50 (58.8%) 6.8 (4.6–10) 9 (5–23) 2.0 (0.7–4.0) 0.008 NS NS NS NS NS NS 22 (28.6%) 39 (50.6%) 0 1 (1.2%) 12 (15.5%) 2 (2.6%) 25 (30.1%) 44 (53%) 0 1 (1.2%) 11 (13.3%) 2 (2.4%) 6 (7.1%) 15 (17.6%) 2 (2.4%) 0 58 (68.2%) 0 4 (4.7%) 6 (7.1%) 19 (22.6%) 1 (1.2%) 0 54 (64.3%) 3 (3.6%) 1 (1.2%) NS NS, non-significant. therapy or to prescribe more conservative treatment.21 However, while the mentioned immune tests yield high (99%) positive predictive values, the negative predictive values are only in the order of 80% (and even lower in older patients). A renal biopsy is therefore mandatory if CGN is suspected.1 CGN is one of the leading histopathologically diagnosed aetiologies underlying acute or rapidly progressive renal injury.22 The indication of a renal biopsy for this reason was registered in 58% of the cases, followed by nephritic and nephrotic syndrome (16.6% and 6.9% respectively). Interestingly, as shown in Table 3, hypertension accounted for 8.9% of the indications of biopsy in CGN type 3, showing significant differences with respect to types 1 and 2. Hypertension usually precedes flare-up or relapse in ANCA-associated vasculitis, and renal biopsy may be useful for diagnosing and starting treatment before renal injury has developed.19 Chronic kidney disease accounted for 6% and 6.7% of the indications in CGN types 2 and 3 versus only 1% in CGN type 1 – thus showing that this disorder usually debuts more aggressively than the other two types. This condition is confirmed by the fact that renal function is poorer in type 1 than in types 2 and 3, as a consequence of the higher frequency of crescent formation at the time of diagnosis.19 The strongest predictor for renal and survival outcomes in CGN is renal function at the time of diagnosis, which is correlated to the histological findings.23,24 Probably, as a result of the introduction of serum tests, renal function at debut or onset has improved when compared with previous reports.1,19 Important deterioration of renal function can lead to low levels of proteinuria, and this is probably the main reason for finding of sub-nephrotic protein excretion in CGN.25 Our results indicate a median proteinuria of 1.7 g/ day, with higher protein urinary excretion in CGN type 2 (median 3.0 g/day) compared with the other disease types. Haematuria is a constant finding in all types of CGN16 and also in our series, with 85% of the patients presenting gross haematuria, microhaematuria or telescoped sediment. However, the kind of haematuria differs between groups. In this sense, microhaematuria appears frequently in CGN type 3, unlike gross haematuria, which is more often seen in types 1 and 2. As observed in other series, anti-GBM antibody disease could be associated with pulmonary bleeding in one-half of all cases.5,17 The presence of lung bleeding was more common in young patients, as published elsewhere; however, no differences were observed in terms of gender, clinical features, urine test findings or renal function.17,25 Our study has a series of limitations. First, biopsy complications were not recorded. Second, no data were collected on more complex analytical parameters, such as autoimmunity and the presence of ANCAs. Lastly, the clinical questionnaire accompanying each renal biopsy © 2015 Royal Australasian College of Physicians 561 Quiroga et al. did not include treatment or patient outcome. CGN type 4 is not included in the registry, since it dates from 1994. presentation, renal function, degree of proteinuria and the urine test characteristics differ. Conclusion Acknowledgements Although the three types of CGN are usually classified as the same entity, some features, such as patient age at The authors thank the participating hospitals for submitting the results of their renal biopsies. References 1 Kambham N. Crescentic Glomerulonephritis: an update on pauci-immune and anti-GBM diseases. Adv Anat Pathol 2012; 19: 111–24. 2 Seo P, Stone JH. The antineutrophil cytoplasmic antibody-associated vasculitides. Am J Med 2004; 117: 39–50. 3 Hauer HA, Bajema IM, van Houwelingen HC, Ferrario F, Noël LH, Waldherr R et al. Renal histology in ANCA-associated vasculitis: differences between diagnostic and serologic subgroups. Kidney Int 2002; 61: 80–9. 4 Haas M, Eustace JA. Immune complex deposits in ANCA-associated crescentic glomerulonephritis: a study of 126 cases. Kidney Int 2004; 65: 2145–52. 5 Jennette JC, Thomas DB. Crescentic glomerulonephritis. Nephrol Dial Transplant 2001; 16(Suppl 6): 80–2. 6 Tarzi RM, Cook HT, Pusey CD. Crescentic glomerulonephritis: new aspects of pathogenesis. Semin Nephrol 2011; 31: 361–8. 7 Atkins RC, Nikolic-Paterson DJ, Song Q, Lan HY. Modulators of crescentic glomerulonephritis. J Am Soc Nephrol 1996; 7: 2271–8. 8 Singh SK, Jeansson M, Quaggin SE. New insights into the pathogenesis of cellular crescents. Curr Opin Nephrol Hypertens 2011; 20: 258–62. 9 Pesce F, Schena FP. Worldwide distribution of glomerular diseases: the role of renal biopsy registries. Nephrol Dial Transplant 2010; 25: 334–6. 10 Rychlík I, Jancová E, Tesar V, Kolsky A, Lácha J, Stejskal J et al. The Czech 11 12 13 14 15 16 17 registry of renal biopsies. Occurrence of renal diseases in the years 1994–2000. Nephrol Dial Transplant 2004; 19: 3040–9. Schena FP. Survey of the Italian Registry of Renal Biopsies. Frequency of the renal diseases for 7 consecutive years. The Italian Group of Renal Immunopathology. Nephrol Dial Transplant 1997; 12: 418–26. Simon P, Ramee MP, Boulahrouz R, Stanescu C, Charasse C, Ang KS et al. Epidemiologic data of primary glomerular diseases in western France. Kidney Int 2004; 66: 905–8. López-Gómez JM, Rivera F, on behalf of Spanish Registry of Glomerulonephritis. Renal biopsy findings in acute renal failure in the cohort of patients in the Spanish Registry of Glomerulonephritis. Clin J Am Soc Nephrol 2008; 3: 674–81. Goicoechea M, Rivera F, López-Gómez JM, Spanish Registry of Glomerulonephritis. Increased prevalence of acute tubulointerstitial nephritis. Nephrol Dial Transplant 2013; 28: 112–15. Verde E, Quiroga B, Rivera F, López-Gómez JM. Renal biopsy in very elderly patients: data from the Spanish Registry of Glomerulonephritis. Am J Nephrol 2012; 35: 230–7. Bruns FJ, Adler S, Fraley DS, Segel DP. Long-term follow-up of aggressively treated idiopathic rapidly progressive glomerulonephritis. Am J Med 1989; 86: 400–6. Wilson CB, Dixon FJ. Anti-glomerular basement membrane antibody-induced glomerulonephritis. Kidney Int 1973; 3: 74–89. 18 Berden AE, Ferrario F, Hagen EC, Jayne DR, Jennette JC, Joh K et al. Histopathologic classification of ANCA-associated glomerulonephritis. J Am Soc Nephrol 2010; 21: 1628–36. 19 Robson J, Doll H, Suppiah R, Flossmann O, Harper L, Höglund P et al. Damage in the anca-associated vasculitides: long-term data from the European Vasculitis Study group (EUVAS) therapeutic trials. Ann Rheum Dis 2013. doi:10.1136/annrheumdis -2013-203927 20 Jennette JC, Falk RJ. Small-vessel vasculitis. N Engl J Med 1997; 337: 1512–23. 21 Lee RW, D’Cruz DP. Pulmonary renal vasculitis syndromes. Autoimmun Rev 2010; 9: 657–60. 22 Jennette JC. Rapidly progressive crescentic glomerulonephritis. Kidney Int 2003; 63: 1164–77. 23 Levy JB, Turner AN, Rees AJ, Pusey CD. Long-term outcome of anti-glomerular basement membrane antibody disease treated with plasma exchange and immunosuppression. Ann Intern Med 2001; 134: 1033–42. 24 Hogan SL, Nachman PH, Wilkman AS, Jennette JC, Falk RJ. Prognostic markers in patients with antineutrophil cytoplasmic autoantibody-associated microscopic polyangiitis and glomerulonephritis. J Am Soc Nephrol 1996; 7: 23–32. 25 Floege J, Johnson RJ, Feehally J. Comprehensive Clinical Nephrology, 4rd. St Louis, Missouri: Saunders Elsevier; 2010. © 2015 Royal Australasian College of Physicians 562 Internal Medicine Journal 45 (2015) P O S I T I O N PA P E R Consensus guidelines for the investigation and management of encephalitis in adults and children in Australia and New Zealand P. N. Britton,1,2 K. Eastwood,3,4 B. Paterson,4 D. N. Durrheim,4 R. C. Dale,1,5 A. C. Cheng,6,7 C. Kenedi,8,9,10 B. J. Brew,11,12 J. Burrow,13 Y. Nagree,14,15 P. Leman,14,16 D. W. Smith,14 K. Read,17 R. Booy1,2,18 and C. A. Jones,1,2 on behalf of the Australasian Society of Infectious Diseases (ASID), Australasian College of Emergency Medicine (ACEM), Australian and New Zealand Association of Neurologists (ANZAN) and the Public Health Association of Australia (PHAA) 1 Discipline of Paediatrics and Child Health and Marie Bashir Institute for Emerging Infectious Diseases and Biosecurity, Sydney Medical School, University of Sydney, Departments of 2Infectious Diseases and Microbiology and 5Neurology, and 18National Centre for Immunisation Research and Surveillance, The Children’s Hospital at Westmead, 11St Vincent’s Centre for applied medical research, University of New South Wales, 12Department of Neurology, St Vincent’s Hospital, Sydney, 3Health Protection, Hunter New England Population Health, 4Biopreparedness, Hunter Medical Research Institute, Newcastle, New South Wales, 6Department of Infectious Diseases, The Alfred Hospital, 7Department of Epidemiology and Preventive Medicine, Monash University, Melbourne, Victoria, 13Department of Neurology, Royal Darwin Hospital, Darwin, Northern Territory, 14Faculty of Medicine, Dentistry and Health Sciences, University of Western Australia, 16Emergency Department, Royal Perth Hospital, Perth, 15Emergency Department, Fremantle Hospital, Fremantle, Western Australia, Australia; Departments of 8General Medicine and 9Liaison Psychiatry, Auckland City Hospital, 17Department of Infectious Diseases, North Shore Hospital, Auckland, New Zealand; and 10Department of Medicine and Department of Psychiatry, Duke University Medical Center, Durham, North Carolina, USA Key words encephalitis, guideline, Australia, New Zealand. Correspondence Cheryl Jones, Discipline of Paediatrics and Child Health, Sydney Medical School, C/o The Children’s Hospital at Westmead, Locked Bag 4001, Westmead, NSW 2145, Australia. Email: [email protected] Received 2 November 2014; accepted 17 February 2015. doi:10.1111/imj.12749 Abstract Encephalitis is a complex neurological syndrome caused by inflammation of the brain parenchyma. The management of encephalitis is challenging because: the differential diagnosis of encephalopathy is broad; there is often rapid disease progression; it often requires intensive supportive management; and there are many aetiologic agents for which there is no definitive treatment. Patients with possible meningoencephalitis are often encountered in the emergency care environment where clinicians must consider differential diagnoses, perform appropriate investigations and initiate empiric antimicrobials. For patients who require admission to hospital and in whom encephalitis is likely, a staged approach to investigation and management is preferred with the potential involvement of multiple medical specialties. Key considerations in the investigation and management of patients with encephalitis addressed in this guideline include: Which first-line investigations should be performed?; Which aetiologies should be considered possible based on clinical features, risk factors and radiological features?; What tests should be arranged in order to diagnose the common causes of encephalitis?; When to consider empiric antimicrobials and immune modulatory therapies?; and What is the role of brain biopsy? Introduction Encephalitis is a complex condition caused by brain inflammation that is challenging to manage. The diagnoFunding: P. N. Britton is personally funded by NHMRC postgraduate scholarship 2014 (APP1074547), the Royal Australasian College of Physicians (RACP), Sydney Medical School and the Marie Bashir Institute (MBI), the University of Sydney and the Arkhadia Fund/Norah Theresa Hayes-Ratcliffe Fellowship. Conflict of interest: None. sis is rarely confirmed by brain biopsy and instead is inferred by the presence of acute central nervous system (CNS) dysfunction, fever and/or inflammation in the cerebrospinal fluid (CSF) and/or on neuroimaging.1 Differentiation from encephalopathy due to other causes is difficult. There is a wide variety of presentations and a myriad of possibile aetiologies but in most cases a cause is not identified.2–4 There is often no definitive treatment1,5 and a high rate of mortality and morbidity.6 The investigation and management of encephalitis worldwide are of © 2015 Royal Australasian College of Physicians 563 Britton et al. variable quality.7–9 While several international guidelines exist10–13 and the International Encephalitis Consortium consensus included Australian authors,14 a concise guideline for Australian and New Zealand clinicians is required due to differences in the epidemiology of encephalitis. Box 2 Selected differential diagnoses of suspected meningo-encephalitis Meningitis without parenchymal involvement: bacterial, viral, other (e.g. TB, cryptococcus). Cerebral abscess and other forms of intra-cranial suppuration. Methods We reviewed the literature and sought expert opinions in the development of the Consensus guidelines. The guidelines were peer reviewed by the Australasian Society for Infectious Diseases Encephalitis Special Interest Group and Guidelines Committee, the Public Health Association of Australia (PHAA), the Australian and New Zealand Association of Neurologists (ANZAN), and the Australasian College of Emergency Medicine (ACEM). Epidemiology In Australia, the annual hospitalisation rate for encephalitis has been calculated as 5.2/100 000 and case fatality rate is estimated to be 4.6%.4 The highest admission rates are observed in males, and those aged less than 9 or over 60 years of age.4 This is similar to international findings.15–17 Case definition Infection associated encephalopathy (e.g. septic encephalopathy, acute nectrotising encephalopathy (ANE)). Vascular disease: ischaemic/haemorrhagic cerebro-vascular accident (CVA), cerebral vasculitides (e.g. systemic lupus erythematosus). Hypertensive encephalopathy including posterior reversible encephalopathy syndrome (PRES). Neoplastic: primary malignancies. CNS or metastatic, haematologic Toxin induced encephalopathy: alcohol, illicit drugs, other drugs (especially neuroleptics, cyclosporin). Metabolic encephalopathy: hepatic, renal, hypoglycaemia, hyponatraemia, hypocalcaemia, thiamine deficiency, Wilson disease. Neurodegenerative: fronto-temporal dementia, Creutzfeld-Jacob disease (other prion disease), neuroacanthocytosis. Demyelinating disease: multiple sclerosis (MS), neuromyelitis optica (NMO or Devic disease). Endocrine: Hashimoto’s encephalopathy/steroid encephalopathy associated with autoimmune (SREAT), Addisonian crisis. responsive thyroiditis Psychiatric: psychosis, catatonia. The international case definition of encephalitis (Box 1)10 requires the presence of altered mental status Seizure disorder. Traumatic brain injury. Intussusception. Box 1 Encephalitis case definition from the international encephalitis consortium14 Major Criterion (required): Patients presenting to medical attention with altered mental status – defined as decreased or altered level of consciousness, or lethargy or personality change – lasting ≥24h. Minor Criteria (2 for possible encephalitis; ≥3 for probable or confirmed encephalitis): 1 Documented fever ≥38°C (100.4°F) within the 72h before or after presentation. 2 Generalised or partial seizures not fully attributable to a preexisting seizure disorder. 3 New onset of focal neurologic findings. 4 CSF WBC count ≥5/mm3. 5 Abnormality of brain parenchyma on neuroimaging suggestive of encephalitis that is either new from prior studies or appears acute in onset. 6 Abnormality on electroencephalography that is consistent with encephalitis and not attributable to another cause. AND Exclusion of encephalopathy caused by trauma, metabolic disturbance, tumour, alcohol abuse, sepsis and other noninfectious causes. lasting at least 1 day, and exclusion of encephalopathy from other causes (Box 2). Confirmed diagnosis requires meeting additional criteria such as CSF pleocytosis, neuroimaging and electroencephalography (EEG) changes consistent with encephalitis, and the presence of seizures and new onset of focal neurological signs. Of note, in individual cases, expected features of encephalitis such as headache, fever and CSF pleocytosis may be absent.14 Aetiology Multiple infectious agents have been associated with encephalitis, but the syndrome is an uncommon manifestation of most. Viruses are the most commonly identified agent in all settings.5 Immune-mediated aetiologies are increasingly recognised in up to one third of cases, and are important because they are often treatable (Box 3). © 2015 Royal Australasian College of Physicians 564 Consensus guidelines for encephalitis Box 3 Selected immune-mediated encephalitides ADEM18,19 Acute disseminated encephalomyelitis is an inflammatory, multi-focal, demyelinating condition of the central nervous system. It presents with encephalopathy and multi-focal neurological deficits. It is most common in children (mean age 5–8 years old), with a slight male predominance. Rarely it may occur in adults. A temporal association following infection or, less commonly, vaccination is often identified. Magnetic resonance imaging (MRI) is central to the diagnosis. Features include multi-focal, high signal lesions most evident on T2 weighted and fluid-attenuated inversion recovery (FLAIR) sequences involving the sub-cortical, central and periventricular white matter and deep grey matter. Approximately one quarter of children with ADEM will have serum antibodies to myelin oligodendrocyte glycoprotein (MOG). Persistence of anti-MOG IgG is associated with recurrent central nervous system demyelination in this group. Corticosteroids are the established first-line therapy, with other immune-modulatory therapies used in refractory cases. Acute haemorrhagic leuco-encephalopathy (AHLE) is a rare, hyper-acute form of ADEM that overlaps with cerebral vasculitis. Anti-NMDAR20–22 Anti-N-methyl-D-aspartate receptor encephalitis has been shown to be one of the principal causes of encephalitis in recent large prospective studies. It typically presents with psychiatric symptoms, seizures, memory loss and mutism. The syndrome evolves to include movement disorders, dysautonomia and sometimes hypoventilation. Although initially described as a para-neoplastic disorder with ovarian teratoma in young adults (usually female), this tumour association is uncommon in young children where the female gender predominance is also less pronounced. MRI is most often normal. It is diagnosed by identifying CSF or serum antibodies against the NR1 subunit of the NMDA receptor. Anti-NMDAR can be identified in a proportion of relapsing HSV encephalitis, in particular if associated with chorea. Immunomodulatory therapy improves outcomes. Anti-VGKC23–26 Anti-voltage-gated potassium channel-complex (including antibodies against leucine-rich glioma-inactivated 1 protein (Lgi1) and contactin-associated protein 2(Caspr2)) encephalitis includes a broad clinical spectrum. In adults it typically presents in older male (>40 yrs) patients with ‘limbic encephalitis’; sub-acute evolution of memory loss, confusion, medial-temporal lobe seizures and psychiatric features; hyponatraemia is common. Lgi1 antibodies are often identified and it is rarely associated with malignancy. In children it presents as temporal lobe focal seizures, status epilepticus and encephalopathy (behavioural disturbance, hallucinations) and cognitive decline. Specific Lgi1 or Caspr2 antibodies may not be identified. Diagnosis is by identifying serum antibodies that bind to the VGKC-complex, although low titre antibodies are of questionable significance. Immuno-modulatory therapy should probably be similar to NMDAR encephalitis although there is less evidence. Para-neoplastic ‘limbic encephalitis27,28 ‘Limbic encephalitis’ (see above for clinical features) occurring in adults is often associated with malignancy. The encephalitis may occur prior to the diagnosis, or during the course of cancer treatment. The tumours most often associated with limbic encephalitis are small cell lung carcinomas (SCLC), testicular germ cell tumours, breast cancer, ovarian teratoma, Hodgkin lymphoma and thymoma. The most commonly identified antibodies in this group are against intracellular neuronal antigens: anti-Hu, anti-Ma2(Ta), anti-CV2/CRMP5, and anti-amphiphysin. A spectrum of neurological syndromes may overlap with ‘limbic encephalitis’ including features of brainstem encephalitis, basal ganglia syndromes, cerebellar ataxia and peripheral neuropathies. Specific antibodies associate with specific tumours, clinical features and neurological outcome; for example, anti-Hu with SCLC, isolated limbic encephalitis and poorer prognosis, and anti-Ma2 with testicular tumour, brainstem features and better prognosis. Treatment is directed towards the underlying tumour; immuno-modulatory treatments are often used adjunctively. Other Increasing numbers of serum auto-antibodies are being associated with paraneoplastic and non-paraneoplastic limbic encephalitis. These include: anti-Ri, anti-Yo, anti-glutamic acid decarboxylase (GAD), anti-gamma-amino-butyric acid B receptor (GABA-B-R), anti-alphaamino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPA-R), anti-glycine receptor (GlyR), anti-dipeptidyl-peptidase-like protein-6 (DPPX), anti- metabotropic glutamate receptor 5 (mGlu-R5).29 An algorithm addressing approaches to testing and management has been recently published.30 These include acute disseminated encephalomyelitis (ADEM), primarily seen in children and antibodymediated encephalitides (e.g. anti-N-methyl-D-aspartate receptor (NMDAR) and anti-voltage-gated potassiumchannel (VGKC) complex).17,18,20 Aetiology varies with age, immune status, geography, climate and pathogen endemicity, and has changed over time due to changes in immunisation, changing behaviours (Box 4), improved testing and discovery of novel aetiologies. Herpes simplex virus (HSV), varicella zoster virus (VZV), toxoplasma, ADEM and enteroviruses are the most commonly identified encephalitides from studies based on hospital admission records. These studies also demonstrate that deaths from toxoplasmosis, HSV and measles-related encephalitis and subacute sclerosing panencephalitis (SSPE) have declined in recent decades.4,31 A confirmed laboratory diagnosis is frequently not obtained. Almost 70% of cases in a retrospective Australian study did not have an identified aetiology, although © 2015 Royal Australasian College of Physicians 565 Britton et al. Box 4 Clinical, risk factor and radiologic pointers to direct targeted (second line) investigation Clinical features • Psychosis, movement disorder, hypoventilation: anti-NMDAR. • Cognitive dysfunction, seizures: anti-VGKC, anti-NMDAR, HSV, HHV6, anti-GAD, anti-Hu, anti-Ma (other antibody- mediated see Box 3). • Subacute behavioural/personality change: HSV, anti-NMDAR, anti-VGKC, HIV, Treponema pallidum (syphilis), Whipple disease, trypanosomiasis#, SSPE, anti-GAD, anti-Hu, anti-Ma (other antibody mediated see Box 3). • Hydrophobia, hypersalivation, delerium: rabies, ABLV. • Parkinsonian features: flaviviruses (esp. JEV), anti-DR2 (basal ganglia encephalitis). • Brainstem dysfunction: enteroviruses (esp. Ev71), flaviviruses (esp. MVEV, JEV, KUNV), Nipah#, Listeria monocytogenes, Burkholderia pseudomallei, MTB, anti-Hu, anti-Ma (other paraneoplastic see Box 3). • Associated limb weakness (flaccid paralysis) or tremor: enteroviruses (esp. Ev71, poliovirus), flaviviruses. • Rash: enteroviruses, VZV, HHV6, measles , dengue, rickettsiae, Neisseria meningitidis (Meningococcus). • Associated pneumonia: Mycoplasma pneumoniae, influenza, Nipah#, Hendra, Coxiella burnetii (Q fever). • Parotitis, testicular pain: mumps. • Cervical lymphadenopathy: EBV, CMV. • SIADH: anti-VGKC, SLEV†. • Chronic symptoms: HIV, JCV, BKV, trypanosomiasis#, SSPE, T. pallidum (syphilis), Whipple disease. • Cranial nerve palsy: neuroborreliosis†. Risk factors • Neonate (<4 weeks): HSV-2, CMV, toxoplasmosis, T. pallidum (syphilis), L. monocytogenes, enteroviruses parechovirus. • Infant/Child: HSV, VZV, enteroviruses, HHV6/7, M. pneumoniae, EBV, parechovirus, Bartonella sp., ADEM. • >60 years: L. monocytogenes, VZV, HSV. • Female: anti-NMDAR. • Immunocompromised patient: HHV6, CMV, EBV, measles, VZV, LCMV, toxoplasma, cryptococcus, JCV, BKV, Bartonella sp. • Tropical Australia: JEV, dengue, MVEV, KUNV, B. pseudomallei. • Travel history‡ • Asia: JEV, dengue, malaria, MTB, Nipah, Angiostrongylus cantonensis. • Pacific: JEV, dengue, malaria, MTB, Angiostrongylus cantonensis. • North America: WNV, LACV, SLEV, CTFV, EEEV, neuroborreliosis, Rickettsia rickettsii (RMSF), ehrlichiosis (HME), anaplasmosis (HGA), babesiosis, coccidiomycosis. • South America: WNV, VEEV, dengue, MTB, trypanosomiasis (Chagas). • Europe: TBEV, TOSV, neuroborreliosis, anaplasmosis (HGA). • Africa: malaria, trypanosomiasis, MTB. • Animal exposure • Monkeys: herpes B, rabies†. • Bats: rabies†, ABLV. • Dogs and other canids outside Australia: rabies. • Cats: Bartonella hensellae. • Horse: Hendra, KUNV. • Rodents: LCMV, leptospirosis. • Snails/other moluscs: Angiostrongylus cantonensis. • Swine: Nipah. • Mosquito or Tick bite history. • Arboviruses: MVEV, KUNV, JEV, dengue in Australia + by region. • Rickettsiae: Rickettsia typhi, R. australis, R.honei, Orientalis tsutsugamushi in Australia + by region. • Other: neuroborreliosis†, ehrlichiosis (HME)†, anaplasmosis (HGA)†. • Recreational • Sexually transmitted: HIV. • Fresh water§: leptospirosis, Naegleria fowleri. • Soil/mud§: Balamuthia mandrillis. • Occupational • Animal husbandry, farming: C. burnetii (Q fever), leptospirosis. • Abbatoir workers: C. burnetii (Q fever). • Unvaccinated: measles, mumps, rubella, VZV. © 2015 Royal Australasian College of Physicians 566 Consensus guidelines for encephalitis Box 4 Continued Radiologic features • Brainstem: enteroviruses (esp. Ev71), MVEV, JEV, WNV, nipah†, B. pseudomallei, L. monocytogenes, anti-NMO (anti-AQP4), anti-Hu, anti-Ma (other paraneoplastic see Box 3). • ‘Limbic’: HSV, HHV6, anti-NMDAR, anti-VGKC, anti-GAD, anti-Hu, anti-Ma (other antibody mediated see Box 3). • Cerebellum: EBV, VZV, enteroviruses, M. pneumoniae. • Subcortical grey matter (basal ganglia, thalami): EBV, flaviviruses (esp. JEV, MVEV), Influenza, MTB, post-streptococcal, M. pneumoniae, anti-DR2. • Frontal lobe: N. fowleri, B. mandrillis. • ‘Vasculitic’: VZV, systemic lupus erythematosis (SLE) and other cerebral vasculitides. • White matter lesions: ADEM, JCV-PML. †If travelled to an endemic region. ‡Other important aspects of the travel history include the season (especially spring/summer for vector borne pathogens) and specific activites engaged in. §In New Zealand natural geothermal pools pose a particular risk for amoebic meningo-encephalitis, particularly those where there is the direct contact of the water with soil or run-off of water into the pool from soil. ABLV, Australian bat lyssavirus; ADEM, acute disseminated encephalomyelitis; CMV, cytomegalovirus; CTFV, Colarado tick fever virus; DR2, dopamine-2 receptor; EBV, Epstein–Barr virus; EEEV, eastern equine encephalitis virus; GAD, glutamic acid decarboxylase; HGA, human granulocytotropic anaplasmosis; HHV6, human herpes virus-6; HIV, human immunodeficiency virus; HME, human monocytotropic ehrlichiosis; HSV, herpes simplex virus; JCV, John Cunningham virus; JEV, Japanese encephalitis virus; KUNV, Kunjin virus; LACV, Lacrosse virus; LMCV, lymphocytic choriomeningitis virus; MTB, Mycobacterium tuberculosis; MVEV, Murray valley encephalitis virus; NMDAR, N-methyl-D-aspartate receptor; NMO, neuromyelitis optica (AQP4, aquaporin-4); RMSF, Rocky Mountain spotted fever; SLEV, St Louis encephalitis virus; SSPE, sub-acute sclerosing panencephalitis; TBEV, tick bourne encephalitis virus; TOSV, Toscana virus; VEEV, Venezeulan equine encephalitis virus; VGKC, voltage-gated potassium channel; VZV, varicella zoster virus; WNV, West Nile virus. testing for immune-mediated and vector-borne causes was limited.4 Rigorous implementation of systematic testing will likely reduce this proportion but in many cases the cause will remain unknown.17 In Australia, endemic viruses, including Hendra virus, Australian bat lyssavirus (ABLV), Murray Valley encephalitis virus (MVEV) and West Nile virus (WNV) (Kunjin clade (KUNV) – WNV/KUNV), should be considered as possible aetiologies as well as regional infections such as Japanese encephalitis virus (JEV), enterovirus 71 (EV71), dengue and Nipah virus.32 Key differences to note when applying this guideline in New Zealand are that there are currently no endemic flaviviruses, nor are Hendra virus, ABLV and Q fever endemic. Novel agents, particularly viruses, or a changing geographical distribution of diseases should be considered where unexplained encephalitis clusters occur. Causality Experts agree that identification of an infectious agent that is an established cause of encephalitis from a CNS specimen is strong evidence of causality.33 Identification of an encephalitic infectious agent outside of the CNS is less conclusive. Identification of a specific antibody response within the CSF in temporal association with an episode of encephalitis is more convincing evidence of causality than identification of a systemic antibody response, especially on a single specimen. Causality may be classified as confirmed/definite, probable or possible to reflect the level of evidence achieved.2,3,14,17 Investigation of patients may require specimens from multiple sites, with repeated sampling for pathogen identification and to identify a specific serologic response. This is necessary to avoid missing treatable causes,17 especially where there are two or more potential infectious agents and/or autoantibodies. Clinical assessment We present two algorithms to assist clinicians with diagnosis and management. The first (Fig. 1) will assist clinicians to: identify possible meningoencephalitis patients, consider differential diagnoses, initiate empiric acyclovir and antibiotic therapy, and discriminate between patients in whom encephalitis can be excluded from those where a more rigorous assessment is required. Table 1 details first-line investigations. The second algorithm (Fig. 2) follows on from the first and is applied when encephalitis is likely. It provides a multidisciplinary, staged approach to investigation and management. History Collecting a comprehensive history is essential to enable a diagnosis. The onset and evolution of altered consciousness, lethargy, cognition, behaviour or personality change, seizures, weakness, abnormal movements and © 2015 Royal Australasian College of Physicians 567 Britton et al. Table 1 Recommended first-line investigation of encephalitis in Australia and New Zealand Specimen/Investigation CSF† Serum|| Respiratory Faeces Skin swabs (where lesions present) Neuroimaging Tests Opening pressure, microscopy, Gram stain and bacterial culture Cell count and type‡ Biochemistry: protein, glucose PCR: HSV§, enterovirus, VZV Antibodies: oligoclonal bands, VZV IgG¶ Antigen: cryptococcal Ag Other: VDRL (adult); consider cytology; to store Serology: HIV††, flavivirus (Australia)‡‡, M. pneumoniae, EBV (child/adolescent), T. pallidum (syphilis – adult) PCR testing for enterovirus, influenza A and B, adenovirus PCR or antigen testing for enterovirus, adenovirus, rotavirus (child); enterovirus culture/typing PCR testing for HSV 1/2, VZV, enterovirus MRI (sequences to include: T1,T2, FLAIR, DWI, gradient-echo, gadolinium contrast) or if unavailable CT with contrast EEG †Collect up to 10 mL, if able, in four tubes in adults and children, and up to 5 mL in a small child (<2 years old). ‡Formal cytological examination is required to reliably differentiate eosinophils from other leukocytes and identify malignant cells. §HSV PCR is highly sensitive (>96%) between days 3 and 7 of the illness, its sensitivity decreases slightly in the second week of the illness. False negatives prior to day 3 have been described. After day 10, CSF HSV IgG can be used to make a late diagnosis. ¶Where available, CSF VZV IgG may be more sensitive than PCR. Testing requires the demonstration of intrathecal synthesis of VZV IgG, that is a reduced serum/CSF ratio of VZV IgG compared with the serum/CSF ratio of albumin. ||Collect up to 20 mL blood in a clotting tube in adults and children; and up to 5 mL in a small child (<2 years old). ††HIV is very uncommon in children in Australia, and encephalopathy is an uncommon presentation; some experts would still undertake HIV testing as the diagnosis impacts upon possible aetiologies of encephalitis, and is treatable. ‡‡Flaviviral IgM should be tested after 5 days of symptoms. A negative result makes the diagnosis unlikely. CSF IgM is specific for these viruses and should be performed in patients in whom the diagnosis is likely in terms of risk factors, clinical and radiologic features (see Boxes 4 and 5). Ag, antigen; CSF, cerebro-spinal fluid; CT, computed tomography scan; DWI, diffusion-weighted imaging; EEG, electro-encephalogram; FLAIR, fluid-attenuated inversion recovery; HIV, human immunodeficiency virus; HSV, herpes simplex virus; MRI, magnetic resonance imaging; PCR, polymerase chain reaction; VZV, varicella zoster virus; WBC, white blood cell. altered sensation should be elicited and any localisation (focality) recorded. Details of current or recent fever, headache, rash or any other prodromal illness, and an exposure history should be sought including contact with sick persons, immunisation history, travel, mosquito, tick or other insect bites, animal exposures (wild, farm or domestic), and occupation and outdoor activities (e.g. hiking, camping, water sport). Public health authorities should be consulted about seasonal/epidemic activity of infectious agents (e.g. flaviviruses and other arboviruses, enteroviruses).36 Risk factors (Box 4) including age, immunisation and immune status (e.g. immune suppressive treatment, immunodeficiency virus (HIV) risk factors) should be considered. Examination Physical examination should include an objective assessment of the level of consciousness, and look for subtle seizure activity, meningism, abnormal movements (e.g. chorea, parkinsonism), weakness, sensory loss and cranial nerve involvement (including deafness and anosmia), noting any focal findings and for features suggesting other diagnoses (Box 2). Temperature and other vital signs should be assessed for features of raised intracranial pressure or autonomic dysfunction. Mental status examination should be recorded, particuarly if there are psychotic features (hallucinations and delusions). A rash or other skin lesions (e.g. bite marks, eschar, mouth/ palate ulcers, lymphadenopathy and shingles lesions), respiratory or gastrointestinal signs may give clues to the aetiology. Clusters of clinical features (e.g. psychosis and movement disorder and anti-NMDAR encephalitis, or hydrophobia, delirium and hypersalivation with rabies/ ABLV) (Boxes 3, 4) may be strongly indicative of a specific cause. Investigations First-line investigation of all patients with suspected/probable encephalitis Investigations to exclude differential diagnoses (Box 2) and guide initial management are listed in Table 1 and Figure 1. Blood cultures should be taken prior to the administration of empiric antibiotics. A lumbar puncture (LP) should be performed if there is no contraindication or following appropriate imaging and/or clinical observation. CSF analysis is needed to confirm encephalitis (Fig. 1) and identify a cause. Sufficient volumes should be sampled (Table 1) to enable microscopy and cell counts, Gram stain, bacterial culture (mycobacterial culture or fungal cultures if indicated), biochemistry (protein, glucose) and exclusion of HSV, Cryptococcus, VZV and syphilis in those patients meeting the more rigorous definition of encephalitis (Fig. 2). Where avaiable, other biomarkers of CNS inflammation including CSF oligoclonal bands37 and CSF neopterin38 should © 2015 Royal Australasian College of Physicians 568 Consensus guidelines for encephalitis be considered. A serum specimen (Table 1) should be stored for testing with convalescent sera. All patients (Fig. 2) should have serology for HIV, mycoplasma and flaviviruses, and syphilis serology in adults and Epstein– Barr virus (EBV) serology in children. A respiratory tract specimen and stool for viral testing, and viral and bacterial swabs from any skin lesions should be collected. CNS imaging (Fig. 1) should be performed on all patients, by magnetic resonance imaging (MRI) wherever possible using T1, T2 and fluid-attenuated inversion recovery, diffusion-weighted imaging, gradient echo or similar sequences and gadolinium contrast. A chest X-ray is needed to detect associated lung disease (e.g. tuberculosis (TB) and Cryptococcus). EEG is highly sensitive in encephalitis, but often non-specific. It is particularly important in patients with chronic symptoms and those with psychiatric presentations to identify encephalopathy or to diagnose subtle seizure activity and non-convulsive status epilepticus.11,12 Localised EEG activity may suggest specific aetiologies (e.g. temporal localisation with HSV). Targeted testing of patients with encephalitis Where encephalitis is likely, second and third-line testing of patients should be guided by risk factors, clinical and radiologic features (Boxes 4, 5; Fig. 2) in consultation with specialists in neurology, infectious diseases, microbiology/virology and neuroradiology. Remote consultations (by telephone) may be necessary, and transfer to a referral centre considered. Patient subgroups Children Encephalitis is challenging to identify in very young infants as features are non-specific (lethargy, excessive irritability, poor feeding). Diagnosis requires a high index of suspicion and consultation with experienced clinicians. The most common causes of childhood encephalitis globally are HSV-1, VZV, enteroviruses and JEV in endemic regions. Other causes include: ADEM, EBV and adenovirus in children, and HSV-2 and parechovirus in neonates. Human herpesvirus (HHV)-6 and HHV-7 may be associated with febrile seizures and encephalopathy in immune-competent children and may uncommonly cause encephalitis in the immunocompromised.42 Mycoplasma pneumoniae has been associated with childhood encephalitis (less commonly in adults) when a positive M. pneumoniae IgM is detected in blood, although causality remains controversial without concurrent pathogen identification.33,43 Box 5 Tests of choice for the more common and regionally important aetiologies33,39–41 For an extensive review of indicated tests for other aetiologies see Granerod et al., 2010 and Tunkel et al., 2008.10,33 Direct discussion with a medical microbiologist/virologist and local laboratory scientist is good practice before ordering uncommon tests. HSV: CSF PCR 3–10 days into illness. May be negative < 3 days, repeat lumbar puncture and re-test CSF PCR (between days 3 and 10) if other features suggest HSV (see Fig. 2). CSF IgG (in combination with serum IgG) > 10 days. Enteroviruses: CSF PCR, stool and upper respiratory tract specimen for PCR/viral culture. VZV: CSF PCR†, CSF IgG (in combination with serum IgG), Acute serum IgM, serum IgG acute/convalescent‡. EBV/CMV/HHV6: CSF PCR†, Acute serum IgM, serum IgG acute/convalescent‡. Flaviviruses§: CSF IgM after 5 days into illness, Acute serum IgM, serum IgG acute/convalescent‡. WNV/KUNV: As for other flaviviruses and CSF PCR. Dengue: As for other flaviviruses and acute blood NS1 Antigen, PCR. Measles: CSF IgM, acute serum IgM and acute/convalescent serology, urine or upper respiratory specimen for PCR or antigen testing. Rabies or ABLV: CSF PCR. Serum and CSF IgG. DFA on saliva, nuchal skin, corneal impression, brain. Hendra or Nipah: PCR on CSF, serum, respiratory, urine specimens ± serum IgM/G. Ab-mediated: Serum and/or CSF anti-NMDAR Ab; serum antiVGKC complex Ab; serum anti-Hu, anti-Ma2 Ab¶. †Quantitave PCR may contribute to diagnosis. Exclusion of HHV6 chromosomal integration may be required to confirm its aetiologic role. ‡Convalescent for practical purposes is 2–4 weeks following symptom onset. §Includes: Japanese encephalitis virus (JEV), Murray valley encephalitis virus (MVEV), West Nile virus/Kunjin virus (WNV/ KUNV), dengue, St Louis encephalitis virus (SLEV), tick-borne encephalitis virus (TBEV). Other encephalitic arthropod-borne viruses (arboviruses) are investigated in the same way including: togaviruses (eastern equine encephalitis virus (EEEV), western equine encephalitis virus (WEEV), Venezuelan equine encephalitis virus (VEEV)), bunyaviruses (Lacrosse virus (LACV), Toscana virus (TOSV)), and reoviruses (Colorado tick fever virus (CTFV)). ¶Other serum antibodies that have been implicated in paraneoplastic and non-para-neoplastic limbic encephalitis include: anti-amphiphysin, anti-CV2/CRMP5, anti-Ri, anti-Yo, anti-glutamic acid decarboxylase (GAD), anti-gamma-aminobutyric acid A and receptor B (GABA-A-R, GABA-B-R), anti-alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPA-R), anti-glycine receptor (GlyR), antidipeptidyl-peptidase-like protein-6 (DPPX), anti- metabotropic glutamate receptor 5 (mGlu-R5). CSF, cerebrospinal fluid; DFA, direct fluorescent antibody test; HSV, herpes simplex virus; NMDAR, N-methyl-D-aspartate receptor; PCR, polymerase chain reaction; VGKC, voltage-gated potassium channel. © 2015 Royal Australasian College of Physicians 569 Britton et al. Who has ‘Suspected’ meningo-encephalitis? An adult or child who presents with: Encephalopathy: defined by some or all of the following features: altered level of consciousness, altered cognition, altered personality/behaviour†, and lethargy‡; In combination with: current or recent history of fever, and/or new onset seizures, and/or new onset focal neurological signs/symptoms and/or headache. *Conditions that may present like meningo-encephalitis - Meningitis - Cerebral abscess - Traumatic brain injury - Encephalopathy: Early investigation and Management • • • • • • • • • (See Box2 for detail) Comprehensive history, including exposures, and examination (See box 4); Consider other causes* Bloods: full blood count, electrolytes, glucose, urea, creatinine, calcium, liver function tests, blood culture, serum to store (5-10 mL). In adults consider early HIV testing with appropriate pre-test Infection-associated Toxin induced Metabolic Neurodegenerative Seizure Endocrine Neoplastic Psychiatric† counselling. • • • • Judicious fluid and electrolyte management as required. Acute seizure management (follow local and state based guidelines). Consider if Lumbar Puncture (LP) can be performed and role of preceding CT scan (see below). If patient septic or LP or CT delayed§, commence antibiotics promptly as per national guidelines¶. Performance of LP and role of prior CNS imaginggII CNS imaging (most commonly CTΔ) should be performed prior to lumbar puncture in the following circumstances: • Impairment of consciousness; abnormal, fluctuating or declining GCS. • Signs of raised intra-cranial pressure (papilloedema, relative bradycardia with hypertension, oculomotor palsy or abnormal pupillary response). • Focal neurological deficits. • New onset seizures until stabilised. • Immunocompromised state (HIV/AIDS, immunosuppressive therapy, transplantation). • Previous history of a CNS lesion (mass lesion, stroke, or focal infection). LP is relatively contra-indicated in the following circumstances: • Haemodynamic instability or acute respiratory failure. • Coagulation disorders e g disseminated intravascular coagulation use of anticoagulant drugs thrombocytopenia (<100 x106/L) Contraindication to LP or LP deferred pending CNS imaging or CT unavailable: • • • Bacterial meningitis possible. Commence antibiotics promptly§ for possible bacterial meningitis as per local and national guidelines¶. Encephalitis is possible, start acyclovir (see doses below). Perform LP as soon as possible: if no radiologic contraindication or reconsider daily while an inpatient. Acyclovir dose: Adults/Children >12 years: 10mg/kg IV 8 hourly. Children: <3 mo- 20mg/kg IV 8 hourly; 3mo-12years 500mg/m2 10mg/kg IV 8 hourly. No clinical contraindication. LP performed: • • Record CSF opening pressure. Take 10mL if able (5mL in a small child <15kg); ideally in 4 tubes (1 - 2.5mL in 4th tube). Send for microscopy (cell count, Gram stain), culture and biochemistry (protein, glucose), HSV and enterovirus PCR. Check CSF microscopy values (see below). • • adjust dose for renal impairment. CSF microscopy abnormal • Commence antibiotics for possible bacterial meningitis as per local and national guidelines2. • Encephalitis is possible, start acyclovir. • Consider tuberculous or fungal meningitis depending on CSF parameters (see below) and risk factors. • Arrange CNS imaging : MRI within 24-48h (CT with contrast if MRI unavailable). MRI a nd/or CSF abnormalconsistent with encephalitis (see below) and no other diagnosis made. Encephalitis probable (See Figure 2) MRI normal and CSF normal, but clinical findings persist, and no other diagnosis made. Encephalitis remains possible. (See Figure 2) ***Typical cerebro-spinal fluid patterns††11,34,35 Normal Viral meningoencephalitis Opening pressure <25cm H20 Normal-high <5 5–1000 Cell count (uL or 106/L) Cell type Lymphocyte/m Lymphocytes onocytes, no predominate neutrophils or (neutrophils if RBC early) >0.5 Normal Glucose (CSF:plasma) (mmol/L) Protein (g/L) <0.5 0.5–1.0 CSF microscopy normal • Bacterial / tuberculous / fungal meningitis excluded. • Encephalitis remains possible, start acyclovir. • Arrange CNS imaging : MRI within 24-48h (CT with contrast if MRI unavailable). MRI normal, CSF normal and clinical findings resolved. Encephalitis excluded. Manage as per alternative diagnosis. Alternative diagnosis made. Encephalitis excluded. Manage as per alternative diagnosis. Bacterial meningitis High 100–50 000 Tuberculous meningitis High 5–500 Fungal meningitis Neutrophils predominate Lymphocytes predominate Lymphocytes predominate Low (<0.4) Very Low (<0.3) Normal-low >1.0 1.0–5.0 0.2–5.0 Very High 5–1000 © 2015 Royal Australasian College of Physicians 570 Consensus guidelines for encephalitis Figure 1 Algorithm for the assessment and management of a patient with suspected meningo-encephalitis. Where traumatic sampling occurs with elevated red blood cells on microscopy, the WBC can be corrected using the formula: True CSF WBC = actual CSF WBC – (WBC blood × RBC CSF/RBC blood) or approximately 1 WBC per 500 RBC. The ratio of WBC types in the CSF can be compared with that in blood. 1000 × 106/L RBC in CSF raises CSF protein by approximately 0.1 g/L. †Particular note should be made of apparently psychiatric presentations. ‡In young children, the clinical features of encephalopathy may be difficult to discern and may include poor feeding, excessive irritability and unusual crying. §The Australasian College of Emergency Medicine (ACEM) recommends that antibiotics may be delayed if the lumbar puncture will be performed within 20 min of presentation. Antibiotics should be administered prior to LP where: there is no doctor present, there will be a delay to a required CT, lumbar puncture is not able to be performed (due to other contraindication or the healthcare professional does not have the requisite skills) or possible systemic sepsis. ¶Consult Therapeutic Guidelines: Antibiotic: Version 15. Therapeutic Guidelines Limited, Melbourne (2014). ||If CT or MRI are unavailable locally, consultation with specialists in neurology and infectious diseases should be pursued and collaborative discussion as to the need for transfer to a referral centre should be included in these discussions. Δ Early MRI should be advocated because of its increased sensitivity, particularly in children where stroke is less common. ††There are exceptions to these ‘typical patterns’; infectious diseases consultation should be sought where particular risk factors or clinical features suggest a specific aetiology and CSF findings are inconsistent with this. CNS, central nervous system; CSF, cerebrospinal fluid; CT, computed tomography scan; GCS, Glasgow coma score; HIV/AIDS, human immunodeficiency syndrome/acquired immune deficiency syndrome; LP, lumbar puncture; MRI, magnetic resonance imaging; RBC, red blood cell; WBC, white blood cell. ◀ Immunocompromised hosts The aetiology of encephalitis in the immunocompromised varies depending on the timing, nature and intensity of immunosuppression. CSF pleocytosis may be lacking in these patients. CNS reactivation of latent infection (e.g. VZV, cytomegalovirus (CMV), HHV-6, EBV) can occur, but is less common than systemic reactivation. HHV-6 post-transplant limbic encephalitis is now well described.44,45 VZV reactivation and primary infection in immunocompromised hosts causes a small vessel vasculitis. Encephalitis may be caused by opportunistic pathogens (e.g. Toxoplasma, Cryptococcus). HIV testing is essential as encephalitis may be the presenting illness of HIV/ AIDS. A variety of neurological syndromes is associated with HIV; patients at highest risk are those with severe immune suppression (CD4 count < 200). Toxoplasma gondii, Cryptococcus neoformans and CMV are the most important pathogens. John Cunningham virusassociated progressive multifocal leucoencephalopathy (PML) can present in a variety of ways including fulminant encephalopathy.46,47 Initiation of anti-retroviral therapy can result in CNS immune reconstitution inflammatory syndrome (IRIS) encephalitis, including a nonpathogen-associated CNS IRIS, so-called CD8-positive encephalitis.48 The role of corticosteroids in this group should be discussed with an HIV specialist. International travellers or immigrants Overseas travellers may be exposed to a wide array of infections that can cause encephalitis. Common aetiologies as well as the exotic should be considered. Testing should be guided by a detailed history including timing of symptom onset in relation to travel, destination and in-location movements and activities, pre-departure immunisation, antimicrobial prophylaxis and adherence, animal and vector exposure, and ingestion of raw or unusual foods. Cerebral malaria is a potential cause in the febrile returned traveller with encephalopathy. Tuberculous meningoencephalitis should be considered, especially in young children and vector-borne pathogens (e.g. flaviviruses, Rickettsia spp.) after travel to overseas rural locations, especially in summer/spring. A history of insect bites is not always given. Tropical Australia In those living in or returning from tropical Australia, dengue, JEV and the endemic flaviviruses (MVEV and KUNV) should be considered. Parts of the Northern Territory (above 21oS) are endemic for melioidosis, which can present as brainstem encephalitis with cranial nerve palsies and limb weakness.49 Leptospirosis may occur following flooding events and exposure to water.50 Unknown or ‘cryptic’ encephalitis Brain biopsy is not necessary in most encephalitis patients; however, it should be considered in patients without a diagnosis who remain unwell or are deteriorating, especially if there are focal lesions on imaging or where CNS vasculitis is suspected.51 Potentially treatable aetiologies may be diagnosed using biopsy in these circumstances,51–54 and other occult diagnoses can be made, for example, CNS Whipple disease, TB, PML and neurosarcoidosis.52 Liaison with histopathology and microbiology prior to sampling is essential to ensure correct specimen handling, transport and testing. A proportion of patients will not have an aetiological diagnosis made despite extensive investigation. Patients © 2015 Royal Australasian College of Physicians 571 Britton et al. Encephalitis(14) An adult or child with: 1. Encephalopathy: defined by the presence of some or all of the following features: altered level of consciousness, altered cognition, personality/behavioural change, lethargy; lasting >24 h. 2. In combination with two or more of the following: • Fever or history of fever (>38C) within 72h before/after presentation. • Generalised or partial seizures not fully attributable to a pre-existing seizure disorder. • New onset focal neurologic findings. • CSF pleocytosis (≥ 5WBC/uL). • Abnormal results of neuroimaging suggestive of encephalitis. • EEG abnormality consistent with encephalitis and not attributable to another cause. 3. AND no alternative cause identified/diagnosis made. Arrange first-line investigations if not performed already (see also Table 1): Commence empiric acyclovir: • Adults/Children >12 years: 10mg/kg IV 8 hourly. Children: <3 mo- 20mg/kg IV 8 hourly; 3mo-12years 500mg/m2 10mg/kg IV 8 hourly. CSF: microscopy, culture, protein, glucose, HSV PCR, enterovirus PCR, VZV PCR and IgG, cryptococcal Ag, VDRL (adult), consider cytology. • Serology: HSV, flavivirus (Australia), HIV, M. pneumoniae, EBV (child/adolescent), Treponema pallidum (Syphilis - adult) • Respiratory viral testing: PCR or antigen testing for enterovirus, influenza A and B, adenovirus. • Stool viral testing: PCR or antigen for enterovirus, adenovirus, rotavirus (child). • MRI brain: sequences to include T1,T2, FLAIR, DWI, gradient-echo, gadolinium contrast or if unavailable CT with contrast. • Chest X-ray. • EEG (particularly useful in certain circumstances†). Consider addition of empiric antimicrobials for Listeria monocytogenes (penicillin or ampicillin) and rickettsiae (doxycycline in adults) adjust dose for renal impairment. Arrange specialist consultation: Neurology Infectious Diseases Microbiology/Virology Radiology Identify clinical features, risk factors, radiologic features (see Box 4) to guide second-line investigation: • • In consultation with neurologist, infectious diseases specialist, radiologist, microbiologist (Box 5). Especially note the following risk groups: o Children and neonates o Immunocompromised (including HIV/AIDS, immunosuppressive therapy, transplantation) o International travellers or immigrants o Those residing in or having travelled to tropical regions of Australia Consider if HSV encephalitis is excluded and therefore determine duration of acyclovir therapy: 1. 2. In a patient without neuroimaging suggestive of HSV encephalitis‡, cease empiric acyclovir if: o A negative CSF PCR for HSV is obtained, if the CSF was sampled between days 3 and 7 of the clinical illness. o Two negative CSF PCRs for HSV are obtained, if the first PCR was taken in the first 72 h of the clinical illness. In a patient with neuroimaging suggestive of HSV encephalitis‡, irrespective of CSF PCR result: o Continue acyclovir for 21 days if < 3 mo; 14-21 days if >3 mo, child or adult and, o Consider CSF HSV IgG testing after day 10 of the clinical illness (unless a definitive alternative diagnosis made). Definitive treatment of aetiology if identified (see Box 6) Where relevant, report case to public health or other statutory authorities and perform contact tracing If no aetiology identified, consider empiric treatment of possible aetiologies, including immune therapy (corticosteroids and/or IVIG) based on clinical features, risk factors, radiologic features in consultation with neurologist and infectious diseases specialist (see Box 6). Consider third-line investigations if: 1. The patient remains unwell and other investigations are negative or 2. The patient is deteriorating and an aetiologic diagnosis has not yet been made. • • Repeat CSF sampling: microscopy, CSF wet mount, cytology, repeat HSV PCR, CSF immunoglobulin testing (HSV, VZV, flavivirus, IgG index, ABLV (Australia) and other epidemiologically relevant viruses if international travel). Repeat MRI brain: sequences to include T1,T2, FLAIR, DWI, gradient-echo, gadolinium contrast. It is essential to liaise with a (neuro)radiologist with regards to planning these and any additional sequences. • • All patients in this circumstance should be tested for anti-NMDAR, anti-VGKC and in Australia, ABLV. Brain biopsy: it is essential to liaise with histopathology and microbiology prior to sampling with regards to specimen handling, transport and testing – especially note that specimens should not be formalin fixed prior to transfer to the laboratory. © 2015 Royal Australasian College of Physicians 572 Consensus guidelines for encephalitis Figure 2 Algorithm for the investigation and management of encephalitis. †Patients with chronic symptoms, those with primarily psychiatric presentations or to diagnose subtle seizure activity and non-convulsive status epilepticus. ‡Imaging findings characteristic of HSV are medial temporal lobe and inferior frontal cortex involvement; lesions may be unilateral or bilateral. Ab, antibody; ABLV, Australian bat lyssavirus; Ag, antigen; AIDS, acquired immunodeficiency syndrome; CSF, cerebrospinal fluid; CT, computed tomography scan; DWI, diffusion weighted index; EEG, electroencephalogram; HIV, human immunodeficiency virus; HSV, herpes simplex virus; mo, months; NMDAR, N-methyl D aspartate receptor; PCR, polymerase chain reaction ; VZV, varicella zoster virus; WBC, white blood cell; yo, years old; VGKC, voltage gated potassium channel; MRI, magnetic resonance imaging; FLAIR, fluid attenuated inversion recovery. ◀ Box 6 Directed management of viral and immune-mediated encephalitis For an extensive review of antimicrobial treatments for other aetiologies see Tunkel et al., 2008.10 HSV: Minimum 14 days intravenous acyclovir for immunocompetent patients and 21 days for immunocompromised patients (adults and children > 12 years: 10 mg/kg 8 hourly; children: <3 mo 20 mg/kg 8 hourly; 3 mo-12 yo 500 mg/m2 8 hourly). Consider repeat lumbar puncture for CSF HSV PCR at planned completion of treatment especially in immunocompromised and children. VZV: Consider 7–14 days intravenous acyclovir (adults and children > 12 years: 10 to 12.5 mg/kg 8 hourly; children: 500 mg/m2 8-hourly (approximately 20 mg/kg for child 5 years or less, 15 mg/kg for child 5–12 years)) with or without corticosteroids in consultation with an infectious diseases specialist. Enterovirus: Intravenous immunoglobulin if hypogammaglobulinaemic. Intravenous immunoglobulin is used widely in Asia for enterovirus 71. CMV/HHV6: Reduce immunosuppression and consider ganciclovir and/or foscarnet in consultation with infectious diseases specialist. Rabies or ABLV: Consider Milwaukee protocol55,56 in consultation with infectious diseases specialist. ADEM: Methylprednisolone 30 mg/kg daily in children up to 1000 mg (adult daily dose) for 3–5 days in consultation with a neurologist. Second-line treatments in consultation with a neurologist. Ab-mediated: Immunosuppressive therapy in consultation with a neurologist. Investigation for underlying tumour and removal (where indicated). Ongoing tumour surveillance. ADEM, acute disseminated encephalomyelitis; CMV, cytomegalovirus; CSF, cerebrospinal fluid; DFA, direct fluorescent antibody test; HHV, human herpes virus; HSV, herpes simplex virus; VZV, varicella zoster virus. with ‘cryptic’ encephalitis should be tested for antiNMDAR and anti-VGKC complex encephalitis and in Australia for ABLV. Management (Figs 1,2; Box 6) Supportive and empiric Seizure control, management of raised intracranial pressure (occasionally by surgical decompression), circulatory and respiratory support, fluid and electrolyte balance, nutritional support, skin integrity and pressure area care, and prevention of hospital-acquired infections should all be addressed. Patients with ‘suspected meningo-encephalitis’ should be commenced on acyclovir. Antibiotics for possible meningitis or sepsis should be administered promptly as per local and national guidelines (ACEM advise within 20 min of presentation) and should not be delayed if LP is contraindicated or neuroimaging delayed. Directed management of encephalitis with an identified aetiology (Box 6) When a cause is identified, directed therapy (Box 6) should be determined in consultation with relevant specialists and national/international antimicrobial guidelines.10 With the exception of the herpesviruses, most viral causes have no specific treatment. For HSV and VZV encephalitis, guidelines regarding acyclovir duration and corticosteroids vary,57–64 as does advice regarding antivirals for CMV or HHV-6 encephalitis.10 Antivirals are not recommended for EBV encephalitis.10 Pleconaril for enteroviral encephalitis has limited documented efficacy and is not widely availabile. Intravenous immunoglobulin is used, without strong evidence of efficacy, to treat EV71-associated encephalo-myelitis,65 and also for chronic enteroviral infections in antibody deficient hosts. It is increasingly being used as adjunctive therapy for other encephalitides. Corticosteroids have an established role in the management of ADEM, although this is not based on high-quality evidence18,66; intravenous immunoglobulin and plasma exchange may be used where there is steroid resistance.18 Evidence of benefit from immune suppression in NMDAR encephalitis in increasing21 and similar approaches are recommended for other immune-mediated encephalitides.67 An extensive search for an underlying malignancy should be performed whenever NMDAR encephalitis is diagnosed68 and in adults with ‘limbic encephalitis’69 (Box 3). There is no evidence that antimicrobials are beneficial in M. pneumoniae-associated encephalitis. © 2015 Royal Australasian College of Physicians 573 Britton et al. Outcome, prognosis and follow-up Overall mortality of encephalitis is approximately 10%.2,3,17 Up to 50% of patients experience short-term deficits with 20% experiencing severe sequelae; longterm outcome is poorly characterised, and neurocognitive sequelae likely underestimated.70,71 Depression of consciousness at presentation is the main adverse prognostic feature; poor outcome has also been associated with refractory status epilepticus, intensive care unit admission, focal neurologic signs, abnormal MRI findings, extremes of age and immune compromise, a diagnosis of HSV in adults, and JEV or Mycoplasma pneumoniae in children,5 or delay in the initiation of directed therapy. References 1 Lewis P, Glaser CA. Encephalitis. Pediatr Rev 2005; 26: 353–63. 2 Mailles A, Stahl J-P, Steering C, Steering Committee and Investigators Group. Infectious encephalitis in France in 2007: a national prospective study. Clin Infect Dis 2009; 49: 1838–47. 3 Glaser CA, Honarmand S, Anderson LJ, Schnurr DP, Forghani B, Cossen CK et al. Beyond viruses: clinical profiles and etiologies associated with encephalitis. Clin Infect Dis 2006; 43: 1565–77. 4 Huppatz C, Durrheim DN, Levi C, Dalton C, Williams D, Clements MS et al. Etiology of encephalitis in Australia, 1990–2007. Emerg Infect Dis 2009; 15: 1359–65. 5 Granerod J, Crowcroft NS. The epidemiology of acute encephalitis. Neuropsychologists 2007; 17: 406–28. 6 Khetsuriani N, Holman RC, Anderson LJ. Burden of encephalitis-associated hospitalizations in the United States, 1988–1997. Clin Infect Dis 2002; 35: 175–82. 7 Huppatz C, Gawarikar Y, Levi C, Kelly PM, Williams D, Dalton C et al. Should there be a standardised approach to the diagnostic workup of suspected adult encephalitis? A case series from Australia. BMC Infect Dis 2010; 10: 353. 8 Kneen R, Jakka S, Mithyantha R, Riordan A, Solomon T. The management of infants and children treated with aciclovir for suspected viral encephalitis. Arch Dis Child 2010; 95: 100–6. Recovery from encephalitis reaches a plateau at approximately 6–12 months. Rehabilitation assessment (medical and non-medical) should be considered, especially in those with neurological or neuropsychological deficits at discharge. We recommend early formal discharge planning to facilitate referrals and follow-up including development and learning in children, and seizure management. Conclusion Further research is needed to inform better local management guidelines; however, many patients will benefit from the optimal application of existing knowledge. 9 Kelly C, Sohal A, Michael BD, Riordan A, Solomon T, Kneen R. Suboptimal management of central nervous system infections in children: a multi-centre retrospective study. BMC Pediatr 2012; 12: 145. 10 Tunkel AR, Glaser CA, Bloch KC, Sejvar JJ, Marra CM, Roos KL et al. The management of encephalitis: clinical practice guidelines by the Infectious Diseases Society of America. Clin Infect Dis 2008; 47: 303–27. 11 Kneen R, Michael BD, Menson E, Mehta B, Easton A, Hemingway C et al. Management of suspected viral encephalitis in children – Association of British Neurologists and British Paediatric Allergy, Immunology and Infection Group National Guidelines. J Infect 2012; 64: 449–77. 12 Solomon T, Michael BD, Smith PE, Sanderson F, Davies NW, Hart IJ et al. Management of suspected viral encephalitis in adults – Association of British Neurologists and British Infection Association National Guidelines. J Infect 2012; 64: 347–73. 13 Steiner I, Budka H, Chaudhuri A, Koskiniemi M, Sainio K, Salonen O et al. Viral meningoencephalitis: a review of diagnostic methods and guidelines for management. Eur J Neurol 2010; 17: 999–e57. 14 Venkatesan A, Tunkel AR, Bloch KC, Lauring AS, Sejvar J, Bitnun A et al. Case definitions, diagnostic algorithms, and priorities in encephalitis: consensus statement of the International Encephalitis Consortium. Clin Infect Dis 2013; 57: 1114–28. 15 Davison KL, Crowcroft NS, Ramsay ME, Brown DWG, Andrews NJ. Viral encephalitis in England, 1989–1998: what did we miss? Emerg Infect Dis 2003; 9: 234–40. 16 Kulkarni MA, Lecocq AC, Artsob H, Drebot MA, Ogden NH. Epidemiology and aetiology of encephalitis in Canada, 1994–2008: a case for undiagnosed arboviral agents? Epidemiol Infect 2013; 141: 2243–55. 17 Granerod J, Ambrose HE, Davies NW, Clewley JP, Walsh AL, Morgan D et al. Causes of encephalitis and differences in their clinical presentations in England: a multicentre, population-based prospective study. Lancet Infect Dis 2010; 10: 835–44. Erratum appears in Lancet Infect Dis 2011 11: 79. 18 Tenembaum S, Chitnis T, Ness J, Hahn JS. Acute disseminated encephalomyelitis. Neurology 2007; 68(16 Suppl 2): S23–36. 19 Young NP, Weinshenker BG, Lucchinetti CF. Acute disseminated encephalomyelitis: current understanding and controversies. Semin Neurol 2008; 28: 84–94. 20 Gable MS, Sheriff H, Dalmau J, Tilley DH, Glaser CA. The frequency of autoimmune N-methyl-D-aspartate receptor encephalitis surpasses that of individual viral etiologies in young individuals enrolled in the California Encephalitis Project. Clin Infect Dis 2012; 54: 899–904. 21 Titulaer MJ, McCracken L, Gabilondo I, Armangue T, Glaser C, Iizuka T et al. Treatment and prognostic factors for long-term outcome in patients with anti-NMDA receptor encephalitis: an © 2015 Royal Australasian College of Physicians 574 Consensus guidelines for encephalitis 22 23 24 25 26 27 28 29 30 31 32 observational cohort study. Lancet Neurol 2013; 12: 157–65. Hacohen Y, Wright S, Waters P, Agrawal S, Carr L, Cross H et al. Paediatric autoimmune encephalopathies: clinical features, laboratory investigations and outcomes in patients with or without antibodies to known central nervous system autoantigens. J Neurol Neurosurg Psychiatry 2013; 84: 748–55. Vincent A, Buckley C, Schott JM, Baker I, Dewar BK, Detert N et al. Potassium channel antibody-associated encephalopathy: a potentially immunotherapy-responsive form of limbic encephalitis. Brain 2004; 127(Pt 3): 701–12. Suleiman J, Brenner T, Gill D, Brilot F, Antony J, Vincent A et al. VGKC antibodies in pediatric encephalitis presenting with status epilepticus. Neurology 2011; 76: 1252–5. Wong SH, Saunders MD, Larner AJ, Das K, Hart IK. An effective immunotherapy regimen for VGKC antibody-positive limbic encephalitis. J Neurol Neurosurg Psychiatry 2010; 81: 1167–9. Lai M, Huijbers MGM, Lancaster E, Graus F, Bataller L, Balice-Gordon R et al. Investigation of LGI1 as the antigen in limbic encephalitis previously attributed to potassium channels: a case series. Lancet Neurol 2010; 9: 776–85. Gultekin SH, Rosenfeld MR, Voltz R, Eichen J, Posner JB, Dalmau J. Paraneoplastic limbic encephalitis: neurological symptoms, immunological findings and tumour association in 50 patients. Brain 2000; 123(Pt 7): 1481–94. Dalmau J, Rosenfeld MR. Paraneoplastic syndromes of the CNS. Lancet Neurol 2008; 7: 327–40. Lancaster E, Dalmau J. Neuronal autoantigens – pathogenesis, associated disorders and antibody testing. Nat Rev Neurol 2012; 8: 380–90. Lancaster E, Martinez-Hernandez E, Dalmau J. Encephalitis and antibodies to synaptic and neuronal cell surface proteins. Neurology 2011; 77: 179–89. Huppatz C, Kelly PM, Levi C, Dalton C, Williams D, Durrheim DN. Encephalitis in Australia, 1979–2006: trends and aetiologies. Commun Dis Intell 2009; 33: 192–7. Paterson BJ, Mackenzie JS, Durrheim DN, Smith D. A review of the epidemiology and surveillance of viral zoonotic encephalitis and the impact on 33 34 35 36 37 38 39 40 41 42 43 44 human health in Australia. N S W Public Health Bull 2011; 22: 99–104. Granerod J, Cunningham R, Zuckerman M, Mutton K, Davies NWS, Walsh AL et al. Causality in acute encephalitis: defining aetiologies. Epidemiol Infect 2010; 138: 783–800. Beaman MH, Wesselingh SL. 4: Acute community-acquired meningitis and encephalitis. Med J Aust 2002; 176: 389–96. Nigrovic LE, Shah SS, Neuman MI. Correction of cerebrospinal fluid protein for the presence of red blood cells in children with a traumatic lumbar puncture. J Pediatr 2011; 159: 158–9. Selvey LA, Dailey L, Lindsay M, Armstrong P, Tobin S, Koehler AP et al. The Changing Epidemiology of Murray Valley Encephalitis in Australia: the 2011 outbreak and a review of the literature. PLoS Negl Trop Dis 2014; 8: e2656. Sinclair AJ, Wienholt L, Tantsis E, Brilot F, Dale RC. Clinical association of intrathecal and mirrored oligoclonal bands in paediatric neurology. Dev Med Child Neurol 2013; 55: 71–5. Dale RC, Brilot F, Fagan E, Earl J. Cerebrospinal fluid neopterin in paediatric neurology: a marker of active central nervous system inflammation. Dev Med Child Neurol 2009; 51: 317–23. Debiasi RL, Tyler KL. Molecular methods for diagnosis of viral encephalitis. Clin Microbiol Rev 2004; 17: 903–25, table of contents. Bloch KC, Glaser C. Diagnostic approaches for patients with suspected encephalitis. Curr Infect Dis Rep 2007; 9: 315–22. Thomson RB Jr, Bertram H. Laboratory diagnosis of central nervous system infections. Infect Dis Clin North Am 2001; 15: 1047–71. Ward KN, Andrews NJ, Verity CM, Miller E, Ross EM. Human herpesviruses-6 and -7 each cause significant neurological morbidity in Britain and Ireland. Arch Dis Child 2005; 90: 619–23. Bitnun A, Ford-Jones E, Blaser S, Richardson S. Mycoplasma pneumoniae encephalitis. Semin Pediatr Infect Dis 2003; 14: 96–107. Wainwright MS, Martin PL, Morse RP, Lacaze M, Provenzale JM, Coleman RE et al. Human herpesvirus 6 limbic encephalitis after stem cell 45 46 47 48 49 50 51 52 53 54 55 56 transplantation. Ann Neurol 2001; 50: 612–19. Seeley WW, Marty FM, Holmes TM, Upchurch K, Soiffer RJ, Antin JH et al. Post-transplant acute limbic encephalitis: clinical features and relationship to HHV6. Neurology 2007; 69: 156–65. Kranick SM, Nath A. Neurologic complications of HIV-1 infection and its treatment in the era of antiretroviral therapy. Continuum (N Y) 2012; 18: 1319–37. 6 Infectious Disease. Ferenczy MW, Marshall LJ, Nelson CD, Atwood WJ, Nath A, Khalili K et al. Molecular biology, epidemiology, and pathogenesis of progressive multifocal leukoencephalopathy, the JC virus-induced demyelinating disease of the human brain. Clin Microbiol Rev 2012; 25: 471–506. Lescure FX, Moulignier A, Savatovsky J, Amiel C, Carcelain G, Molina JM et al. CD8 encephalitis in HIV-infected patients receiving cART: a treatable entity. Clin Infect Dis 2013; 57: 101–8. Currie BJ, Fisher DA, Howard DM, Burrow JN. Neurological melioidosis. Acta Trop 2000; 74: 145–51. Smith JK, Young MM, Wilson KL, Craig SB. Leptospirosis following a major flood in Central Queensland, Australia. Epidemiol Infect 2013; 141: 585–90. Venkateswaran S, Hawkins C, Wassmer E. Diagnostic yield of brain biopsies in children presenting to neurology. J Child Neurol 2008; 23: 253–8. Wong SH, Jenkinson MD, Faragher B, Thomas S, Crooks D, Solomon T. Brain biopsy in the management of neurology patients. Eur Neurol 2010; 64: 42–5. Pulhorn H, Quigley DG, Bosma JJ, Kirollos R, du Plessis DG, Jenkinson MD. Impact of brain biopsy on the management of patients with nonneoplastic undiagnosed neurological disorders. Neurosurgery 2008; 62: 833–7, discussion 7–8. Hall WA. The safety and efficacy of stereotactic biopsy for intracranial lesions. Cancer 1998; 82: 1749–55. Willoughby RE Jr, Tieves KS, Hoffman GM, Ghanayem NS, Amlie-Lefond CM, Schwabe MJ et al. Survival after treatment of rabies with induction of coma. N Engl J Med 2005; 352: 2508–14. Milwaukee Protocol. Version 4.0 (updated 2012 Sep 13) [cited 2015 Apr 12]. Available from URL: http://www .mcw.edu/Pediatrics/InfectiousDiseases/ PatientCare/Rabies.htm © 2015 Royal Australasian College of Physicians 575 57 Openshaw H, Cantin EM. Corticosteroids in herpes simplex virus encephalitis. J Neurol Neurosurg Psychiatry 2005; 76: 1469. 58 Steiner I, Kennedy PG, Pachner AR. The neurotropic herpes viruses: herpes simplex and varicella-zoster. Lancet Neurol 2007; 6: 1015–28. 59 Tyler KL. Herpes simplex virus infections of the central nervous system: encephalitis and meningitis, including Mollaret’s. Herpes 2004; 11(Suppl 2): 57A–64A. 60 Kimberlin DW. Herpes simplex virus infections in neonates and early childhood. Semin Pediatr Infect Dis 2005; 16: 271–81. 61 Whitley RJ, Kimberlin DW. Herpes simplex encephalitis: children and adolescents. Semin Pediatr Infect Dis 2005; 16: 17–23. 62 Martinez-Torres F, Menon S, Pritsch M, Victor N, Jenetzky E, Jensen K et al. Protocol for German trial of Acyclovir and corticosteroids in Herpes-simplex-virus-encephalitis 63 64 65 66 (GACHE): a multicenter, multinational, randomized, double-blind, placebocontrolled German, Austrian and Dutch trial [ISRCTN45122933]. BMC Neurol 2008; 8: 40. Gilden D. Varicella zoster virus and central nervous system syndromes. Herpes 2004; 11(Suppl 2): 89A– 94A. Kamei S, Sekizawa T, Shiota H, Mizutani T, Itoyama Y, Takasu T et al. Evaluation of combination therapy using aciclovir and corticosteroid in adult patients with herpes simplex virus encephalitis. J Neurol Neurosurg Psychiatry 2005; 76: 1544–9. Ooi MH, Wong SC, Lewthwaite P, Cardosa MJ, Solomon T. Clinical features, diagnosis, and management of enterovirus 71. Lancet Neurol 2010; 9: 1097–105. Dale RC, Brilot F, Banwell B. Pediatric central nervous system inflammatory demyelination: acute disseminated encephalomyelitis, clinically isolated syndromes, neuromyelitis optica, and 67 68 69 70 71 multiple sclerosis. Curr Opin Neurol 2009; 22: 233–40. Dale RC, Brilot F, Duffy LV, Twilt M, Waldman AT, Narula S et al. Utility and safety of rituximab in pediatric autoimmune and inflammatory CNS disease. Neurology 2014; 83: 142–50. Dalmau J, Gleichman AJ, Hughes EG, Rossi JE, Peng X, Lai M et al. Anti-NMDA-receptor encephalitis: case series and analysis of the effects of antibodies. Lancet Neurol 2008; 7: 1091–8. Florance NR, Davis RL, Lam C, Szperka C, Zhou L, Ahmad S et al. Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis in children and adolescents. Ann Neurol 2009; 66: 11–18. Chaudhuri A, Kennedy PG. Diagnosis and treatment of viral encephalitis. Postgrad Med J 2002; 78: 575–83. Britton PN, Dale RC, Booy R, Jones CA. Acute encephalitis in children: Progress and priorities from an Australasian perspective. J Paediatr Child Health 2015; 51: 147–58. B R I E F C O M M U N I C AT I O N S Survey of infection control and antimicrobial stewardship practices in Australian residential aged-care facilities R. L. Stuart,1,2 C. Marshall,3,4 E. Orr,1 N. Bennett,5 E. Athan,6,7 D. Friedman6,7 and M. Reilly,8 on behalf of Members of RACRIG (Residential Aged Care Research Interest Group)* 1 Department of Infectious Diseases, Monash Health and 2Department Medicine, Monash University and 3Department of Infectious Diseases, Royal Melbourne Hospital and 4Department Medicine, University of Melbourne and 5VICNISS Coordinating Centre, Melbourne and 6Department Infectious Disease, Barwon Health and 7Department of Medicine, Deakin University, Geelong, Victoria and 8Hands-On Infection Control, Perth, Western Australia, Australia Key words residential care, infection control, antibiotic stewardship. Correspondence Rhonda L. Stuart, Infectious Diseases, Monash Health, 246 Clayton Road, Clayton, Melbourne, Vic. 3168, Australia. Email: [email protected] Abstract This study assessed infection prevention and antimicrobial stewardship (AMS) practices in Australian residential aged-care facilities (RACF). Two hundred and sixty-five surveys (15.6%) were completed with all states represented and the majority (177 (67.3%)) privately run. Only 30.6% RACF had infection control trained staff on site. Few facilities had AMS policies, only 14% had antimicrobial prescribing restrictions. Most facilities offered vaccination to residents (influenza vaccination rates >75% in 73% of facilities), but pneumococcal vaccination was poor. Received 25 August 2014; accepted 29 January 2015. doi:10.1111/imj.12740 © 2015 Royal Australasian College of Physicians 576 Brief Communications The term residential aged-care facilities (RACF) refers to a group of residential facilities designed to meet the needs of the elderly.1 These include nursing homes, skilled nursing facilities and assisted living facilities. The population in RACF is vulnerable to infection due to frailty, poor functional status, multiple comorbidities and compromised immune systems.2 Bed-bound residents are at greater risk of skin and soft tissue infections, while those with urine and/or faecal incontinence have an increased risk of urinary tract infections.3 In addition, close living proximity and frequent carer-resident contact facilitate the spread of organisms among RACF residents.2 This, coupled with frequent transfers to the acute hospital setting, promotes a higher infection burden among residents in RACF compared to those living at home.4 Although the infection burden among the RACF population has long been recognised, infection prevention efforts are often limited to sentinel infection surveillance activity. Of particular concern is the widespread empiric antibiotic prescribing in RACF that may lead to the emergence of antibiotic resistance. Studies have reported increasing use of broad-spectrum oral antibiotics, such as fluoroquinolones, among this population, with up to 75% of use judged to be inappropriate.5,6 In an era where multidrug-resistant organisms (MDRO) are emerging in the community, RACF residents have been increasingly identified as important reservoirs of such bacteria.7,8 In Australia, RACF are operated by not-for-profit organisations, church and charitable organisations, commercial organisations and some state and governments. To receive Australian Government subsidies, RACF are required to be accredited and meet four Accreditation Standards. ‘An effective infection control programme’ and ‘care recipients’ medication is managed safely and correctly’ are two of the 44 expected outcomes.9 The aim of this study was to document the infection prevention and antimicrobial stewardship practices in RACF around Australia. This will, in-turn, lend itself to developing an understanding of gaps to inform an ongoing research agenda. All RACF caring for low or high-level care residents (as defined by the Aged Care Funding Instrument),10 and having more than 50 beds were identified from a data*This group comprises members from The Healthcare Infection Control Special Interest Group (HICSIG), which is part of the Australian Society of Infectious Diseases (ASID), as well as members from the Australasian College for Infection Prevention and Control (ACIPC). Other Members of RACRIG: David Looke, John Ferguson, Judy Forrest, Luke Chen, Michelle Callard, Mike Richards, Mona Schousboe, Sandy Berenger, Daryl Pye, Mary Smith, Michael Wishart, Kirsty Buising. Funding: None. Conflict of interest: None. base held by the Commonwealth Department of Health. Managers of these facilities were contacted by email, and then a follow-up phone call, to ask if they would like to be involved in the survey. Details of contact numbers and email addresses for these sites are all publicly available on the Commonwealth Department of Health web site.10 The survey could be completed online or on paper and mailed back to the principal investigator. Surveys were sent to all available addresses, but we were unable to confirm that the intended addressee received the email unless they responded. Completion and submission of the survey implied consent. The survey was developed to enable RACF to answer questions in a de-identified manner on aspects of infection control and antimicrobial stewardship, that the members of the working group felt important. This included questions (in a checkbox format) on the population demographics of residents, the expertise and availability of infection control personnel, the availability of policies and procedures around infection control and antimicrobial stewardship, the type of infection surveillance that was undertaken in the facility and whether vaccination programmes were available for staff and residents. There were 40 questions in total, with the survey taking 5–10 min to complete. The RACF were invited once to complete the survey, there were no inducements offered for completion. Analysis was descriptive. The Commonwealth Departmental Ethics Committee approved the project. There were 265 surveys returned from a possible total pool of 1700 RACF (15.6%) with the majority (177 (67.3%)) being from private facilities. All States were represented with 81 (30.6%), 88 (33.2%), 43 (16.2%), 22 (8.3%), 16 (6%) and 14 (5.3%) of returned surveys coming from New South Wales, Victoria, Queensland, South Australia, Western Australia and Tasmania respectively. This total number of RACF beds per facility ranged from 50 to 250 (mean 90, median 77 beds). The total number of RACF beds covered by the survey was 22 335, with 15 725 (70.4%) being high care. Occupancy at the time of the study was 95% (range 45–100%; median 98%). Male residents accounted for 7230 occupants (32.4%) with 13 972 (62.6%) being greater than 85 years of age. Over the entire cohort, there were 776 residents (3.5%) with urinary catheters in situ and 22 (0.1%) with a vascular catheter in place, while 910 (4.1%) had been in an acute care facility in the previous 30 days. Two hundred and forty-two (91.3%) facilities had designated infection control personnel although only 30.6% (74) of these staff had any certification in infection control. Two hundred and sixteen (81.5%) facilities had an infection control committee. The availability of poli- © 2015 Royal Australasian College of Physicians 577 Brief Communications Table 1 Reported availability of procedures, surveillance undertaken and vaccine availability n (%) Procedure availability Management/isolation of MRSA carriers Management/isolation of VRE carriers Management/isolation of MDR-GN Wound management Management of urinary catheters Management of vascular catheters Management of enteral feeding Standard precautions Management/isolation of gastroenteritis Management/isolation of Clostridium difficile Cleaning rooms of MRO carriers Hand hygiene Antibiotic use Surveillance undertaken Non-catheter-associated urinary tract infection Catheter-associated urinary tract infection Blood stream infection Common cold/pharyngitis Influenza-like illness Lower respiratory tract infection/pneumonia Skin and soft tissue infection Skin condition, wounds and ulcers Eye infection Gastrointestinal infection Clostridium difficile infection MRSA infection VRE infection Use of transmission-based precautions where appropriate Contact (single room, gloves, gown) Droplet (single room, surgical mask) Airborne (negative pressure room, N95/P2 mask None Resident vaccinations available Influenza Pneumococcal Tetanus/diphtheria/pertussis Varicella-zoster No vaccines available Staff vaccines available Influenza Tetanus/diphtheria/pertussis Varicella-zoster Hepatitis B Measles/mumps/rubella QuantiFeron Gold/Mantoux testing No vaccines available 226 (85.9) 206 (78.3) 174 (66.2) 259 (98.5) 250 (95.1) 73 (27.8) 218 (82.9) 253 (96.2) 258 (98.1) 156 (59.3) 228 (86.7) 256 (97.3) 106 (40.3) 240 (92.7) 211 (81.5) 171 (66) 195 (75.3) 229 (88.4) 242 (93.4) 242 (93.4) 251 (96.9) 250 (96.5) 242 (93.4) 151 (58.3) 197 (76.1) 182 (70.3) 239 (91.6) 183 (70.1) 34 (13) 23 (8.8) 245 (96.1) 170 (66.7) 11 (4.3) 6 (2.6) 10 (3.9) 217 (86.5) 21 (8.4) 77 (30.7) 20 (8) 26 (10.4) 16 (6.4) 31 (12.4) MDR-GN, multidrug resistant Gram negative; MDRO, multidrug resistant organism; MRSA, methicillin resistant Staphylococcus aureus; VRE, vancomycin-resistant enterococcus. cies or procedures within the facility and the surveillance performed are outlined in Table 1. Alcohol-based hand rub (ABHR) was available in all publically accessible areas in 246 (95.4%) of facilities and Table 2 Recommendations for RACF in Australia Recommendation Align accreditation of RACF with national standards for the acute sector Develop database of policies and procedures for facilities to access Develop antimicrobial guidelines for common infections in RACF Develop surveillance programme for MDRO Enhanced immunisation Develop education packages for nursing staff Hand hygiene Cleaning and disinfection Examples Include a focus on • Infection prevention and control • Antimicrobial stewardship • Immunisation Standardised procedures for managing • MRSA colonisation • VRE colonisation • Management of urinary catheters • Multidrug-resistant Gram-negative colonisation • Clostridium difficile infection Suggested • Urinary sepsis with and without indwelling catheter • Respiratory tract infection • Skin and soft tissue infection Include Australia-wide focus on • Clostridium difficile • Multidrug-resistant Gram-negative bacteria • MRSA and VRE Increase vaccination rates • Influenza – resident • Influenza – healthcare workers • Pneumococcal vaccine – residents Diploma opportunities • Nurse practitioner role in RACF • Infection control in RACF Guideline development specific for RACF Guideline development specific for RACF MDRO, multidrug resistant organism; MRSA, methicillin resistant Staphylococcus aureus; RACF, residential aged-care facilities; VRE, vancomycinresistant enterococcus. resident bedrooms in 72 (27.9%). While four facilities (1.6%) did not have ABHR available at all. Antimicrobial prescribing was the role of general practitioners in all facilities, while 88 (33.6%) also had specialist consultants prescribing. Notification to the medical officer about resident illness and need for antibiotics was made by telephone in 254 (98.5%) via a communication book in 118 (45.7%) and in 16 cases (6.2%), the facility waited until the doctor made a routine visit. Notably, policies for antibiotic use were only available in 106 (40.3%) of facilities (Table 1), with only 36 (13.9%) stating there were any restrictions to prescribing. Local private pharmacies dispensed the majority of medications (222, 86%) with the remainder distributed through a hospital-associated pharmacy. Vaccination for residents and staff is summarised in Table 2. Influenza vaccination was available in 245 (96.1%) of facilities with vaccination rates in 2012–2013 reported as >75% in 190 (72.8%) facilities, 50–75% in 45 © 2015 Royal Australasian College of Physicians 578 Brief Communications (17.3%) and <50% in 26 (11%) of facilities. Although 170 (66.7%) facilities claimed that pneumococcal vaccination was available for residents, only 46 (20.7%) reported vaccination rates >75%, with 99 facilities (44.6%) reporting that the pneumococcal vaccination rate for residents was unknown. Staff influenza vaccination rates were >75% in 35 (13.6%), 50–75% in 66 (25.7%), 20–50% in 105 (40.9%) and <20% in 51 (19.8%) of facilities. This large survey of infection control and antimicrobial stewardship practices in RACF across Australia is the first of its kind to our knowledge. Infection control resources were evident across the services; however, most facilities did not have nursing staff possessing a higher certification in this area. Hand hygiene education and ABHR availability across all but a few facilities implies the importance placed on this as an infection control intervention, similar to that seen in the acute care sector.11 Surveillance activities for common infections in RACF was also generally undertaken although a lack of surveillance for Clostridium difficile was notable given the increasing concern there is for this disease.12 Additionally, we were unable to assess if standardised criteria were used for surveillance in these facilities – an area that requires further work. While the majority of facilities had procedures in place for common infections, the currency of these documents was not assessed in this study. In fact, some services commented that it would be beneficial for Australian RACF to have access to a bank of policies and procedures that could be modified to suit individual facilities. This could be an area for future investment and one that may assist RACF accreditation. The survey did not address auditing of these procedures. Antimicrobial stewardship is recognised as a vital component of infection control activities and has become part of National Standards for Accreditation in the Australian acute health sector. Recognition of AMS importance is References 1 Siegel JD, Rhinehart E, Jackson M, Chiarello L, the Healthcare Infection Control Practices Advisory Committee. 2007 guideline for isolation precautions: preventing transmission of infectious agents in healthcare settings. June, 2007 [cited 2014 Jul]. Available from URL: http://www.cdc.gov/ncidod/dhqp/pdf/ isolation2007.pdf 2 Garibaldi RA. Residential care and the elderly: the burden of infection. J Hosp Infect 1999; 43(Suppl): S9–18. also growing in residential care with increasing studies showing an urgent need for research in this area.6,13 Our survey supports the need to develop guidelines for antimicrobial use in RACF, to support facilities to enforce restrictions on prescribing and to develop a nationwide infection surveillance programme for MDRO. Improving influenza vaccination rates in the elderly decreases lower respiratory tract infection and decreases hospitalisation.14 This survey has shown room for improvement with 28% facilities declaring that <75% of their residents were vaccinated in the previous year. More concerning is the low influenza vaccination rates of healthcare worker in these facilities (only 13.6% achieving vaccination rates >75%). This is a trend seen Australia wide,15 but given that most evidence for the healthcare worker vaccine efficacy is in the residential care setting,16 it is an area that deserves urgent attention. Pneumococcal vaccination is recommended for those >65 years of age,17 and it is concerning that RACF do not place importance on knowing if residents are vaccinated. More research in the area of vaccination in RACF is required. A summary of recommendations from this study is presented in Table 2. A weakness of this study is the low response rate (15.6%) of total available services such as these data may not reflect all RACF across Australia. However, given that the survey does include 265 sites and over 22 000 beds, it is the largest study of its kind. Furthermore, the response rate is estimated from a possible pool of 1700 facilities with greater than 50 beds; however, we were not able to confirm that all facilities received the email invitation, thus the response rate is likely to be much higher. In summary, this large survey has uncovered some important areas for future research and quality improvement in RACF, namely AMS, immunisation of both residents and staff and the role that accreditation changes may have in these areas. 3 Nicolle LE, Strausbaugh LJ, Garibaldi RA. Infections and antibiotic resistance in nursing homes. Clin Microbiol Rev 1996; 9: 1–17. 4 Ingarfield SL, Finn JC, Jacobs IG, Gibson NP, Holman CDJ, Jelinek GA et al. Use of emergency departments by older people from residential care: a population based study. Age Ageing 2009; 38: 314–18. 5 Stuart RL, Kotsanas D, Webb B, Vandergraaf S, Gillespie EE, Hogg GG et al. Prevalence of antimicrobialresistant organisms in residential aged care facilities. Med J Aust 2011; 195: 530–3. 6 Lim CJ, McLellan SC, Cheng AC, Culton JM, Parikh SN, Peleg AY et al. Surveillance of infection burden in residential aged care facilities. Med J Aust 2012; 196: 327–31. 7 Rogers BA, Ingram PR, Runnegar N, Pitman MC, Freeman JT, Athan E et al. Community-onset Escherichia coli infection resistant to expanded-spectrum cephalosporins in low-prevalence countries. Antimicrob Agents Chemother 2014; 58: 2126–34. © 2015 Royal Australasian College of Physicians 579 Brief Communications 8 Pop-Vicas A, Tacconelli E, Gravenstein S, Lu B, D’Agata EMC. Influx of multidrug-resistant, gram-negative bacteria in the hospital setting and the role of elderly patients with bacterial bloodstream infection. Infect Control Hosp Epidemiol 2009; 30: 325–31. 9 Australian Government. Quality of care principles. 2014 [cited 2014 Jul]. Available from URL: http://www .comlaw.gov.au/Details/F2014L00830 10 Australian Government. Aged care. 2014 [cited 2014 Jul]. Available from URL: http://www.myagedcare.gov.au/ aged-care-homes 11 Grayson ML, Russo PL, Cruickshank M, Bear JL, Gee CA, Hughes CF et al. Outcomes from the first 2 years of the Australian National Hand Hygiene Initiative. Med J Aust 2011; 195: 615–19. 12 Slimings C, Armstrong P, Beckingham WD, Bull AL, Hall L, Kennedy KJ et al. Increasing incidence of Clostridium difficile infection, Australia, 2011–2012. Med J Aust 2014; 200: 272–6. 13 Stuart RL, Wilson J, Bellaard-Smith E, Brown R, Wright L, Vandergraaf S et al. Antibiotic use and misuse in residential aged care facilities. Intern Med J 2012; 42: 1145–9. 14 Loeb M, McGeer A, McArthur M, Walter S, Simor AE. Risk factors for pneumonia and other lower respiratory tract infections in elderly residents of long-term care facilities. Arch Intern Med 1999; 159: 2058–64. 15 Seale H, MacIntyre CR. Seasonal influenza vaccination in Australian hospital health care workers: a review. Med J Aust 2011; 195: 336–8. 16 Talbot TR, Babcock H, Caplan AL, Cotton D, Maragakis LL, Poland GA et al. Revised SHEA position paper: influenza vaccination of healthcare personnel. Infect Control Hosp Epidemiol 2010; 31: 987–95. 17 Australian Government. The Australian Immunisation Handbook. Canberra: Australian Government, Department of Health; 2014; 1–546. Long-term follow up of paediatric liver transplant recipients: outcomes following transfer to adult healthcare in New Zealand R. Harry,1 C. Fraser-Irwin,2 S. Mouat,2 E. Gane,1 S. Munn1 and H. M. Evans2 1 New Zealand Liver Transplant Unit (NZLTU), Auckland City Hospital and 2Department of Paediatric Gastroenterology, Starship Hospital, Auckland, New Zealand Key words paediatrics, liver transplantation, transition to adult care, patient non-adherence. Correspondence Rachael Harry, New Zealand Liver Transplant Unit, Auckland City Hospital, 1023, Auckland, New Zealand. Email: [email protected] Abstract Poor outcomes are reported in young people with chronic health conditions. We performed a retrospective notes review of New Zealand paediatric liver transplant recipients transferred to adult services. Two patients were lost to follow up. Out of 20, 12 were non-adherent, and out of 12, 7 developed rejection. Other risk behaviours were common in the non-adherent group. We conclude that dedicated services for these young people may be needed to optimise outcomes. Received 22 October 2014; accepted 28 January 2015. doi:10.1111/imj.12721 Adolescents and young people who have chronic health conditions are at increased risk of poor health and social outcomes compared with those who do not.1,2,3 This has been demonstrated among young people who were recipients of solid organ transplants as children. Among Funding: None. Conflict of interest: None. young people who have received renal transplants in childhood, graft loss is reported as between 35% at 2 years following transfer to adult services4 and 67% at 4 years5. In liver transplant populations, others have shown adherence with investigations, clinic appointments and medication is compromised in patients who transfer to adult care.6 Such non-adherence is not uniform but has been shown to be associated with low © 2015 Royal Australasian College of Physicians 580 Brief Communications socioeconomic status, single parenting, psychiatric diagnoses, school dropout, substance abuse and child abuse.7 Ultimately, non-adherence in liver transplant recipients may be associated with late rejection, graft loss, re-transplantation or death.8 Young people with chronic illness are also more likely to engage in risk-taking behaviours such as smoking, drinking alcohol, taking drugs and unprotected sex and are more likely to come to harm as a result of them.2 The long-term outcome of paediatric liver transplant recipients after transfer to adult services in New Zealand has not been previously reported. As such, the clinical notes were reviewed retrospectively of New Zealand paediatric liver transplant recipients born before 1998 who had been planned to transfer to adult services prior to 31 December 2012 (i.e. aged over 14 years). Data were retrieved from New Zealand Liver Transplant Unit (NZLTU) and Starship Hospital databases whether transplanted in New Zealand or abroad. Prior to 2002, when the paediatric liver transplant service started at Starship Hospital, Auckland, paediatric liver transplant recipients underwent assessment and transplantation in Brisbane, Australia. This was granted institutional approval by the Auckland DHB research review committee. Demographic data were recorded from clinical record or NZLTU databases including ethnicity, age and diagnosis at transplant. The following outcomes occurring following transfer to adult services were sought: 1. Non-adherence with medication as evidenced by undetectable tacrolimus levels, self-report or report by others of non-adherence in the clinical record or episodes of rejection attributed to non-adherence by treating physicians. 2. Health outcomes such as rejection (biopsy proven or as defined by treating physicians) admissions with rejection, mental health diagnoses, graft loss and death 3. Social outcomes, such as drug and alcohol use, unplanned pregnancy and legal issues as reported in the clinical record. The data are reported in two groups based on the presence or absence of evidence of non-adherence as median and ranges. A total of 60 New Zealand paediatric liver transplant recipients who underwent liver transplantation before 1998 was identified from NZLTU and Starship Hospital databases. Of these, nine had died post-transplant, six had moved abroad, four had been lost to follow up (presumed to be abroad) and six were still in paediatric care. There were 13 young people in the process of transition through the newly established young person’s liver clinic. Table 1 Demographic data and health outcomes Number NZE Age at Tx Time Tx to transfer Age at transfer NA bloods/clinics Late rejection Multiple episodes Mental health Ongoing healthcare engagement Adherent Non-adherent 8 8 (100%) 5 years (1–16) 5 years (1–9) 16.5 years (16–19) 0 0 0 0 8 (100%) 12 8 (66%) 2 years (1–13) 3 years (1–9) 17 years (15–18) 10 (83%) 7 (58%) 3 (25%) 5 (42%) 5 (42%) NA, non-attendance; NZE, New Zealand European; Tx, transplant. The remaining 22 patients had planned to be transferred directly from paediatrics to adult health services without being involved in any formal transition pathway or youth specific service. Data were available on 20 of these, as two were lost to follow up at or shortly after transfer. These data are summarised in Table 1. A total of 16 young people was New Zealand European (NZE) and four were New Zealand Maori or Pacific Islander. The median time after transplant was 17 years (range 4–27 years) and the median age was 21.5 years (range 17–30 years). Out of 20, 12 (60%) of these patients had evidence of non-adherence following transfer. The four non-NZE young people all had evidence of non-adherence in their record. Of those who were non-adherent, 7/12 (58%) had either suspected or biopsy proven rejection. Three of these young people had multiple episodes of rejection requiring hospitalisation. Overall, 35% of the nonadherent group had evidence of rejection, whereas no patients who were thought to be adherent had late rejection. No patients in this series required re-transplantation or died. Other risk behaviours, such as alcohol and substance use, are common in the group of patients with evidence of non-adherence and are not reported in the group presumed to be adherent (Fig. 1). Young people in the non-adherent group were also suboptimally engaged with healthcare with 10 young people in the non-adherent group (83%) reported to be suboptimally adherent with attendance at clinics or monitoring blood tests. At the time of data collection, only 42% of the non-adherent group were receiving regular secondary or tertiary healthcare in New Zealand (Table 1). Other health risks were reported in the nonadherent group. Of this group, 42% carried mental © 2015 Royal Australasian College of Physicians 581 Brief Communications Figure 1 Substance use in the non-adherent group. ( ), Alcohol; ( ), alcohol and drugs; ( ), alcohol, drugs and legal issues; ( ), no substance use. health diagnoses resulting in one intentional overdose. Six pregnancies are reported in four young women in the non-adherent group. Two young women had terminations aged 18 years, one also had an unplanned pregnancy at 19 years. Three live births were reportedin patients aged 20, 22 and 22 years where intent related to pregnancy was not reported. In the group of patients with no evidence of non-adherence, there was one pregnancy reported to be intentional. In conclusion, these data comprise a retrospective notes review of patients who underwent paediatric liver References 1 Sawyer SM, Drew S, Yeo MS, Britto MT. Adolescents with a chronic condition: challenges living, challenges treating. Lancet 2007; 369: 1481–9. 2 Denny S, Farrant B, Cosgriff J, Harte M, Sheridan J, Robinson E. Forgone health care among secondary school students in New Zealand. J Prim Health Care 2013; 5: 11–18. 3 Denny S, de Silva M, Fleming T, Clark T, Merry S, Ameratunga S et al. The prevalence of chronic health conditions transplantation and were subsequently transferred to adult services. There are limitations to these data, including the under reporting of non-adherence and other risk behaviours that are inherent in retrospective clinical record reviews and the potential over reporting of risk behaviours in the non-adherent group, as these may have been specifically sought where they were not in the adherent group. Notwithstanding the limitations of this retrospective study, we found that reported non-adherence with medication is common in paediatric liver transplant recipients following transfer to adult services in New Zealand. Nonadherence was reported in two out of three patients, of whom two out of three subsequently suffered harm as a consequence of rejection. Despite the flaws in the data, we confirm that in this population, non-adherence occurs as part of a constellation of risk behaviours, including alcohol and drug use, unintentional pregnancy, mental health diagnoses and legal issues. Dedicated services for young people have been shown to improve outcomes for paediatric renal transplant recipients in the UK.5 These data demonstrate that there may be a need for improved services for young people with chronic health conditions, including solid organ transplants, in New Zealand. A holistic approach that not only addresses the presenting medical condition, but also provides culturally and developmentally appropriate care may improve longterm medical and social outcomes for these young people. impacting on daily functioning and the association with emotional well-being among a national sample of high school students. J Adolesc Health 2014; 54: 410–15. 4 Watson AR. Non-compliance and transfer from paediatric to adult kidney transplant unit. Pediatr Nephrol 2000; 14: 469–72. 5 Harden PN, Walsh G, Bandler N, Bradley S, Lonsdale D, Taylor J et al. Bridging the gap: an integrated paediatric to adult clinical service for young adults with kidney failure. BMJ 2012; 344: e3718. 6 Burra P. The adolescent and liver transplantation. J Hepatol 2012; 56: 714–22. 7 Lurie S, Shemesh E, Sheiner PA, Emre S, Tindle HL, Melchionna L et al. Non-adherence in pediatric liver transplant recipients – an assessment of risk factors and natural history. Pediatr Transplant 2000; 4: 200–6. 8 Mohammad S, Hormaza L, Neighbors K, Boone P, Tierney M, Azzam RK et al. Health status in young adults two decades after pediatric liver transplantation. Am J Transplant 2012; 12: 1486–95. © 2015 Royal Australasian College of Physicians 582 Brief Communications Primary central nervous system posttransplantation lymphoproliferative disorder after heart and lung transplantation G. Gifford,1 K. Fay,1,2 A. Jabbour3,4,5 and D. D. Ma1,4,6 1 Haematology Department and 3Cardiology Department, St Vincent’s Hospital, 2Haematology Department, Royal North Shore Hospital, 4Faculty of Medicine, University of New South Wales, 5Clinical Faculty, Victor Chang Cardiac Research Institute, and 6St Vincent’s Centre for Applied Medical Research, Sydney, New South Wales, Australia Key words posttransplant lymhpoproliferative disorder, central nervous system, lymphoma, heart, lung, transplantation. Correspondence David D. Ma, Haematology, St Vincent’s Hospital, 390 Victoria Street, Darlinghurst, Sydney, NSW 2010, Australia. Email: [email protected] Received 4 September 2014; accepted 28 February 2015. Abstract Primary central nervous system posttransplantation lymphoproliferative disorder (PCNS-PTLD) is uncommon, especially after heart or lung transplantation. Database analysis from a single heart and lung transplantation centre and a literature review pertaining to PCNS-PTLD was performed. In this study, the prevalence of PCNS-PTLD was 0.18% after heart and/or lung transplants. Of 1674 transplants, three cases of PCNS-PTLD developed 14 months, 9 years and 17 years posttransplant, and all were Epstein–Barr virus driven malignancies. Literature review of the topic revealed predominantly retrospective studies, with most reported cases after renal transplantation. The overall survival is poor, and it may be improved by early diagnosis and treatment. There are no published guidelines on the management of PCNS-PTLD; immunechemotherapy in conjunction with reduction of immune suppression is preferred based on available evidence. doi:10.1111/imj.12735 Primary central nervous system posttransplantation lymphoproliferative disorder (PCNS-PTLD) is uncommon, and its occurrence after heart or lung transplantation is unknown. PCNS-PTLD presents in a plethora of ways with broad differential diagnoses. Management of this condition in transplant recipients is challenging. There is no consensus on treatment due to its rarity. This report describes all identified cases of PCNS-PTLD in a single institution that performs heart and lung transplantation over 28 years and its prevalence. The approaches to the management of PCNS-PTLD based on published evidence are summarised. Case 1: A 64-year-old man presented with urinary incontinence, dysphasia, personality changes and memory loss 14 months after heart transplantation for transthyretin amyloid cardiomyopathy. He was on prednisolone, mycophenolate and cyclosporin. Magnetic resonance imaging (MRI) revealed bilateral lesions in the frontotemporal areas. Neurosurgery relieved the associated raised intracranial pressure and obtained histology; monomorphic PTLD, variant diffuse large B cell lymphoma (DLBCL) that was angioinvasive and Epstein-Barr Funding: St Vincent’s Haematology Research Trust. Conflict of interest: St Vincent’s Hospital. virus (EBV)–encoded RNA (EBER) positive. There was no systemic involvement on computed tomography (CT) and positron electron tomography (PET). Cyclosporin and prednisone were reduced, mycophenolate replaced by everolimus. Intravenous rituximab was administered weekly for 4 weeks resulting in rapid clinical and radiological improvement. The patient then completed six cycles of high-dose methotrexate (HD-MTX). The patient remains alive at 18 months, with complete clinical recovery, no evidence of tumour on MRI and a normal functioning cardiac allograft. Case 2: A 56-year-old man who received double lung transplantation for α1-antitrypsin deficiency developed gradual diplopia and ataxia 9 years posttransplant. He was immunosuppressed with prednisolone, tacrolimus and mycophenolate mofetil. Imaging showed a circumferential cerebellar lesion surrounding the fourth ventricle. Emergency decompressive neurosurgery to relieve raised intracranial pressure also provided a histological diagnosis of monomorphic PTLD, variant DLBCL. The lymphoma was angio-invasive and EBER positive. There was no systemic involvement CT and PET. Tacrolimus and mycophenolate were reduced and the patient received one dose of intravenous rituximab. The patient rapidly deteriorated and died within a month of his diagnosis. © 2015 Royal Australasian College of Physicians 583 Brief Communications Case 3: A 70-year-old man presented with a 4-month history of progressive ataxia and headache 17 years after heart transplantation for idiopathic dilated cardiomyopathy. He was immunosuppressed with mycophenolate and cyclosporin. Multiple cerebral masses with surrounding oedema and midline shift were detected on cerebral imaging. An EBER positive, large B cell PCNS-PTLD was diagnosed, subtype not classified due to extensive necrosis. There was no systemic involvement on CT and PET. Everolimus replaced cyclosporin. His performance status was poor and he received one fraction of palliative whole brain radiation therapy. He died within a month of his diagnosis. Immunosuppression for heart and lung transplantation typically included corticosteroids, a calcineurin inhibitor and a nucleotide antagonist. Immunosuppression is typically more intense and prolonged for recipients for heart and lung transplantation, due to the higher incidence of allograft rejection. For all patients in our institution, immunosuppressive drugs were dosed according to pharmacokinetic measurement, with therapeutic ranges for heart and lung transplant for tacrolimus 10–15 ug/L; cyclosporin trough therapeutic level varied according to time after transplant, with a target of 100–180 ug/L a year after transplantation; mycophenolate mofotil 2.5– 4.5 mg/L; sirolimus 3.5–15 ug/L. In this single centre study of 1674 heart and/or lung transplantation recipients (857 heart, 151 single lung, 583 bilateral lung and 83 heart-lung), three were identified to have PCNS-PTLD during a 28-year period from 1984 to 2012, yielding a prevalence of 0.18%. The transplantation recipients are routinely reviewed in a multidisciplinary clinic with a prospectively maintained departmental database, and local registry, so that the prevalence is accurate. This study is the first to establish prevalence for PCNS-PTLD after solid organ transplant. PTLD ranges from polyclonal proliferations to monomorphic forms indistinguishable from those which occur in immunocompetent individuals. The major risk factors for PTLD are immunosuppression and primary EBV infection.1 Higher incidences of PTLD are thus observed in lung transplantation recipients who often remain heavily immunosuppressed, and in EBVseronegative patients receiving an allograft from an EBVseropositive donor. PTLD has a bimodal distribution; most cases of PTLD occur within a year of transplantation,1 and these cases are more likely to involve the allograft.2 PTLD that occur late are more commonly disseminated, EBVnegative, monomorphic and carry a worse prognosis.3–5 The incidence of PCNS-PTLD is unknown, and older series have included systemic PTLD with CNS involvement. In a series of 639 heart and/or lung transplantation recipients, two developed PCNS-PTLD.6 PCNS-PTLD in the published literature is predominantly reported in small case series after renal transplantation, the commonest solid organ transplanted. The interval from transplantation to diagnosis of PCNS-PTLD has been reported to range from 3 months to 5 years.7,8 The prognosis of PCNS-PTLD is varied and best described after renal transplantation. A case series of 25 patients reported overall survival of 40% with a median survival time of 26 months.9 In recent international reports, median survival was 47 months in a series of 34 patients,8 while the largest series of 84 PCNS-PTLD reported an overall survival of 43%.10 In the joint British Committee for Standards in Haematology and British Transplantation Society Guidelines for Management of PTLD in Adult Solid Organ Transplant Recipients,11 reduction in immunosuppression followed by local radiotherapy with or without steroids, and addition of HD-MTX for young, fit patients are recommended as grade C, level 3 evidence. Otherwise, survey of the literature yields neither guidelines nor consensus documents on how to treat PCNS-PTLD. It may not be unreasonable to extrapolate from the treatment of PCNSL to PCNS-PTLD. PCNSL is chemosensitive and radiosensitive, and its treatment has been rigorously studied. However, patients with PCNS-PTLD often have comorbidities precluding the application of standard PCNSL treatment protocols. Recommendations for the treatment of systemic PTLD might be insufficient or inappropriate for PCNS-PTLD. Reducing immunosuppression in PTLD is recommended,1 as the attenuation or withdrawal of immunosuppression allows restitution of immunity, especially against EBV. Reducing immunosuppression alone has been reported to induce remission in low grade, systemic PTLD.12 Reduction of immunosuppression needs to be gradual to prevent allograft rejection, a timeframe that is not feasible in PCNS-PTLD due to raised intracranial pressure. Surgery is directed at obtaining histological diagnosis and for cerebral decompression. It otherwise has little therapeutic role. Whole-brain or focal radiation therapy is administered alone or in combination for treatment of PCNSL or to palliate symptoms.13 For PCNS-PTLD, radiation dosages and schedules have been extrapolated from PCNSL and human immunodeficiency virus and acquired immunodeficiency syndrome-related lymphoma. Acute and longterm neurotoxicity from radiation therapy limits this treatment. Systemic chemotherapy has improved outcomes for PTLD,3 but the blood brain barrier limits the choice of agents for PCNS-PTLD. Extrapolating from PCNSL studies, HD-MTX and cytarabine have been successfully © 2015 Royal Australasian College of Physicians 584 Brief Communications used to treat PTLD-CNS.12,14 Complex medical comorbidities and poor performance status prevent the administration of systemic chemotherapy in many PCNS-PTLD patients. Therapy with intravenous rituximab has improved overall survival for patients who develop systemic PTLD.15 Although only a small fraction of the systemic dose is detectable in cerebrospinal fluid,16 rituximab remains effective as monotherapy in PCNSL because of its long half-life, resulting in low yet stable therapeutic concentrations over time.17 Sequential treatment of rituximab followed by chemotherapy has also been validated.18 Direct administration of rituximab into the central nervous system either through an Ommaya reservoir or repeat lumbar punctures is the topic of ongoing research. A small study showed that intrathecal rituximab was efficacious in heavily pretreated patients with nonHodgkin lymphoma who have CNS disease.19 Intrathecal rituximab has been successful in some paediatric sufferers with PCNS-PTLD.20 However, accessing the intrathecal space might be inadvisable in patients with raised intrac- References 1 Heslop HE. How I treat EBV lymphoproliferation. Blood 2009; 114: 4002–8. 2 Bakker NA, van Imhoff GW, Verschuuren EA, van Son WJ, Homan van der Heide JJ, Veeger NJ et al. Early onset post-transplant lymphoproliferative disease is associated with allograft localization. Clin Transplant 2005; 19: 327–34. 3 Quinlan SC, Pfeiffer RM, Morton LM, Engels EA. Risk factors for early-onset and late-onset post-transplant lymphoproliferative disorder in U.S. kidney recipients. Am J Hematol 2011; 86: 206–9. 4 Paranjothi S, Yusen RD, Kraus MD, Lynch JP, Patterson GA, Trulock EP. Lymphoproliferative disease after lung transplantation: comparison of presentation and outcome of early and late cases. J Heart Lung Transplant 2001; 20: 1054–63. 5 Ghobrial IM, Habermann TM, Macon WR, Ristow KM, Larson TS, Walker RC et al. Differences between early and late posttransplant lymphoproliferative disorders in solid organ transplant patients: are they two different diseases? Transplantation 2005; 79: 244–7. 6 Wudhikarn K, Holman CJ, Linan M, Blaes AH, Dunitz JM, Hertz ME et al. 7 8 9 10 11 ranial pressure. In summary, the current literature suggests that in conjunction with reduction in immunosuppression, immune-chemotherapy should be first line treatment due to its efficacy and minimisation of neurotoxicity. In our series, the prevalence of PCNS-PTLD was low. PCNS-PTLD were high-grade, aggressive, monomorphic, EBV-driven malignancies that presented with neurological symptoms and occurred late after transplantation. Histology was required for diagnosis. PCNS-PTLD after heart and/or lung transplantation may become more common in the future, as recipients live longer due to improvements in transplantation techniques and posttransplant care. Although PCNS-PTLD is rare, it should be included in the differential diagnosis of heart and/or lung transplantation recipients who present with neurological symptoms and signs. The management of PCNS-PTLD is currently extrapolated from PCNSL and PTLD as clinical trials are very difficult to conduct in this patient population. Post-transplant lymphoproliferative disorders in lung transplant recipients: 20-yr experience at the University of Minnesota. Clin Transplant 2011; 25: 705–13. Phan TG, O’Neill BP, Kurtin PJ. Post-transplant primary CNS lymphoma. Neuro-Oncol 2000; 2: 229–38. Cavaliere R, Petroni G, Lopes MB, Schiff D, the International Primary Central Nervous System Lymphoma Collaborative Group. Primary central nervous system post-transplantation lymphoproliferative disorder. Cancer 2010; 116: 863–70. Snanoudj R, Durrbach A, Leblond V, Caillard S, Hurault De Ligny B, Noel C et al. Primary brain lymphomas after kidney transplantation: presentation and outcome. Transplantation 2003; 76: 930–7. Evens AM, Choquet S, Kroll-Desrosiers AR, Jagadeesh D, Smith SM, Morschhauser F et al. Primary CNS posttransplant lymphoproliferative disease (PTLD): an international report of 84 cases in the modern era. Am J Transplant 2013; 13: 1512–22. Parker A, Bowles K, Bradley JA, Emery V, Featherstone C, Gupte G et al. Diagnosis of posttransplant lymphoproliferative disorder in solid organ transplant recipients – BCSH and 12 13 14 15 16 BTS guidelines. Br J Haematol 2010; 149: 674–95. Tsai DE, Hardy CL, Tomaszewski JE, Kotloff RM, Oltoff KM, Somer BG et al. Reduction in immunosuppression as initial therapy for posttransplant lymphoproliferative disorder: analysis of prognostic variables an long-term follow-up of 42 adult patients. Transplantation 2001; 71: 1076–88. Ferreri AJM. How I treat primary CNS lymphoma. Blood 2011; 118: 510–22. Ferreri AJ, Reni M, Foppoli M, Martelli M, Pangalis GA, Frezzato M et al. High-dose cytarabine plus high-dose methotrexate versus high-dose methotrexate alone in patients with primary CNS lymphoma: a randomised phase 2 trial. Lancet 2009; 31: 1512–20. Choquet S, Leblond V, Herbrecht R, Socié G, Stoppa AM, Vandenberghe P et al. Efficacy and safety of rituximab in B-cell post-transplantation lymphoproliferative disorders: results of a prospective multicenter phase 2 study. Blood 2006; 107: 3053–7. Kikuchi A, Kawada H, Iwaki Y, Machida S, Tsuchiya T, Fukuda R et al. Measurement of rituximab concentration in the cerebrospinal fluid in CNS lymphoma. Rinsho Ketsueki 2004; 45: 1255–7. © 2015 Royal Australasian College of Physicians 585 17 Rubenstein JL, Combs D, Rosenberg J, Levy A, McDermott M, Damon L et al. Rituximab therapy for CNS lymphomas: targeting the leptomeningeal compartment. Blood 2003; 101: 466–8. 18 Trappe R, Oertel S, Leblond V, Mollee P, Sender M, Reinke P et al. Sequential treatment with rituximab followed by CHOP chemotherapy in adult B-cell post-transplant lymphoproliferative disorder (PTLD): the prospective international multicentre phase 2 PTLD-1 trial. Lancet Oncol 2012; 13: 196–206. 19 Rubenstein JL, Fridlyand J, Abrey L, Shen A, Karch J, Wang E et al. Phase I study of intraventricular administration of rituximab in patients with recurrent CNS and intraocular lymphoma. J Clin Oncol 2007; 25: 1350–6. 20 Bonney DK, Htwe EE, Turner A, Kelsey A, Shabani A, Hughes S et al. Sustained response to intrathecal rituximab in EBV associated post-transplant lymphoproliferative disease confined to the central nervous system following haematopoietic stem cell transplant. Paediatr Blood Cancer 2012; 58: 459–61. L E T T E R S TO T H E E D I TO R Clinical-scientific notes Bilateral cordotomy post-failure of intrathecal analgesia in a palliative care setting A 60-year-old man was referred to a tertiary palliative care unit with poorly controlled right hip pain. He was diagnosed in 2009 with a large solitary right hip metastasis from a poorly differentiated pulmonary neuroendocrine tumour. Over a 5-year period he was given seven lines of chemotherapy and three courses of radiotherapy (total of 121 Gy in 63 fractions) to this metastasis. The patient’s analgesic regimens failed to stabilise his pain, despite opioid rotations and recognised coanalgesics. Unfortunately, analgesic up-titration caused increasing drowsiness, which limited his mobility. He also had an aversion to hospitals, exacerbated by anxiety, but increasing pain persuaded him to consent to inpatient intrathecal analgesia. Ongoing support from his family was vital during his admission. An intrathecal catheter was inserted in late January 2014. While initially effective, the management lacked sustained efficacy despite significant dose increases. The infusion was ceased after 12 days, following a multidisciplinary plan for a cordotomy. An open bilateral cordotomy via a T1/T2 laminectomy was performed with an excellent result. The patient had no right leg pain post-procedure, and only minor wound pain; postoperative analgesia is outlined in Table 1. Lower limb power remained intact; however, due to deconditioning, he was limited to stand-transfers and also developed urinary incontinence. Following a 5-week period of rehabilitation, he was discharged home with his family, remaining comfortable and with improved mobility. Unfortunately, after 2 months he deteriorated and required a 2-week hospital admission for end-of-life care. Despite the best systemic management of cancer pain, up to 10% of patients have inadequate analgesia.1 Intrathecal catheter insertion and cordotomy are two analgesic procedures appropriate for medically refractory cancer pain. There is no current consensus of when and in whom cordotomies should be performed. However, medically refractory, unilateral nociceptive pain, where prognosis is less than 1 year is deemed appropriate.2 Holistic multidisciplinary care is essential to manage pain and recognise suitable cordotomy candidates.2,3 While percutaneous cordotomy is recognised as an effective and less invasive technique, the neurosurgical expertise at our centre is in open cordotomy.4 The open cordotomy procedure is performed under general anaesthetic via a laminectomy technique. Open surgical exposure allows mechanical interruption of the lateral spinothalamic tract at the upper thoracic level.1,3 In contrast, the percutaneous procedure is performed under local anaesthetic, where a radiofrequency heat lesion interrupts the lateral spinothalamic tract at the C1/C2 level.4 Open cordotomy is less commonly performed, causes more extensive lesions and is less selective than the percutaneous procedure; however, it decreases the risk of respiratory compromise.1 Complications of both procedures include: paresis or ataxia, worsening micturition control (as in the present case), post-cordotomy dysesthesia and mirror pain.5 The patient was appropriate for a bilateral approach given his high risk of developing contralateral © 2015 Royal Australasian College of Physicians 586 Letters to the Editor Table 1 Analgesic requirements Drugs Oral morphine equivalent dose† Morphine (oral) Morphine (subcut) Morphine (intrathecal) Hydromorphone (oral) Hydromorphone (subcut) Bupivocaine – intrathecal Methadone – oral Midazolam (subcut) Midazolam (intrathecal) Ketamine – CSCI Diclofenac Pre-intrathecal maximum dose 622.5‡ Post-intrathecal Pre-cordotomy 3 days post-cordotomy 3307.75 mg§ (1489–9503 mg) 120 mg (90–180 mg) 60 mg 70 mg — — — — 75 mg — — — 50 mg — 11.25 mg (5–45 mg) 10 mg (4–30 mg) — 12 mg (0 mg–12 mg) 150 mg (120–200 mg) 20 mg (20–40 mg) 20 mg (10–35 mg) 10 mg (5–10 mg) 200 mg¶ (0–200 mg) 50 mg (50–75 mg) — 30 mg (20–40 mg) — — 2 mg (2–4 mg) — — 5 mg (0–5 mg) — 150 mg (100–200 mg) 100 mg (50–100 mg) 2 weeks post-cordotomy EOLC – 3 months post-cordotomy 176.5 mg (112–194 mg) 1230 mg (255–1500 mg) — 20 mg (20–20 mg) — 4.5 mg (1–8 mg) — — 20 mg (10–20 mg) — — — — — — — — 82 mg (17–100 mg) — — 47.5 mg (7.5–85 mg) — — — †Morphine – oral : subcut: intrathecal = 3:1:0.01; hydromorphone : morphine = 1:5; methadone oral : morphine oral 1:4.7 (Knotkova, Fine & Portenoy – see references). ‡Calculated from admission notes – median dose not available. §All doses are presented as median dose and range unless otherwise specified. ¶Started post-intrathecal failure. CSCI, continuous subcutaenous infusion; EOLC, end-of-life care. pain requiring a further cordotomy.6 This case study demonstrates the beneficial use of cordotomy, once intrathecal and other non-procedural analgesia have failed. Unfortunately, the availability of cordotomy remains dependent on appropriately skilled neurosurgeons.2 Further research should better elucidate the use of cordotomy in this important group of patients. References 1 Atkin N, Jackson KA, Danks RA. Bilateral open thoracic cordotomy for refractory cancer pain: a neglected technique? J Pain Symptom Manage 2010; 39: 924–9. 2 Honey C, Yeomans W, Isaacs A, Honey CM. The dying art of percutaneous cordotomy in Canada. J Palliat Med 2014; 17: 624–8. Received 10 September 2014; accepted 2 October 2014. doi:10.1111/imj.12743 S. P. M. Hosking,1 M. E. Franco,1,2 P. Poon1,2,4 and L. William1,2,3 1 Supportive and Palliative Care Unit, Monash Medical Centre, Monash Health and 2Faculty of Medicine, Monash University and 3 Palliative Care Department, Eastern Health and 4Eastern Palliative Care Association, Melbourne, Victoria, Australia 3 Viswanathan A, Bruera E. Cordotomy for treatment of cancer-related pain: patient selection and intervention timing. Neurosurg Focus 2013; 35: E6. 4 Bain E, Hugel H, Sharma M. Percutaneous cervical cordotomy for the management of pain from cancer: a prospective review of 45 cases. J Palliat Med 2013; 16: 901–7. 5 Jones B, Finlay I, Ray A, Simpson B. Is there still a role for open cordotomy in cancer pain management? J Pain Symptom Manage 2003; 25: 179–84. 6 Vissers KCP, Besse K, Wagemans M, Zuurmond W, Giezeman MJ, Lataster A et al. 23. Pain in patients with cancer. Pain Pract 2011; 11: 453–75. © 2015 Royal Australasian College of Physicians 587 Letters to the Editor Serum creatinine is not the end-all, be-all of renal impairment A 52-year-old African American man with no medical history presented as a referral to the nephrology clinic for evaluation of renal dysfunction. The patient was an active body builder in good health. He had blood pressure of 110/70 mmHg and heart rate of 70 b.p.m., and his physical examination was remarkable for an extremely muscular physique with no evidence of central obesity. He weighed 220 lb with a body mass index of 30.4 kg/m2 and body surface area of 2.25 m2. He reported taking injectable testosterone cypionate to build muscle for the past 1 year. Initial laboratory measurements revealed a blood urea nitrogen (BUN) of 3.9 mmol/L, a serum creatinine of 141.4 μmol/L and an estimated glomerular filtration rate (eGFR) of 50 mL/ min/1.73 m2. Repeat serum BUN/creatinine/eGFR did not reveal a significant variation from the initial evaluation of renal function on day 1 (Table 1). Urinalysis was negative for haematuria, proteinuria or pyuria. Since the patient’s only abnormality was an elevated serum creatinine, we used several methods to measure his ‘true GFR’. First, the 24-h urine collection revealed a creatinine clearance of 131 mL/min (urine volume 1500 mL). Second, the GFR was estimated at 140.2 mL/min from a dynamic radionuclide study by measuring Tc-99m DTPA uptake within the kidneys. Last, cystatin C was measured at Table 1 Laboratory parameters during clinic visit BUN (mmol/L) Creatinine (μmol/L) Urine protein/creatinine ratio (mg/mmol) 24 h protein (mg/day) 24 h creatinine excretion (mmol) 24 h volume (L) eGFR MDRD (mL/min/1.73 m2) Tc GFR (mL/min) 24 h creatinine clearance (mL/min) 24 h creatinine clearance (mL/min/1.73 m2) Cystatin C (mg/L) Day 1 Day 5 Day 21 3.9 141.4 6.7 4.6 141.4 6.7 157.5 26.5 1.5 50.3 140 131 110 5.0 132.6 5.6 50.3 1 Wang ZM, Gallagher D, Nelson ME, Matthews DE, Heymsfield SB. Total-body skeletal muscle mass: evaluation of 24-h urinary creatinine excretion by computerized axial tomography. Am J Clin Nutr 1996; 63: 863–9. Received 25 September 2014; accepted 22 October 2014. 57.5 doi:10.1111/imj.12733 1 S. K. Mallipattu, J. Ling2 and J. Uribarri3 0.76 BUN, blood urea nitrogen; eGFR, estimated glomerular filtration rate; MDRD, modification of diet in renal disease. References 0.76 mg/L (normal range 0.5–1.0 mg/L). These three independent measurements of a normal GFR confirmed our suspicion that this patient had an elevated serum creatinine in the absence of renal impairment. In clinical practice, a serum creatinine greater than the upper limit of normal is taken as prima facie evidence of decreased GFR and therefore impaired renal function. The use of the modification of diet in renal disease (MDRD) equation to estimate GFR strengthens this interpretation since a high serum creatinine will invariably calculate a decreased GFR. The diagnosis of decreased GFR will label the patient as having chronic kidney disease, a diagnosis with significant clinical, psychological and financial repercussions. The rate of creatinine production is directly associated with skeletal muscle mass and to a lesser extent with meat intake. For instance, cross-sectional studies in healthy adult males demonstrate that the mean ratio of skeletal muscle mass to 24-h creatinine excretion is 21.8 kg/g.1 Also, the administration of 3 mg/kg/week of testosterone increases the skeletal muscle mass and 24-h creatinine excretion by 20% within a short 12-week period.2 Furthermore, muscle mass is a strong determinant of eGFR in normal healthy male subjects, independent of body fat or protein intake.3 This is clearly exaggerated in our patient who had a significantly large muscle mass with a high 24-h creatinine excretion (Table 1). This concept is not accounted for in the widely used eGFR from the MDRD equation. In addition to the radioisotope studies and 24-h creatinine clearance measurements to measure GFR, cystatin C production is a better marker of renal function in these clinical scenarios since its measurement is independent of age, sex or muscle mass.4 The use of these other measures of GFR can often be neglected in the primary care setting, leading to the misdiagnosis of renal dysfunction in a given patient with elevated serum creatinine. 1 Division of Nephrology, 2Department of Medicine, Stony Brook University, and 3Division of Nephrology, Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, USA 2 Griggs RC, Kingston W, Jozefowicz RF, Herr BE, Forbes G, Halliday D. Effect of testosterone on muscle mass and muscle protein synthesis. J Appl Physiol 1989; 66: 498–503. 3 Chew-Harris JS, Florkowski CM, Elmslie JL, Livesey J, Endre ZH, George PM. Lean mass modulates glomerular filtration rate in males of normal and extreme body composition. Intern Med J 2014; 44: 749–56. 4 Laterza OF, Price CP, Scott MG. Cystatin C: an improved estimator of glomerular filtration rate? Clin Chem 2002; 48: 699–707. © 2015 Royal Australasian College of Physicians 588 Letters to the Editor General correspondence Audit of inpatient referrals I was very interested in the recent article by Brown et al.1 comparing speciality referrals made from inpatient general medical units in regional and metropolitan hospitals. The authors state that there is no available research on inpatient referrals published. In fact, there is one historical comparator which we published in the 1980s.2 This was a somewhat similar study but was done over a 6-month period prospectively when two units, both of which were general medical units with a special interest in respiratory medicine, recorded all of their inpatient and outpatient activity. There are some interesting comparisons with Brown et al.’s study. The Teaching Hospital unit in our study (consisting of one consultant, one senior registrar, one registrar and one intern) averaged 16.4 admissions per week compared with Monash’s 11.6 and the District General Hospital’s (one consultant, one registrar and one intern) 19.7 admissions as opposed to West Gippsland Hospital’s 10.7. In our study, there was no difference in the range of pathology seen between the two hospitals, but we also found a significant difference between the Teaching Hospital and the District General Hospital in the number of referrals made to other specialists. The Teaching Hospital averaged 0.26 referrals per admission (including References 1 Brown MG, Campbell D, Maydom BW. The undivided patient: a retrospective geriatrics) compared with Monash’s 1.74 and the District General Hospital’s 0.13 compared with West Gippsland’s 0.69. I would suspect that the units involved in Brown’s et al. study were more generously staffed than those in Yorkshire in the 1980s, and together with the much smaller number of admissions, this documents the reduction in clinical experience now offered to junior doctors. Brown et al. correctly point out the dangers of over-referral and speculate on possible causes including greater availability of subspecialists and fear of litigation. Our feeling in the 1980s was that the disparity largely reflected better general medical skills and greater confidence in dealing with a wider variety of conditions among physicians working in District General Hospitals rather than major metropolitan teaching centres, together with a reluctance to bother one’s busy colleagues with routine or banal medical conditions which any physician should be capable of managing. Received 23 October 2014; accepted 31 October 2014. doi:10.1111/imj.12692 G. Simpson Thoracic Medicine, Cairns Base Hospital, Cairns, Queensland, Australia cohort analysis of speciality referrals made from inpatient general medical units comparing regional to metropolitan practice. Intern Med J 2014; 44: 884–9. Author reply We thank Simpson1 for commenting on our paper2 and also for alerting us to his historical comparator study3, which has also compared inpatient referrals in a Teaching Hospital and District General Hospital in the 1980s. It is indeed interesting to note that this study also showed a significant difference between the Teaching Hospital and District General Hospital in the number of referrals made to other specialists. We agree that in the 1980s, this difference may have reflected greater confidence and general medical skills in dealing with a wide variety of conditions among physicians working in District General Hospitals rather than major teaching centres. It is certainly interesting to note the change in patient load over the last two decades. We do not entirely agree 2 Simpson FG, Wilson J, Peake MD, Cooke NJ. Audit of workload of physicians with a special interest in respiratory medicine. Br J Dis Chest 1987; 81: 150–4. with Simpson that this correlates with a reduction on clinical experience offered to junior doctors. There have certainly been important moves in recent years to ensure safer working hours for junior doctors that may in some ways have limited clinical exposure compared with two decades ago. However, we suspect that the change in patient load is more a reflection on the increasing complexity and expectation of patients along with advances in medicine, which have made management more complex as the years go by. Received 22 February 2015; accepted 22 February 2015. doi:10.1111/imj.12741 M. Brown and D. Campbell General Medicine, Monash Health, Melbourne, Victoria, Australia © 2015 Royal Australasian College of Physicians 589 Letters to the Editor References 1 Simpson G. Audit of inpatient referrals. Intern Med J 2015; 45: 589. 2 Brown MG, Campbell D, Maydom BW. The undivided patient: a retrospective cohort analysis of speciality referrals made from inpatient general medical units comparing regional to metropolitan practice. Intern Med J 2014; 44: 884–9. 3 Simpson FG, Wilson J, Peake MD, Cooke NJ. Audit of work-load of physicians with Leprosy and Australia While syphilis has been hailed as ‘the great imitator’, leprosy can also qualify, as illustrated by Turner et al.1 in a summary of cases treated in a tertiary centre in Victoria. The authors make the point that little has been published about aspects of the disease in developed settings. Some readers may be interested in two accounts of leprosy2,3 as seen in New South Wales from the 1950s to the 1970s, revealing confusion in clinical assessments and differential diagnoses in these patients. In this country, leprosy in References 1 Turner D, McGuinness SL, Leder K. Leprosy: diagnosis and management in a its clinical manifestations is seen infrequently, and by many clinicians not at all, so that the diagnosis is often simply not considered. Received 9 February 2015; accepted 10 February 2015. doi:10.1111/imj.12745 C. R. Boughton Division of Infectious Diseases, Prince of Wales Hospital, University of New South Wales, Sydney, New South Wales, Australia developed setting. Intern Med J 2015; 45: 109–12. 2 Boughton CR. Leprosy and Australia. Med J Aust 1972; 2: 837–42. Not only monoclonal antibodies . . . The recent case report by Commons et al.1 suggests that monoclonal antibody therapy was the triggering factor for the development of melioidosis in a patient with psoriatic arthritis. As the physician caring for this patient at the time, I feel the authors have jumped to a conclusion regarding the possible connection with anti-tumour necrosis factor and anti-IL12/23 treatment in this case. While this patient’s spondylitis responded well to biologic therapy, he also suffered from severe, extensive plaque psoriasis that was largely unresponsive to treatment (aside from a short lived initial improvement after etanercept therapy). Given the fact that there is a considerable (>100) number of patients maintained on biologic therapy in a special interest in respiratory medicine. Br J Dis Chest 1987; 81: 150–4. 3 Boughton CR. Leprosy in Sydney. Med J Aust 1977; 2: 351–3. Darwin in the last 5–10 years and the fact that this is the first case of melioidosis observed in this group, I remain unconvinced that treatment was a triggering factor in this case. Working in the garden during the wet season with extensive psoriatic skin lesions and without the use of protective gear seems to have been the most likely route of inoculation. Therefore, in my opinion, it would have been more appropriate to add active psoriasis to the author’s list of risk factors for acquiring melioidosis in endemic areas. Received 15 January 2015; accepted 4 February 2015. doi:10.1111/imj.12742 J. C. Nossent School of Medicine and Pharmacology, The University of Western Australia, Perth, Western Australia, Australia Reference 1 Commons RJ, Grivas R, Currie BJ. Melioidosis in a patient on monoclonal antibody therapy for psoriatic arthritis. Intern Med J 2014; 44: 1245–46. © 2015 Royal Australasian College of Physicians 590 Letters to the Editor Author reply We thank Nossent1 for his response to our article on melioidosis in a patient on monoclonal antibody therapy.2 Nossent raises the important point that skin exposure is a common method of inoculation and patients with psoriatic skin disease are at heightened risk for inoculation. The patient we reported sustained a recent cut while gardening after heavy rainfall, which was felt to be the likely time of inocuation. As described in the Darwin Prospective Melioidosis Study,3 20% of patients who contract melioidosis do not have recognised risk factors, and we acknowledge that any association with adalimumab in this patient remains speculative. However, there are several features that heighten our suspicion that monoclonal antibody therapy may have predisposed our patient to melioidosis. First, the rapid onset presentation with bacteraemia is very similar to patients who are immunosuppressed or receiving highdose corticosteroids and is rarely seen in otherwise well patients.4 In addition, we have now had a second patient diagnosed with melioidosis who presented in a very similar fashion while on adalimumab for ankylosing spondylitis. This 68-year-old man presented early this year with 24 h of headache, lethargy, nausea and high fevers, with onset several days after exposure to wet season rains in the Top End of the Northern Territory. He had chronic lung disease but no other risk factors for melioidosis. Blood cultures grew Burkholderia pseudomallei and he responded well to standard therapy, initially with intravenous ceftazidime. References 1 Nossent JC. Not only monoclonal antibodies . . . Intern Med J 2015; 45: 590. 2 Commons RJ, Grivas R, Currie BJ. Melioidosis in a patient on monoclonal antibody therapy for psoriatic arthritis. Intern Med J 2014; 44: 1245–6. 3 Currie BJ, Ward L, Cheng AC. The epidemiology and clinical spectrum of Finally, animal data have demonstrated that neutralisation of interleukin-12 and tumour necrosis factor (TNF)-α led to increased susceptibility to melioidosis, and adalimumab acts as a TNF-α inhibitor.5 It is apparent that specific risks for individual monoclonal antibody therapies may only be identified through post-marketing surveillance. In particular, the links between natalizumab and progressive multifocal leukoencephalopathy6 and TNF-α inhibitors and listeria7 have now been well documented. As noted by Nossent, melioidosis had not been documented in >100 patients on biological therapy in Darwin until our report. However, it is possible that adalimumab has a particular ability to interfere specifically with critical immune pathways in the host defence against B. pseudomallei. While we cannot claim that adalimumab was definitively a causative risk factor for melioidosis in these two cases, we feel it is important to highlight the potential link. Further surveillance for melioidosis is warranted in patients being treated with adalimumab and other monoclonal antibody therapies who live in or travel to melioidosis-endemic locations. Received 4 March 2015; accepted 5 March 2015. doi:10.1111/imj.12744 R. J. Commons,1 R. Hannah1,2 and B. J. Currie1,3 Departments of 1Infectious Diseases and Northern Territory Medical Program and 2Immunology, Royal Darwin Hospital and 3 Global and Tropical Health Division, Menzies School of Health Research, Darwin, Northern Territory, Australia melioidosis: 540 cases from the 20 year Darwin prospective study. PLoS Negl Trop Dis 2010; 4: e900. 4 Currie BJ. Melioidosis: evolving concepts in epidemiology, pathogenesis and treatment. Semin Respir Crit Care Med 2015; 36: 111–25. 5 Santanirand P, Harley VS, Dance DA, Drasar BS, Bancroft GJ. Obligatory role of gamma interferon for host survival in a murine model of infection with Burkholderia pseudomallei. Infect Immun 1999; 67: 3593–600. 6 Langer-Gould A, Atlas SW, Green AJ, Bollen AW, Pelletier D. Progressive multifocal leukoencephalopathy in a patient treated with natalizumab. N Engl J Med 2005; 353: 375–81. 7 Bodro M, Paterson DL. Listeriosis in patients receiving biologic therapies. Eur J Clin Microbiol Infect Dis 2013; 32: 1225–30. © 2015 Royal Australasian College of Physicians 591 Letters to the Editor Redesign versus resources: continuity lost I read with interest the results of the redesign of General Medical Units at Auckland Hospital in your journal.1 The reduction seen in length of stay and bed days saved actually occurred when two simultaneous interventions occurred, namely service redesign but in addition the service attained increased staffing. So in this pre/posttrial design, it is difficult to ascertain which of these interventions had the most effect. Clearly before 2011, the Auckland Hospital General Medical Service was overwhelmed with patient numbers and therefore increasing both senior and junior medical staffing 24 h/7 days a week would no doubt assist with looking after the patients in a more timely manner, improve educational opportunities for junior medical staff, and there is no medical department in the world that does not want extra resourcing to improve morale. All general medical units around the world are reviewing their model of care to improve patient care and efficiency and external drivers like the 4-h rule in Australia and similar rules in New Zealand are key influences. However, there are aspects of the new model of care described in Auckland that trouble me greatly. First, the authors should be congratulated in improving senior consultant supervision during admitting days by rostering physicians in the evening. This can only improve patient care, junior medical staff supervision and efficiency. The real concern I have is with the loss of continuity of care that occurs with the introduction of separate admitting and receiving teams as well as the lack of single point accountability in decision making when multiple consultants care for a particular patient. There are many methods of load sharing without having to break these two key tenets of good physician care. Our acute inpatients are becoming more complex with many comorbidities, polypharmacy, complex social and functional issues, and thus it takes significant time and effort to understand the nuances of each particular patient. There are higher expectations in quality of care from patients and relatives. We are entering the era of personalised therapies. So good care is very difficult to achieve when medical staff are changing during a very short admission and there are multiple handovers. There is another important factor. With good continuity of care one receives constant feedback on all of the decisions made during the patient’s journey; not only the big decisions but also the tiny small ones as well. We all make hundreds of decisions every day. The outcomes of your decision making may not be apparent by the next day; it may take till discharge or review in the clinic or with the readmission! This constant feedback over years refines our consultant skills and I believe makes physicians a superior clinician compared with disciplines that do not have this opportunity. It would be a great loss to lose this intrinsic advantage. Space precludes me from commenting on the ducking and weaving that can occur when single point accountability is lost; or the hindrance to mentorship and role modelling when junior staff have to deal with multiple consultants with differences in opinions on the same case; or the flawed claim of no change in case mix by referencing a US study; or commenting on a 30-day mortality without any methodology or results presented in the paper. In conclusion, there is no evidence in this paper that the model of care was the key driver in improving the process indicator of length of stay. The patient you know best is the one that you have admitted, and I want my admitting registrar to be my discharging registrar. Received 24 September 2014; accepted 25 September 2014. doi:10.1111/imj.12734 C. P. Denaro Department of Internal Medicine & Aged Care, Royal Brisbane & Women’s Hospital, School of Medicine, University of Queensland, Brisbane, Queensland, Australia Reference 1 Toomath R, Szecket N, Nahill A, Denison T, Spriggs D, Lay C et al. Medical service redesign shares the load saving 6000 bed days and improving morale. Intern Med J 2014; 44: 785–90. © 2015 Royal Australasian College of Physicians 592 Letters to the Editor Author reply We are very pleased that Denaro took an interest in carefully reading our paper.1 We agree that it is difficult to conclude which specific components of our new work model contributed most to the benefits we observed. If another department was interested in reproducing these improvements to their own length of stay (LOS), the simple solution would be to adopt all of the components from our bundle of interventions. As such, we were careful in our conclusions to list all of the component changes as being responsible for the improvement in LOS.2 Having said this, we are confident that the reorganisation of our work model, rather than our increase in staffing, was the major contributor. Many studies have already shown that reconfiguration, rather than addition, of hospital resources has significant effects on efficiency. It has been demonstrated that the on-call schedules of medical personnel have strong effects on the variation in daily discharges,3 and removing such variation improves patient flow.4 Additionally, smoothing (not increasing) patient discharges over the course of the week increases capacity in the emergency department.5 Finally, spreading the load of daily admissions over the whole service reduces median LOS.6 Therefore, our expectation of decreased LOS from ‘line-averaging’, and stratification of the patient journeys, was well founded. Although the increase in Senior Medical Officer (SMO) staffing was a requirement of the new model, the number of SMO on clinical duties at any one time is unchanged; we had 12 working SMO teams in the old model, and 12 in the new one. The addition of the SMO evening shift References 1 Denaro CP. Redesign versus resources; continuity lost. Intern Med J 2015; 45: 592. 2 Toomath R, Szecket N, Nahill A, Denison T, Spriggs D, Lay C et al. Medical service re-design shares the load saving 6000 bed days and improving morale. Intern Med J 2014; 44: 785–90. 3 Wong H, Wu RC, Tomlinson G, Caesar M, Abrams H, Carter MW et al. How much actually occurred 6 months prior to the implementation of the new work model, and was not associated with any change in median LOS. Conversely, there was an immediate step change in median LOS with the introduction of the new model. These observations suggest that the re-configured inpatient team structure was largely responsible for the benefits in LOS. Denaro cherishes patient continuity with good reason. It makes sense for the patient as well as for the continuing education and development of the training doctors. However, the first problem is that true continuity is an illusion. An audit in our own hospital in the old model showed that 62% of patients were discharged by a different team than the one who did the admission. There are many forces that disrupt continuity that we have learned to manage, not least of which is SMO going off service for annual leave. Geographic, unit-based teams are another such force, one that is accompanied by many benefits including better coordinated multidisciplinary care. Finally, the change of ownership of a patient’s care is an opportunity for better diagnostic performance, a built-in system to provide a second opinion. Notwithstanding this defence of our findings and our work model, we are continuously searching for changes that optimise the many positive principles at play that make for better patient care, including doctor–patient and physician–trainee continuity. Received 5 March 2015; accepted 6 March 2015. doi:10.1111/imj.12737 R. Toomath, N. Szecket and P. Poole Auckland City Hospital, General Medicine, Auckland, New Zealand do operational processes affect hospital inpatient discharge rates? J Public Health (Oxf) 2009; 31: 546–53. 4 Institute for Healthcare Improvement. Optimizing patient flow: moving patients smoothly through acute care settings. 2003 [cited 2015 Mar 3]; Available from URL: http://www.ihi.org 5 Szecket N, Wong HJ, Wu RC, Berman HD, Morra D. Implementation of a continuous admission model reduces the length of stay of patients on an internal medicine clinical teaching unit. J Hosp Med 2012; 7: 55–9. 6 Wong HJ, Wu RC, Caesar M, Abrams H, Morra D. Smoothing inpatient discharges decreases emergency department congestion: a system dynamics simulation model. Emerg Med J 2010; 27: 593–8. © 2015 Royal Australasian College of Physicians 593 Letters to the Editor The true prevalence of diabetes in hospital patients and its implications We read with interest the article by Cromarty et al.1 on the effect of diabetes on hospital acquired conditions and length of stay. They should be commended for addressing issues of crucial and increasing importance to the modern Australian health system. However, this paper raises methodological issues that require careful consideration if we are to interpret and apply its findings. The authors acknowledge that their coding-based strategy (using a pre-2012 coding standard that restricted recording diagnoses to ‘those conditions actively monitored or treated in the episode’) could potentially underestimate diabetes prevalence. However, the likely scale and importance of this effect were not made explicit. In particular, their reported 4.5% diabetes prevalence contrasts with rates of 15–35% in a recent cross-sectional diabetes prevalence survey that used active case detection in inpatients at 11 Melbourne metropolitan hospitals.2 Our institution Western Health (Footscray and Sunshine Hospitals), which has similar catchment population demographics to Northern Hospital (i.e. a rapidly expanding metropolitan population with high proportions from non-Englishspeaking backgrounds and lower socioeconomic strata),3 had the highest prevalence (35.1% at Western Health). We have also found similar rates (33%) in General Medical patients, using retrospective methods employing a post-2012 coding strategy to an administrative dataset. Assuming prevalence at Northern to be similar to our own, we estimate that their study may in fact have wrongly defined as many as six out of seven patients with diabetes as being ‘non-diabetic’. Therefore, the potential for their study results to be subject to differential misclassification bias is large. In particular, we wonder whether this effect may have diluted observed differences in study end-points between ‘diabetic’ and ‘non-diabetic’ groups. Notably, the ranking of the top six hospitalacquired diagnoses was the same in the ‘diabetes References 1 Cromarty J, Parikh S, Lim WK, Acharya S, Jackson TJ. Effects of hospital-acquired conditions on length of stay for patients with diabetes. Intern Med J 2014; 44: 1109–16. with end-organ sequelae’ and ‘non-diabetes (Charlson Comorbidity score ≥1)’ groups. Conversely, their allocation strategy could also have selected patients with more advanced or complicated diabetes and therefore exaggerated between-group differences (such as the overall much higher rate of hospital-acquired diagnoses in the diabetic group). As the authors also acknowledge, their pre-2012 coding definition for diabetes creates significant issues of generalisability. How are we to identify prospectively and then apply future interventions only to inpatients whose diabetes is ‘actively monitored or treated in the episode’? A simple, broad and inclusive definition (i.e. ‘patients with known diabetes’) is much easier to apply. We also question the appropriateness of analysis of variance and linear regression to analyse length of stay data (which usually has a highly skewed distribution). The authors do not comment on whether necessary assumptions (linearity, normality, independence and homoscedasticity) were met. Unfortunately, the sorts of research questions that arise in this area are generally poorly amenable to conventional prospective research designs. By contrast, retrospective studies utilising administrative datasets are logistically feasible but throw up a host of methodological challenges. It is important that studies such as this are published so that we can address these challenges and work to improve study designs and analytical methods. Received 29 January 2015; accepted 3 February 2015. doi:10.1111/imj.12746 1 G. Somarajah, H. Karunajeewa,1,2 P. S. Hamblin,3,4 E. Karahalios5 and E. Janus1,4 1 General Internal Medicine Unit and 3Endocrinology and Diabetes Unit, Western Health, 4Department of Medicine, Western Academic Centre and 5Centre for Epidemiology and Biostatistics, Melbourne School of Population and Global Health, University of Melbourne, and 2The Walter and Eliza Hall Institute of Medical Research, Melbourne, Victoria, Australia 2 Bach LA, Ekinci EI, Engler D, Gilfillan C, Hamblin PS, MacIsaac RJ et al. The high burden of inpatient diabetes: the Melbourne Public Hospitals Diabetes Inpatient Audit. MJA 2014; 201: 334–8. 3 Victorian Department of Health. 2012 Local Government area Profiles: North and West Metropolitan Region [Internet]. Melbourne: Victorian Government Department of Health; 2012. [cited 2012 Dec 20]. Available from URL: http://docs .health.vic.gov.au/docs/doc/North-and -West-Metro-Region © 2015 Royal Australasian College of Physicians 594 Letters to the Editor Author reply We agree with Somarajah et al.1 that our study2 should not be used to estimate the prevalence of diabetes in the inpatient population; however, this was not our aim. We sought instead to estimate the rates and types of hospitalacquired diagnoses and their effects on length of stay for patients identified with the most severe diabetes in routine hospital data. Our study is clearly not a basis for estimating prevalence of diabetes, which the contemporaneous paper by Bach et al.3 does very well. As their letter points out, and as we acknowledge at several points in our research report, the cases we identified were those where diabetes required active treatment or monitoring. As such, we did not include in our sample those cases of diabetic patients controlled with diet or oral medications. We do not consider this to be a ‘mis-classification’ of diabetes patients, but rather an issue in generalising our findings to the broader diabetes population in hospital. However, we have every confidence that patients in our sample with end-organ sequelae of diabetes or other symptoms that require active in-hospital treatment are clinically identifiable and were in fact correctly classified. This, we believe, is the most valuable group to identify and assess, as these patients attract the largest proportion of health funding and hence are the group that has the greatest potential for improvement. Interventions focused on changing care of all diabetes patients may not be useful or cost-effective. As the authors of the letter note, the effect of any ‘under-identification’ of the broader diabetes population would be a conservative one, that is, to ‘dilute’ the differences between our sample patients and the general inpatient population. We regret References 1 Somarajah G, Karunajeewa H, Hamblin PS, Karahalios E, Janus E. The true prevalence of diabetes in hospital patients and its implications. Intern Med J 2015; 45: 594. 2 Cromarty J, Parikh S, Lim WK, Shamsunder A, Jackson TJ. Effects of terming the latter the ‘non-diabetes group’ but found it difficult to come up with a concise alternative. This is a foundation study assessing the inpatient complications among the diabetic population, which aimed to provide a basis for future in-depth analysis of these patients. The next stage of our research is to collaborate with clinicians on interventions to identify and reduce occurrences of inpatient complications, and to introduce hospital-based auditing systems to better identify patients most at risk. We did not extend the manuscript with a defence of our statistical approach to the analysis. We rely on Lumley et al.’s evidence from simulations4 that parametric assumptions can be relaxed for large public health data sets such as ours, allowing use of analysis of variance and linear regression on skewed data. We wholeheartedly endorse the authors’ observation that ‘studies such as this’ should be published to improve study designs and analytical methods for research that is not amenable to conventional prospective research designs. We stand by our design and methods in finding that patients with end organ sequelae of diabetes suffer common hospital-acquired complications at 7–10 times the rate of similarly comorbid patients and have lengths of stay significantly extended both by their diabetes and by their hospital-acquired complications. Received 3 March 2015; accepted 11 March 2015. doi:10.1111/imj.12750 1 1 J. E. Cromarty, S. Parikh, T. J. Jackson,1 W. K. Lim2 and S. Acharya3 1 Northern Clinical Research Centre and 2Aged Care Department, The Northern Hospital, Melbourne, Victoria, and 3John Hunter Hospital, Newcastle, New South Wales, Australia hospital acquired conditions on length of stay for diabetic patients. Intern Med J 2014; 44: 1109–16. 3 Bach LA, Ekinci EI, Engler D, Gilfillian C, Hamblin PS, MacIsaac RJ et al. The high burden of inpatient diabetes mellitus: the Melbourne Public Hospitals Diabetes Inpatient Audit. Med J Aust 2014; 201: 334–8. 4 Lumley T, Diehr P, Emerson S, Chen L. The importance of the normality assumption in large public health data sets. Annu Rev Public Health 2002; 23: 151–69. © 2015 Royal Australasian College of Physicians 595 Letters to the Editor Systemic lupus erythematosus patients and tertiary specialist care – simple considerations dropping through the cracks: osteoporosis monitoring as an example We read with interest the paper by Nikpour et al.1 noting the lack of Australian epidemiological data for lupus treatment. As lupus and its treatments directly impact on osteoporosis, we expect that tertiary lupus specialists be actively aware of this common comorbidity and their patients’ routine bone monitoring investigations followed, whether these are conducted in hospital or externally by general practitioners. We recently reviewed rates of osteoporosis monitoring in a tertiary hospital cohort of well-defined systemic lupus erythematosus patients under non-endocrinological specialist care, identifying significant gaps in practice in this at-risk group. The monitoring aspects were presence of documented bone densitometry (DXA) and biochemical markers of bone turnover to determine the level of active awareness of this co-morbidity in our patient cohort. Between 2002 and 2010, 2325 positive anti-dsDNA antibody tests were performed by the state public pathology provider in Western Australia. Removing serial results on the same patient, and patients not seen in the tertiary hospital system, we identified 271 potential subjects, for whom 190 medical records were available for review. This confirmed 103 subjects had systemic lupus erythematosus and ongoing tertiary hospital care. Paediatric patients, patients not seen at least four times in the tertiary clinics and patients with discoid lupus, druginduced lupus, rheumatoid arthritis, overlap syndrome or inflammatory bowel disease were excluded. Our population was mostly female (87.4%) with a median age of 44 years (interquartile range 34.5–55.5 years) and rheumatological (82%), cutaneous (79%), bone marrow (56%), renal (51%) or serosal (29%) disease manifestations. This cohort was cared for by immunology and/or rheumatology (87%), with renal medicine (33%) or other specialities (dermatology, haematology, neurology) in 12% of patients overall. Reference 1 Nikpour M, Bridge JA, Richter S. A systematic review of prevalence, disease Overall, 30% of patients were under the care of more than one treating team. A single DXA was performed in 27% of subjects, and more than once in 37% with no difference in frequency between males and females. A comparison of the percentage of patients with multiple serum measures, as opposed to a single measurement, of calcium (71% vs 88%), vitamin D (47% vs 63%), parathyroid hormone (18% vs 37%) and fasting metabolic bone studies (14% vs 23%) suggests that monitoring over time for these indices may also be lacking. The relative frequency of serial DXA scans correlated positively with the duration of prednisolone treatment (normalised to time under observation since 2002) (Spearman’s R = 0.51, P < 0.0001) indicating that awareness of glucocorticoidinduced osteoporosis may at least be present. If traditional risk factors for osteoporosis were documented, then we noted a correlation with ordering of all monitoring tests at least once (R = 0.23, P = 0.03) or serially (R = 0.32, P = 0.003); however, patients were not more regularly monitored if under shared care compared with being under a single non-endocrinological speciality (P = 0.9). As the purpose of this audit was evaluation of tertiary hospital care, there is potential bias in patient selection, which may not reflect care provided outside of the hospital setting; however, as an indicator of nonendocrinological specialist awareness and management of a co-morbidity associated with active lupus, it indicates management we can improve on in Western Australia. Received 9 January 2015; accepted 31 January 2015. doi:10.1111/imj.12748 M. Hew,1 E. J. McKinnon,2 B. Kirwin,3 O. P. Martinez3,4,5 and M. Lucas1,2,3 1 Department of Clinical Immunology, PathWest Laboratory Medicine WA, Queen Elizabeth II Medical Centre, 2Institute for Immunology and Infectious Diseases, Murdoch University, 3School of Pathology and Laboratory Medicine, Faculty of Medicine, Dentistry and Health Sciences, University of Western Australia, 4 Department of Clinical Immunology, Royal Perth Hospital, and 5 Department of Clinical Immunology, Fiona Stanley Hospital, Perth, Western Australia, Australia characteristics and management of systemic lupus erythematosus in Australia: identifying areas of unmet need. Intern Med J 2014; 44: 1170–9. © 2015 Royal Australasian College of Physicians 596 OnlineOpen The Open Access option for your research Wiley offers an optional open access model: OnlineOpen, in over 1250 journals. OnlineOpen is available to authors who wish to make their article available to non-subscribers on publication, or whose funding agency requires grantees to archive the final version of their article. Open access: freely available on Wiley Online Library and PubMed Central Fully compliant with open access mandates – meeting the requirements of funding organizations and institutions where these apply Option available for over 1250 Wiley journals An icon clearly signals that your article is OnlineOpen Authors can publish OnlineOpen retroactively For research articles, short communications and review articles wileyonlinelibrary.com/onlineopen 12-50104 For more information on OnlineOpen including details of fees visit: WE MAKE YOUR RESEARCH EASY. NOW WE MAKE JOB HUNTING EASY. Let your partners in research energize your career. Drawing on our expertise and relationships across the research and business communities, Wiley-Blackwell invites you to join Wiley Job Network, the definitive job site for professionals in the sciences, technology, business, finance, healthcare and the arts. đƫ premium jobs from the most respected names in your industry đƫ hundreds of recruiters and employers in your field đƫ job alerts that match your criteria đƫ expert career advice and candidate resources Register and upload your resume/CV now to begin your job search! wileyjobnetwork.com available. For other pricing options, including access information and terms and conditions, please visit: wileyonlinelibrary.com/access. Publisher Internal Medicine Journal is published by Wiley Publishing Asia Pty Ltd 155 Cremorne Street Richmond, Victoria, 3121 Australia Tel: +61 3 9274 3100 Fax: +61 3 9274 3101 Journal Customer Services For ordering information, claims and any enquiry concerning your journal subscription please go to www.wileycustomerhelp.com/ask or contact your nearest office. Americas: Email: [email protected]; Tel: +1 781 388 8598 or 1 800 835 6770 (toll free in the USA & Canada). Europe, Middle East and Africa: Email: [email protected]; Tel: +44 (0) 1865 778315. Asia Pacific: Email: [email protected]; Tel: +65 6511 8000. Japan: For Japanese speaking support, email: [email protected]; Tel (toll free): 005 316 50 480. Visit our Online Customer Help available in 7 languages at www. wileycustomerhelp.com/ask Production Editor Yvonne Lim (email: [email protected]) Information for Subscribers Internal Medicine Journal, (ISSN: 1444-0903), is published monthly. Institutional subscriptions on prices for 2015 are: Print & Online: US$1746 (US), US$2114 (Rest of World), @1370 (Europe). Prices are exclusive of tax. AsiaPacific GST, Canadian GST/HST and European VAT will be applied at the appropriate rates. For more information on current tax rates, please go to wileyonlinelibrary.com/tax-vat. The price includes online access from current content and all online back files to January 1st 2011, where Delivery Terms and Legal Title Where the subscription price includes print issues and delivery is to the recipient’s address, delivery terms are Delivered at Place (DAP); the recipient is responsible for paying any import duty or taxes. Title to all issues transfers FOB our shipping point, freight prepaid. We will endeavour to fulfil claims for missing or damaged copies within six months of publication, within our reasonable discretion and subject to availability. Printing and Despatch Printed in Singapore by Markono Print Media Pte Ltd. All journals are normally despatched direct from the country in which they are printed by surface air-lifted delivery. Offprints C.O.S. Printers Pte Ltd, 9 Kian Teck Crescent, Singapore 628875. Fax: +65 6265 9074. Email: [email protected] Back Issues Single issues from current and recent volumes are available at the current single issue price from [email protected]. Earlier issues may be obtained from Periodicals Service Company, 11 Main Street, Germantown, NY 12526, USA. Tel: +1 518 537 4700, Fax: +1 518 537 5899, Email: [email protected] Copyright and Copying © 2015 Royal Australasian College of Physicians. All rights reserved. No part of this publication may be reproduced, stored or transmitted in any form or by any means without the prior permission in writing from the copyright holder. Authorisation to copy items for internal and personal use is granted by the copy-right holder for libraries and other users registered with their local Reproduction Rights Organisation (RRO), e.g. Copyright Clearance Center (CCC), 222 Rosewood Drive, Danvers, MA 01923, USA (www.copyright.com), provided the appropriate fee is paid directly to the RRO. This consent does not extend to other kinds of copying such as copying for general distribution, for advertising or promotional pruposes, for creating new collective works or for resale. Special requests should be addressed to [email protected] IMJ.PI.DEC14 003-imj-v45-i5-ibc.indd 3 5/5/2015 3:15:58 PM VOLUME 45 issue 5 May 2015 Editorial Position Paper 471 563 Domestic violence: it is time for the medical profession to play its part L. Piterman, P. A. Komesaroff, H. Piterman and K. J. Jones Review 474 Physical activity and sedentary behaviour: applying lessons to chronic obstructive pulmonary disease K. Hill, P. A. Gardiner, V. Cavalheri, S. C. Jenkins and G. N. Healy Clinical Perspectives 482 Familial colorectal cancer M. S. Lung, A. H. Trainer, I. Campbell and L. Lipton Brief Communications 576 Original Articles 492 497 510 517 527 537 546 557 Clinical triage for colonoscopy is useful in young women K. D. Williamson, K. Steveling, G. Holtmann, M. Schoeman and J. M. Andrews Comparison of the management and in-hospital outcomes of acute coronary syndrome patients in Australia and New Zealand: results from the binational SNAPSHOT acute coronary syndrome 2012 audit C. Ellis, C. Hammett, I. Ranasinghe, J. French, T. Briffa, G. Devlin, J. Elliott, J. Lefkovitz, B. Aliprandi-Costa, C. Astley, J. Redfern, T. Howell, B. Carr, K. Lintern, S. Bloomer, A. Farshid, P. Matsis, A. Hamer, M. Williams, R. Troughton, M. Horsfall, K. Hyun, G. Gamble, H. White, D. Brieger and D. Chew, on behalf of Bi-National Acute Coronary Syndromes (ACS) ‘SNAPSHOT’ Audit Group Assessing the use of initial oxygen therapy in chronic obstructive pulmonary disease patients: a retrospective audit of pre-hospital and hospital emergency management C. Susanto and P. S. Thomas Obvious emphysema on computed tomography during an acute exacerbation of chronic obstructive pulmonary disease predicts a poor prognosis T. Cheng, H. Y. Wan, Q. J. Cheng, Y. Guo, Y. R. Qian, L. Fan, Y. Feng, Y. Y. Song, M. Zhou, Q. Y. Li, G. C. Shi and S. G. Huang Efficacy of non-invasive mechanical ventilation in the general ward in patients with chronic obstructive pulmonary disease admitted for hypercapnic acute respiratory failure and pH < 7.35: a feasibility pilot study S. Fiorino, L. Bacchi-Reggiani, E. Detotto, M. Battilana, E. Borghi, C. Denitto, C. Dickmans, B. Facchini, R. Moretti, S. Parini, M. Testi, A. Zamboni, A. Cuppini, L. Pisani and S. Nava Prevalence and significance of CYP2C19*2 and CYP2C191*7 alleles in a New Zealand acute coronary syndrome population P. D. Larsen, L. R. Johnston, A. Holley, A. C. La Flamme, L. Smyth, E. W. Chua, M. A. Kennedy and S. A. Harding Safety of coadministration of ezetimibe and statins in patients with hypercholesterolaemia: a meta-analysis L. Luo, X. Yuan, W. Huang, F. Ren, H. Zhu, Y. Zheng and L. Tang Crescentic glomerulonephritis: data from the Spanish Glomerulonephritis Registry B. Quiroga, A. Vega, F. Rivera and J. M. López-Gómez, on behalf of all members of the Spanish Registry of Glomerulonephritis 001-imj-v45-i5-oc-4.44mm.indd 1 Consensus guidelines for the investigation and management of encephalitis in adults and children in Australia and New Zealand P. N. Britton, K. Eastwood, B. Paterson, D. N. Durrheim, R. C. Dale, A. C. Cheng, C. Kenedi, B. J. Brew, J. Burrow, Y. Nagree, P. Leman, D. W. Smith, K. Read, R. Booy and C. A. Jones, on behalf of the Australasian Society of Infectious Diseases (ASID), Australasian College of Emergency Medicine (ACEM), Australian and New Zealand Association of Neurologists (ANZAN) and the Public Health Association of Australia (PHAA) 580 583 Survey of infection control and antimicrobial stewardship practices in Australian residential aged-care facilities R. L. Stuart, C. Marshall, E. Orr, N. Bennett, E. Athan, D. Friedman and M. Reilly, on behalf of Members of RACRIG (Residential Aged Care Research Interest Group) Long-term follow up of paediatric liver transplant recipients: outcomes following transfer to adult healthcare in New Zealand R. Harry, C. Fraser-Irwin, S. Mouat, E. Gane, S. Munn and H. M. Evans Primary central nervous system posttransplantation lymphoproliferative disorder after heart and lung transplantation G. Gifford, K. Fay, A. Jabbour and D. D. Ma Letters to the Editor Clinical-scientific notes 586 Bilateral cordotomy post-failure of intrathecal analgesia in a palliative care setting S. P. M. Hosking, M. E. Franco, P. Poon and L. William 588 Serum creatinine is not the end-all, be-all of renal impairment S. K. Mallipattu, J. Ling and J. Uribarri General correspondence 589 Audit of inpatient referrals G. Simpson 589 Author reply M. Brown and D. Campbell 590 Leprosy and Australia C. R. Boughton 590 Not only monoclonal antibodies … J. C. Nossent 591 Author reply R. J. Commons, R. Hannah and B. J. Currie 592 Redesign versus resources: continuity lost C. P. Denaro 593 Author reply R. Toomath, N. Szecket and P. Poole 594 The true prevalence of diabetes in hospital patients and its implications G. Somarajah, H. Karunajeewa, P. S. Hamblin, E. Karahalios and E. Janus 595 Author reply J. E. Cromarty, S. Parikh, T. J. Jackson, W. K. Lim and S. Acharya 596 Systemic lupus erythematosus patients and tertiary specialist care – simple considerations dropping through the cracks: osteoporosis monitoring as an example M. Hew, E. J. McKinnon, B. Kirwin, O. P. Martinez and M. Lucas
