Download introduction to biology - San Diego Mesa College

MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
BIOL107 Take-Home Quiz Page

On the following pages you have the opportunity to look up questions very similar
or identical to the ones you will find on your regular take-home quizzes which I
hand out through-out the semester

Since some of the questions to the individual chapters will also be very similar to
the ones you will find in the scheduled tests for this semester, I also encourage
you to use this page to test your gained knowledge and to rehearse important
lecture topics

The quizzes are listed according to the chapter contents which will be covered in
the lectures
Chapter 1: INTRODUCTION TO BIOLOGY
Q.1:
Science
A) is based on faith
B) is based on experimental evidence
C) is concerned with the natural world
D) builds on what has been learned earlier
E) all of the above, except a)
Q.2: Explain in your own words what is meant by the statement that the scientific
process is not a rigid method
Q.3:
A scientist performs a controlled experiment. This means that:
A) the experiment is repeated many times to ensure that the results are accurate
B) the experiment proceeds at a slow pace to guarantee that the scientist can carefully
observe all reactions and process all experimental data
C) two experiments are conducted in parallel, one differing from the other by only one
single variable (factor)
D) two experiments are conducted in parallel, one differing from the other by two or
more variables
E) one experiment is performed but the scientist controls the variables
Q.4:
In order to be scientifically valid, a hypothesis must be
A) phrased as a question
B) published in a scientific journal
C) testable
D) falsifiable
E) both c) and d)
Q.5:
Which of the following is/are (a) property(ies) of life?
A) a complex organization
B) the ability to take in energy and use it
C) the ability to respond to stimuli from the environment
D) the ability to reproduce
E) all of the above
1
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 6: Any form of scientific investigation is based on the assumption of
A) the existence of a supernatural cause behind every phenomenon
B) a gravitational force behind any phenomenon
C) a natural cause behind a certain phenomenon which can be understood
through scientific reasoning and experimentation
D) a metabolic activity behind any natural phenomenon
Q. 7: A scientific theory that has been repeatedly re-tested and successful expanded to
become a commonly accepted part of reality about our world, is called a ________ .
A)
B)
C)
D)
E)
scientific publication
hypothesis
scientific statement
dogma
scientific principle
Chapter 2: THE CHEMICAL BASIS OF LIFE
Q. 1: The five most common elements in living organisms are?
A) C, H, O, Na, Cl
B) C, H, O, Na, Ca
C) C, H, O, N, Ca
D) C, N, O, Na, Cl
E) C, N, O, Ca, Fe
Q. 2: The atomic number of a chemical element in the period table of the chemical
elements tells
A) the number atoms
B) the number of electrons
C) the number of protons
D) the number of neutrons
E) both, b and c
Q. 3: How many electrons would you find in the outermost electron shell (orbital) of the
carbon atom?
A) 2
B) 4
C) 6
D) 12
E) none
Q. 4: When full, the innermost electron shell of an atom contains ____ electrons, and the
outermost shell contains ______ electrons.
A) 2…..2
B) 2….8
C) 4….8
D) 8…..2
E) 8…..8
Q. 5: ______ are weak bonds that are not strong enough to hold atoms together to form
molecules but are strong enough to form bridges between molecules, e.g. DNA
A) Ionic bonds
B) Covalent bonds
C) Polar covalent bonds
D) Anionic bonds
E) Hydrogen bonds
2
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 6: The carbon atoms in the glucose molecule are held together by
A) ionic bonds
B) single covalent bonds
C) double covalent bonds
D) polar covalent bonds
E) hydrogen bonds
Q. 7: Typically nitrogen atoms are composed of seven electrons, seven protons and
seven neutrons. An isotope of nitrogen could
A) be positively charged
B) be negatively charged
C) have more than seven electrons and more than seven protons
D) have more than seven each of electrons, protons and neutrons
E) have more than seven neutrons
Q. 8: Chemical elements of group I and VII are most likely forming
A) covalent bonds
B) hydrogen bonds
C) ionic bonds
D) double bonds
E) bonds involving protons
Q. 9: The atoms of the water molecule (H-O-H) are held together by
A) an ionic bond
B) a single covalent bond
C) a double covalent bond
D) a polar covalent bond
E) hydrogen bonds
Chapter 3: THE MOLECULES OF CELLS
Q. 1: Which of the following functional groups is called an amino group?
A) –OH
B) –NH2
C) –COOH
D) –CO
E) –CH3
Q. 2: Monosaccharides can be joined together by a process called dehydration
synthesis. Which of the following statements is/are true of this process?
A) One monomer loses a hydrogen atom, and the other loses a hydroxyl group
B) Electrons are shared between atoms of the joined monomers
C) H2O is released as the monomers are joined
D) Covalent bonds are formed between the monosaccharides
E) All of the above are true
Q. 3: A triglyceride
A) consists of three fatty acids attached to a glycerol molecule
B) is hydrophobic
C) plays a role in energy storage
D) is a type of fat
E) all of the above
3
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 4: Which of the following is the most prevalent functional group in carbohydrates?
A) sulfhydryl group
B) carboxyl group
C) amino group
D) hydroxyl group
E) aldehyde group
Q. 5: Amino acid molecules are to proteins, as ______ molecules are to starch
A) maltose
B) glucose
C) fatty acids
D) nucleotides
E) oils
Q. 6: In an usual phospholipid molecule you would find ___ fatty acid(s), which
constitute(s) the _____ part of this biological molecule
A) 1 … polar (= hydrophilic)
B) 2 … polar
C) 2 … unpolar (= hydrophobic)
D) 3 … polar
E) 3 … unpolar
Q. 7: The bio-molecule DNA differs from RNA because DNA
A) contains the nucleotide thymine in place of uracil
B) contains a single rather than a double polynucleotide strand
C) contains pentose rather than hexose sugars
D) contains phosphate groups
E) all of the above
Q. 8: Anabolic steroids, often miss-used by some athletes for quick muscle build-up, are
synthetic variants (= derivatives) of which of the following body-own molecules?
A) the male sex hormone testosterone
B) the female sex hormone progesterone cholesterol
C) DNA
D) vitamin D
E) cholesterol
Q. 9: How many different nucleotides are used by all biological organisms for the
synthesis of the “hereditary molecule” DNA?
A) 2
B) 3
C) 4
D) 20
E) 64
Q. 10: The biological function of the hormone insulin in animals including humans is:
A) the regulation of the sodium uptake in the kidneys
B) the control of androgen production in the gonads (=sexual organs)
C) the regulation/control of the glucose homeostasis in the body
D) the stimulation of bile production in the liver
E) none of the above
4
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Chapter 4: A JOURNEY INTO THE CELL
Q. 1: Which of the following cellular features does the protist Paramecium have in
common with all cells of your own body?
A) cilia
B) a cell membrane made of phospholipids
C) a nucleus
D) a cytoskeleton
E) all of the above except a
Q. 2: A membranous intracellular structure with a specific function is called a(n)
A) cilium
B) organelle
C) proteasome
D) ribosome
E) cell
Q. 3: The circular strands of extra-chromosomal DNA found in many bacteria are called
A) plastids
B) plasmids
C) chromatids
D) chromosomes
E) ribosomes
Q. 4: Which of the following statements would be true of the surface-to-volume ratio of a
cell that doubled in volume?
A) the ratio must decrease if the cell is to continue obtaining enough nutrients and
gases
B) the ratio must decrease, or the cell will lose too many biomolecules through its
membrane
C) the ratio must increase if the cell is to continue obtaining enough nutrients and
maintaining optimum gas exchange
D) the ratio must stay the same, so that the balance of transport of materials into and
out of the cell is not disturbed
E) both, a and b are true
Q. 5: Which of the following is/are NOT (an) organelle(s) of a typical animal cell?
A) The lysosome
B) The chloroplast
C) The mitochondrion
D) The peroxisome
E) The Golgi apparatus
Q. 6: Which of the following is NOT found in prokaryotic cells?
A) a nucleus
B) pili
C) a cell wall D) organelles E) both, a and d
5
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 7: Mitochondria differ from chloroplasts in that
A) mitochondria convert solar energy to chemical energy, whereas chloroplasts
convert one form of chemical energy to another
B) mitochondria contain three different membrane-bound compartments,
whereas chloroplasts contain two
C) mitochondria contain membrane folds called cristae, whereas chloroplasts
contain disk-like vesicles called grana
D) mitochondria are not found in plants, whereas chloroplasts are not found in
animal cells
E) mitochondria produce glucose whereas chloroplasts break glucose down
Q. 8: Which of the following cell organelles play a role in primarily catabolic cellular
processes?
A) chloroplast
B) mitochondrion
C) lysosome
D) rER
E) all of them
Q. 9: Nucleic acid (in form of DNA) in eukaryotic cells can be found in
A) the nucleus
B) chloroplasts
C) mitochondria
D) the Golgi apparatus
E) a, b and c
Q. 10: The most important function(s) of mitochondria is/are
A) cellular respiration
B) ATP production
C) lipid synthesis
D) calcium storage
E) both, a and b
Q. 11: The protein monomer which builds up the long microfilaments as part of the
cellular cytoskeleton is called:
A) tubulin
B) keratin
C) actin
D) myosin
E) insulin
Q. 12: Which of the following biological organisms have prokaryotic cells?
A) baker’s yeast
B) the green algae Chlamydomonas
C) the Anthrax-causing bacterium Bacillus anthracis
D) the cyanobacterium Anabaena
E) both, c and d
F) all of the above
6
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Chapter 5: THE WORKING CELL
Q. 1: According to _____ , energy cannot be created or destroyed.
A) Einstein’s law of relativity
B) the first law of thermodynamics
C) the second law of thermodynamics
D) the third law of thermodynamics
E) Newton’s law of gravity
Q. 2: When a cell uses chemical energy to perform work, it couples an unfavorable
______ reaction with a(n) _____ reaction
A)
B)
C)
D)
E)
exergonic …… endergonic
endergonic …… exergonic
exergonic …… spontaneous
spontaneous …… exergonic
endergonic …… spontaneous
Q. 3: Which of the following energy transfers is/are possible in living organisms?
A) light energy to chemical energy
B) chemical energy to kinetic energy
C) potential energy to kinetic energy
D) light energy to potential energy
E) all of the above
Q. 4: The term ‘redox’ of chemical redox reactions stands for ________ . Oxidation
means the ______ of a molecule involved in a chemical reaction.
A) red oxidation … gain of protons
B) redunant oxidation … loss of protons
C) redunant oxidation … loss of electrons
D) reduction oxidation … loss of electrons
E) reduction oxidation … gain of electrons
Q. 5: Which of the following processes is endergonic?
A) the combustion of wood or gasoline
B) the release of heat from the breakdown of glucose molecules
C) the synthesis of glucose from carbon dioxide and water
D) the breakdown of glucose to power ATP formation
E) the build-up of polypeptides from amino acids
F) both, c and e
Q. 6: When an enzyme speeds up (= catalyzes) a chemical reaction
A) it lowers the activation energy necessary to trigger the chemical reaction
B) it becomes destroyed after the completion of the reaction
C) it leaves the catalytic cycle in the same shape as it entered it
D) it forms a stable complex with the product
E) both, a and c
7
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 7: Which of the following conditions or factors would interfere with the normal enzyme
function?
A) a low temperature (e.g. 4oC)
B) a high temperature (e.g. 56oC)
C) a low pH (e.g. pH 2)
D) a heavy metal (e.g. mercury or lead)
E) all of the above
Q. 8: Which of the following substances is a cofactor of certain enzymes?
A) The amino acid alanine
B) uranium
C) zinc ion
D) NAD+
E) both, c an d
Chapter 6: HOW CELLS HARVEST CHEMICAL ENERGY
Q.1: Respiration means _____, and cellular respiration _____.
A) ATP production …. is gas exchange
B) gas exchange …. produces ATP
C) glucose reduction … oxidizes glucose
D) use of glucose …. produces glucose
E) production of glucose …. is gas exchange
Q.2: The first chemical pathway of aerobic cellular respiration of glucose is called
________, its end product is the molecule _________ .
A) fermentation ….. ethanol
B) glycolysis …. GAP
C) glycolysis … pyruvate (Pyr)
D) glycolysis …. Acetyl-CoA
E) Krebscycle …. Acetyl-CoA
Q. 3: The chemical ‘center piece’ reaction of cellular respiration is called ____, which
occurs in the ______ of a cell.
A) glycolysis ….. mitochondria
B) the Krebs cycle …. cytosol
C) the Krebs cycle …. mitochondria
D) glycolysis …. cytosol
E) metabolism …. cytosol
Q.4: Which of the following are true chemical waste products of the Krebs cycle?
A) NADH + H+
B) carbon dioxide (CO2)
C) FADH2
D) oxygen
E) all of the above, except d
8
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 5: During cellular respiration, the chemical energy of glucose
A) is released in a sudden combustion reaction
B) is used to manufacture ATP by endergonic chemical reactions
C) is released a little bit at a time in a series of chemical reactions
D) is released after fermentation
E) both, b and c
Q. 6: Which of the following major food/nutritional components supply(ies) our body with
the highest caloric energy content?
A) glucose
B) an amino acid
C) a fatty acid
D) glycerol
E) water
Q. 7: A company is selling a new dietary supplement as a ‘wonder weight loss’ pill.
Scientists of the FDA, who carefully examine the product, discover that one of the
ingredients of that product dramatically lowers the ATP production of isolated
mitochondria; Since the mitochondria have an otherwise normal consumption of oxygen,
but higher heat production, they suspect, that the pill contains a component.
A) that affects the flow of electrons of the mitochondrial electron transport chain
B) that prevents glycolysis from occuring
C) that might function as an un-coupler of the electron transport chain and destroys the
proton gradient across the mitochondrial membrane
D) that blocks the activity of the mitochondrial ATP synthase
E) that may prevent NADH + H+ from docking to the acceptor proteins at the electron
transport chain
F) either, c or d
Q. 8: How many ATP molecules does a eukaryotic cell maximally produce after (aerobic)
cellular respiration of 1 molecule of glucose?
A) 2
B) 4
C) 17
D) 34
E) 36
Q. 9: The end product of anaerobic respiration of glucose in muscle cells is called:
A) water
B) CO2
C) ethanol
D) lactate
E) NADH + H+
9
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Chapter 7: PHOTOSYNTHESIS
Q. 1: Which of the following organisms living on planet Earth perform the biological
process we call photosynthesis?
A) green beetles and fire flies
B) fungi, including yeast
C) green plants and algae
D) cyanobacteria
E) both, b and c
Q. 2: The overall net equation for photosynthesis is
A) 6 CO2 + 6 H2O + light  C6H12O6 + 6 O2
B) 6 O2 + 6 H2O + light  C6H12O6 + 6 CO2
C) C5H12O6 + 6 O2 + heat  6 H2O  + 5 CO2
D) C6H12O6 + 6 O2 + light  6 H2O  + 6 O2
E) the same as the equation for glycolysis written in reverse
Q. 3: In most green plants, chloroplasts
A) are found throughout the leaf tissue
B) are concentrated in a zone of leaf tissue called the mesophyll
C) are concentrated in a portion of the leaf called stroma
D) are concentrated in the stomata
E) are concentrated in the stem and tuber parts of the plant
Q. 4: Which of the following molecules is/are (an) end product of the light reaction of
photosynthesis?
A) O2 B) glucose
C) CO2
D) NADPH + H+
E) both, a and d
Q. 5: The Calvin-Benson cycle of photosynthesis involves all of the following except
A) carbon fixation
B) addition of electrons and protons to carbon
C) formation of waste products in form of carbon dioxide
D) regeneration of NADP+
E) consumption of ATP
Q. 6: Which of the following photosynthesis pigments is found in the reaction centers of
photosystem I and II?
A) xanthophylls
B) chlorophyll a
C) chlorophyll b
D) β-carotene
Q. 7: Which of the following organisms or plants perform photorespiration under hot, dry
climate conditions?
A) C3 plants
B) C4 plants
C) CAM plants
D) green algae
D) all of the above
10
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 8: What is photorespiration?
A) light-driven cleavage of glucose to yield three 2-carbon compounds, which are
broken down to CO2 and H2O within the mitochondria without producing ATP
B) the increase in the rate of mitochondrial respiration that takes place when a
leaf is exposed to light and photosynthesis produces glucose
C) the opening and closing of stomata to changes in light intensity during the day
D) the incorporation of O2 instead of CO2 by Rubisco enzyme, yielding a 3-PG
and a 2-carbon compound that is broken down to CO2 and H2O
E) ATP synthesis driven by light-driven cellular respiration within the
mitochondria
Chapter 8: GROWTH, CELL DIVISION, MITOSIS & MEIOSIS
Q. 1: Regarding their chromosome complement (number), daughter cells after mitotic cell
division are:
A) haploid
B) diploid
C) polyploidy
D) DNA-less
E) mutated
Q. 2: How many cells are there after 8 mitotic cell division of one single cell?
A) 8
B) 16
C) 64
D) 256
E) count-less
Q. 3: The exchange of a single nucleotide of the DNA molecule is called
A) an insertion
B) a point mutation
C) a nucleotide exchange
D) a deletion
E) a conversion
Q. 4: The spot where the two sister chromatids are attached with each other after DNA
replication is called:
A) the centriole
B) the centromere
C) the centrosome
D) the ribosome
E) the chromosome
Q. 5: During which phase of mitosis do the chromosomes line-up on a virtual plane
located equidistant from the two spindle poles?
A) interphase
B) prophase C) metaphase
D) anaphase E) telophase
11
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 6: The protein-made cell component which contains two centrioles and is important
for the formation of the microtubular spindle apparatus in Prophase of mitosis is called
A) the nucleolus
B) the chromosomal gap
C) the centrosome (MTOC)
D) the centromere
E) the chromosome
Q. 7: During which phase of mitosis do the sister chromatids of the visible chromosomes
separate and start to move to the two opposite spindle poles?
A) interphase
B) prophase C) metaphase D) anaphase E) telophase
Q. 8: The potent plant-derived anti-cancer drugs taxol (Paclitaxel) and vinblastine prevent
cancer cells from dividing because:
A) they block the build-up of new DNA (inhibit DNA replication)
B) they prevent the cells from forming a cleavage furrow during mitosis
C) they prevent the uptake of nutrients into the cancer cells
D) they inhibit the ATP synthase enzyme in the mitochondria
E) they prevent the cells from forming a functioning spindle apparatus
Q. 9: In which of the following tissues or body structures of a female human body does
meiosis take place?
A) the bone marrow
B) the skin
C) the ovaries
D) the brain
E) can happen literally in every tissue or organ
Q. 10: During which stage of meiosis does synapsis and the formation of tetrads occur?
A) interphase I
B) prophase I
C) interphase II
D) interphase II
B) none of the above
Q. 11: The cell formed after fusion of a sperm with an egg cell in sexual reproduction is
called
A) a diploid daughter cell
B) a haploid germ cell
C) a diploid germ cell
D) a haploid zygote
E) a diploid zygote
Q. 12: In humans, the 22 pairs of chromosomes that don’t include the sex chromosomes
are called:
A) loci
B) polysomes
C) somatic chromosomes
D) autosomes
E) ribosomes
12
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 13: Which of the following events during meiosis do(es) contribute to the increased
genetic variability?
A) crossing over
B) formation of chiasmata
C) synapsis and tetrad formation
D) independent sorting of homologous chromosomes in Metaphase I
E) all of the above
Chapter 9: GENETICS & INHERITANCE
Q.1: The science of heredity is referred to as
A) karyotyping
B) genetics
C) inheritance
D) genomics
E) none of the above
Q. 2: A monohybrid cross is
A) the second generation of a self-fertilized plant
B) a breeding experiment in which parental varieties have only one trait in common
C) a breeding experiment in which the parental varieties phenotypically differ in
only one trait
D) a breeding experiment between a hybrid and a true-inbred individual
E) none of the above
Q. 3: Research since G. Mendel’s time has established that the principle of the
segregation of genes (alleles) during gamete formation
A) applies to all forms of life
B) applies to all sexually reproducing organisms
C) applies to all asexually reproducing organisms
D) applies only to sexually reproducing plants
E) was invalid
Q. 4: Which of the following is an example of a heritable condition in humans which is
characterized by incomplete dominance?
A) red-green color blindness
B) sickle-cell anemia
C) hemophilia
D) hypercholesterolemia
E) leukemia
Q. 5: Twp short-tailed cats were mated and the female produced a litter of two kittens
without tails, two with long tails, and two with short tails. Which of the following best
explains the phenotypic outcome?
A) Tail length is governed by polygenic inheritance patterns
B) Tail length involves one gene, but incomplete dominance is at work
C) Tail length is governed by one gene, with complete dominance at work
13
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 6: Which of the following terms refers to the situation where a single phenotypic
characteristic is determined by the additive effects of two or more genes?
A) incomplete dominance
B) codominance
C) pleiotropy
D) polygenic inheritance
E) blending inheritance
Q. 7: A man and a woman both have normal color vision, but their daughter has redgreen colorblindness, an X-linked inherited trait in humans (normal vision is dominant to
colorblindness). The man sues the woman for divorce, claiming she had an affair with
another man. The proof, he states in court, is the daughter. The man asserts that he is
not the biological father of this child, because it is red-green colorblind. Solely on the
genetics of this case, and assuming normal X-linked inheritance, should the judge rule in
the man’s favor?
A) yes, genetics prove the man’s case
B) no, the genetics alone do not prove the case, so the judge cannot rule in the man’s
favor without some other evidence
C) red-green color blindness is not X-linked
(Explain and prove your answer with the help of a Punnett square!)
Q. 8: The expressed or visible traits of an organism are referred to as its
A) genetic heritage
B) genotype
C) physiognomy
D) phenotype
E) body features
Q. 9: An allele that has no noticeable effect on the appearance and shape of an organism
unless it is found in a homozygous condition with the cells is said to be
A) dominant
B) recessive
C) co-dominant
D) dormant
E) regressive
Q. 10: Mendel’s principle of independent assortment states that
A) chromosomes sort independently of each other during mitosis and meiosis
B) genes sort independently of each other in animals but not plants
C) independent sorting of genes produces polyploid plants under some conditions
D) each pair of alleles segregates independently during gamete formation
E) both, a and d
Q. 11: In a cross between a pure bred, red-eyed female fruit fly and a white-eyed male,
what percent of the male offspring will have white eyes? (white eyes are X-linked,
recessive). Use a Punnett square to predict and to visualize the outcome of this X-linked
cross!
A) 100%
B) 75%
C) 50%
D) 25%
E) 0% (none)
14
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 12: Consider the family pedigree regarding a certain heritable trait below. The trait
with the filled out boxes is most probably inherited
A) X-linked recessive
B) Autosomal dominant
C) Autosomal recessive
Q. 13: Consider the family pedigree below which shows a shaded trait that represents
Kennedy-type muscular dystrophy, an X-linked recessive human trait, while the “clear”
boxes and circles represent normal individuals. What is the genotype of the family
member indicated with the arrow? (D = normal allele; d = allele for muscular dystrophy)
A) XD XD
B) Xd Xd
C) Xd Y
D) XD Y
E) mark E) if none of the above is correct
Q. 14: Consider the pedigree on the next page below. The shaded trait running in this
family is most probably inherited in a(n) _________________________ fashion.
A) X-linked recessive
B) X-linked dominant
C) autosomal dominant
D) autosomal recessive
15
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 15: Consider the pedigree from the previous question again. What is the genotype of
the family member labeled with the arrow, if H represents a dominant allele for the trait,
and h represents a recessive allele.
A) HH
B) XH XH
C) hh
D) Hh
E) XH Xh
Q. 16: Which statement is true of sex chromosomes?
A) Only animals and plants have sex chromosomes
B) The XX combination is homologous, while the XY combination is not
C) Men give an X chromosome to all of their sons, while the mother provides the Y
Chromosome
D) In humans, the Y chromosome is smaller than the X chromosome
Chapter 10: DNA, DNA REPLICATION & GENETIC CODE
Q. 1: What is the name of the enzyme which adds new nucleotides to the template DNA
strands during DNA replication?
A) RNA polymerase
B) DNA polymerase
C) Taq polymerase
D) the ribosome
E) Helicase
Q. 2: Which of the following cell components or enzymes are found in the replication fork
during active DNA replication?
A) Helicase
B) DNA polymerase
C) Primase
D) primer
E) all of the above
16
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 3: Explain in your own words why short RNA pieces (= primers) are needed during
DNA replication.
Q. 4: DNA transcription means
A) the doubling (= duplication) of a gene on the DNA strand
B) the copying of the genetic information on a gene into a double-stranded RNA
molecule
C) the copying of the genetic information on a gene into a single-stranded RNA
molecule
D) the copying of the genetic information on a gene into a polypeptide chain
E) the cutting-out (= excision) of non-coding DNA sequences from the DNA strand
Q. 5: The addition and polymerization of new nucleotides during the process of DNA
transcription is catalyzed by an enzyme called
A) Helicase
B) DNA Polymerase
C) RNA Polymerase
D) DNAase
E) RNAase
Q. 6: Which of the following codons mark(s) the beginning of a gene on the messenger
RNA (mRNA) molecule?
A) ATG
B) AUG
C) UGA
D) AUA
E) both, a and b
Q. 7: You are a Biochemist who carefully isolated ribosomes from a protein-secreting
eukaryotic cell type. Which of the following cellular components would you very likely
find to be attached with your ribosomal proteins?
A) rRNA, DNA, mRNA,
B) rRNA, pre-mRNA, aminoacyl-tRNA
C) rRNA, mRNA, aminoacyl-tRNA
D) tRNA, pre-mRNA, polypeptides
E) only mRNA and aminoacyl-tRNA
Q. 8: Transfer RNA plays a role in which of the following?
A) picking up the amino acid specified by the anticodon
B) recognizing the appropriate codons on the mRNA strand
C) transferring nucleotides to rRNA
D) help to convert (= translate) a nucleotide sequence into an amino acid
sequence (= polypeptide)
E) all of the above, except c
17
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 9: Knowing now the genetic code of life, what would be the expected (= deduced)
amino acid sequence of the polypeptide synthesized by a ribosome from the following
piece of mRNA
(Hint: Use the genetic code table on page 194 of your text book to crack the code!)
5’- AUGCCGGUACGGACGUGGUGUCAUUAAUAGUAA – 3’
↓
Start codon
Chapter 16: ORIGIN OF LIFE THEORIES
Q. 1: With the synthesis of which organic molecule did F. Woehler in 1836 disprove the
long favored “Vitalism theory”?
A) the amino acid alanine
B) uracil
C) urea
D) heme
E) chlorophyll
Q. 2: The experimental outcome of the Stanley-Miller experiment proved:
A) that life arose spontaneously from inorganic matter in an oxygen atmosphere
B) that organic molecules, such as amino acids, can spontaneously form under
anoxic conditions in the presence of inorganic molecules and electrical
discharges
C) that organic molecules form spontaneously in the presence of RNA enzymes
D) that organic molecules were seeded on planet Earth through repeated
meteorite impacts
Q. 3: Which of the following hypotheses regarding the theory of a chemiosynthetic origin
of life on planet earth is NOT verified by scientific studies and experimental evidence?
A) Inorganic molecules react to form organic monomers under some conditions
B) Organic molecules form organic polymers under some conditions
C) Organic polymers assemble to form “proto cells” that exhibit some, but not all,
characteristics of living cells
D) Under the right conditions “proto cells” transform into a primitive prokaryotic cell
18
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 4: Which statement is NOT true of the evolutionary theory of the origin of life on
Earth?
A) Clays and other charged surfaces may have served as early catalysts for primordial
chemical reactions
B) RNA may have served as both, genetic material and enzymes, in early organisms
C) Organic molecules may have been brought (seeded) to Earth in significant quantities
by comets and meteorites
D) There is consensus in the scientific community as to the precise mechanisms by
which early life forms arose from inorganic materials on Earth
Chapter 17: PLANTS & PLANT LIFE CYCLES
Q. 1: Certain green algae, e.g. Coleochaete, are considered to be the ancestors of all
modern land plants because they share which of the following homologous element(s) or
structure(s)?
A) cell walls made of cellulose
B) starch as a storage molecule for produced carbohydrates
C) the appearance of flagellated sperm during stages of their life cycles
D) the presence of chlorophyll a and b to perform photosynthesis
E) all of the above
Q. 2: The early fossil plants Cooksonia and Rhynia exhibited which of the following
features?
A) sporangia
B) branched, upright stems with primitive vascular tissue
C) primitive leaves
D) developed roots
E) both, a and b
F) all of the above
Q. 3: Which of the following group of biological organisms is NOT a member of the plant
kingdom?
A) liverworts
B) pteridophyta (ferns)
C) cyanobacteria
D) horsetails
E) bryophyta
Q. 4: Plant life cycles have a characteristic alternation between a _____ gametophyte
stage and a _____ sporophyte stage.
A) heterozygous … homozygous
B) homozygous … heterozygous
C) haploid … diploid
D) diploid … haploid
E) haploid … polyploid
19
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 5: What is the name of the female gamete (= egg cell)-producing plant part of mosses?
A) gonad
B) gametangium
C) antheridium
D) archegonium
E) sporangium
Q. 6: the typical large, fan-like leaves of the ferns, which we usually see, is the
dominating ______ stage of this plant; all the cells of the fern at this stage of the plant
cycle have a _____ chromosome set.
A) gametophyte … diploid
B) gametophyte … haploid
C) sporophyte … diploid
D) sporophyte … haploid
E) thallus … haploid
Q. 7: Which of the following plants has a dominant sporophyte generation and a seed,
but no fruit?
A) fir tree
B) pine tree C) pepper tree D) maple tree
E) both, a and b
Q. 8: The gymnosperms (e.g. conifers) were the first seed plants on Earth. Where on the
conifer tree would you look for the typical, winged seeds to appear?
A) male cone
B) female cone
C) male gametophyte
D) female gametophyte
E) female flower
F) conifers are not seed plants
Q. 9: The pollen grain of angiosperm plants has a _____ chromosome set and (after
germination) represents the _______ stage of this group of plants
A) diploid … sporophyte
B) diploid … gametophyte
B) haploid … sporophyte
D) haploid … gametophyte
E) haploid … antheridium
F) both a and e is true
Q. 10: Which of the following plant groups developed last, but most successfully on
planet Earth?
A) Bryophytes
B) Ferns
C) Ginkgos
D) Conifers
E) Flowering plants
Q. 11: The gymnosperms (e.g. conifers) were the first seed plants on Earth. Where on the
conifer tree would you look for the typical, winged seeds to appear?
A) male cone
B) female cone
C) male gametophyte
D) female gametophyte
E) female flower
20
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 12: The embryo within a seed of a gymnosperm or angiosperm plant represents the
early, dormant ______ stage of the plant life cycle; each embryo cell has the ______ set
of chromosomes.
A) zygote … diploid
B) sporophyte … diploid
C) gametophyte … diploid
D) sporophyte … haploid
E) gametophyte … diploid
Q. 13: In angiosperms (= flowering plants), one of the originally four _____ macrospore
cells survives, and builds the so-called embryo-sac which is the ______ .
A) diploid … male gametophyte
B) haploid … male gametophyte
C) diploid … female gametophyte
D) haploid … female gametophyte
E) haploid … female sporophyte
Q. 14: Live plant cells, which are arranged as end-to-end forming tubes and which buildup the plant’s phloem tissue, are called _______ . They are responsible for ______ within
the plant.
A) sclerenchyma cells … photosynthesis
B) collenchyma cells … water transport
C) vessel elements … the transport of nutrients and metabolites
D) sieve tube cells … the transport of nutrients and metabolites
E) sieve tube cells … water transport
Chapter 18: ANIMALS & ANIMAL DIVERSITY
Q. 1: Which of the following sequence of events describes the early embryonic
development of a typical animal.?
A) haploid zygote  Gastrula  Morula  cleavage  Blastula  embryo
B) diploid zygote  Gastrula  Morula  cleavage  Blastula  embryo
C) diploid zygote  cleavage  Gastrula  Blastula  Morula  embryo
D) diploid zygote  cleavage  Morula  Blastula  Gastrula  embryo
E) diploid zygote  cleavage  Blastula  Morula  Gastrula  embryo
Q. 2: Which of the following is/are the most unique animal characteristic(s), which
separates them from all other biological organisms on this planet?.
A) Being diploid organisms
B) Showing a gastrula stage in early embryonic development
C) Being mobile
D) Being multi-cellular
E) They reproduce sexually
21
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 3: An animal has following body features and shape. A radial symmetrical body made
of ectoderm and endoderm tissue, a digestive cavity but no anus and developed muscles
as well as nerve fibers. These features describe best a(n)
A) earthworm
B) flatworm
C) juvenile sponge
D) mollusk
E) adult cnidarian
Q. 4: Why are sponges (Porifera) not considered to be true animals by biologists?
A) because they do not sexually reproduce
B) because they do not have a brain
C) because they do not have true tissues, e.g. endoderm, ectoderm, mesoderm
D) because they do not have a skeleton
E) because they do not show a gastrula stage during embryonic development
Q. 5: The body of which of the following animal phyla is characterized by radial
symmetry?
A) Porifera
B) Cnidarians
C) Amphibia
D) Nematoda
Q. 6: Does a roundworm have a skeleton? If so, what kind?
A) yes, exoskeleton
B) yes, endoskeleton
C) yes, hydrostatic skeleton
D) yes, elastic skeleton
E) there is no skeleton whatsoever in these animals
Q. 7: Which of the following animal phyla is characterized by an incomplete digestive
system and the lack of any form of skeleton?
A) Porifera
B) Platyhelminthes
C) Nematoda
D) Annelida
E) Arthropoda
Q. 8: Clams, oysters and squid belong to which of the following animal phyla?
A) Annelida
B) Mollusca
C) Arthropoda
D) Chordata
22
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 9: You collect a living organism on the beach which has following body features: a
chitin-made exoskeleton, appendages and walking legs, eyes and a segmented tail. You
conclude that this organism is a(n) ________ and belongs to the phylum _________ .
A) protist … arthropoda
B) animal … arthropoda
C) animal … annelida
D) animal … chordata
E) animal … echinodermata
Q. 10: The rigid, longitudinal rod observable in all life forms belonging the animal phylum
Chordata is called:
A) nerve chord
B) notochord
C) endoskeleton
D) vertebral column
Q. 11: The appearance of the coelom in animals co-incites with the evolution of :
A) nerve fibers and brains
B) internal organs
C) a complete digestive system
D) wings
E) vertebral column
Q. 12: Which of the following body feature(s) and/or development(s) of reptiles (is) are
different from amphibians and played a major role in the their successful adaptation to
dry land conditions?
A) a large brain and developed nervous system
B) internal fertilization
C) the development of an amniotic egg
D) an endoskeleton made of bones
E) both, b and c
Q. 13: Which form of skeleton is characteristic for the animal phylum Arthropoda?
A) hydroskeleton
B) endoskeleton
C) exoskeleton
D) cartilaginous skeleton
E) arthropods do not possess a skeleton
Q. 14: The characteristic that distinguishes echinoderms (e.g. sea urchin) and chordates
(e.g. birds, humans) from other animal phyla is that echinoderms and chordates:
A) exhibit bilateral symmetry
B) are deuterostomes
C) exhibit radial symmetry
D) are protostomes
E) have endoderm, mesoderm and ectoderm as embryos
Q. 15: Which of the following is characteristic of vertebrates?
A) a skull
B) a backbone consisting of vertebrae
C) a skeleton made of bone
D) radial symmetry
E) both, a and b
23
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Chapter 13-15: EVOLUTIONARY THEORY
Q. 1: The ancient Greek philosopher Aristotle expressed which of the following ideas?
A) natural forces are at work permanently changing the Earth’s surface
B) an individual’s use of a body part causes it further to evolve
C) species are fixed in its shape and do not evolve
D) the best evidence for change within species is seen in fossils
E) man is the crown of creation
F) both, c and e
Q. 2: Which of the following are the main ideas that the British naturalist Charles Darwin
advanced in his works about 150 years ago?
A) the morphology of biological organisms changes over long periods of time
B) living species have arisen from earlier life forms
C) humans arose by different mechanism than did other species
D) the Earth is approximately 6000 years old and a relatively stable environment
E) both, a and b
Q. 3: Who proposed that mutations are directed out of “need” and that acquired
characteristics (like the formation of webbed toes in an athletic swimmer during his/her
life time) are passed on to the offspring?
A) J. B. Lamarck
B) Ch. Darwin
C) G. Mendel
D) Lyell
E) A. v. Humboldt
Q. 4: Which of the following best describe a biologist’s definition of evolution? The
evolutionary theory explains the:
A) origin of the universe
B) origin of life
C) extinction periods of life
D) origin of species
Q. 5: The earliest discovered fossils represent _______, which (based on radiometric
analysis) lived around ________ years ago.
A) cnidarians, such as jellyfishes … 600 million
B) microorganisms, such as cyanobacteria … 3 billion
C) plants … 1 billion
D) marine invertebrates … 600 million
E) hominids … 4 million
24
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 6: Who, in addition to Charles Darwin, independently (and at the same time period)
arrived at the theory of evolution due to natural selection?
A) Lamarck
B) Linnaeus
C) Wallace
D) Cuvier
E) Mayr
Q. 7: In his book “ On the Origin of Species …”, Darwin systematically outlines evidence
for the following hypotheses, except one. Which topic did Darwin NOT have direct
evidence to support?
A) Variations occur in populations of all species
B) More young are produced than survive to adulthood, creating a struggle for existence
C) Traits are inherited from parents
D) Selection for traits are possible
E) DNA is the genetic material
Q. 8: A change in the relative frequencies of alleles in the gene pool of a population of
the same species is called
A) genetic drift
B) genetic recombination
C) mutation
D) natural selection
E) micro-evolution
Q. 9: Which of the following events affecting the hereditary molecule DNA can contribute
to genetic variation in the gene pool of a given species?
A) unequal recombination
B) point mutations caused by natural radiation or errors during DNA replication
C) crossing over events during meiosis
D) DNA insertion of retrotransposons and retroviruses
E) all of the above
25
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 10: Assume there is a population of moths. Those that are homozygous dominant
regarding the trait wing and body color are black colored, those that are heterozygous
are grey colored and that are homozygous recessive are white colored. Over time (in a
certain habitat), the moth population has more grey colored members. Which type of
natural selection has occurred in this habitat?
A) Disruptive
B) Directional
C) Stabilizing
Q. 11: Assume, due to an extended period of draught, a breeding pair of some animal
migrates to a new habitat in search of water. Both individuals are heterozygous (Aa) for a
distinctive trait, but all four offspring of that couple are homozygous recessive (aa) for
that trait. In the parental generation the recessive allele (a) makes up 50% of the alleles,
but after the offspring are born, the recessive allele (a) makes up 83% of the alleles in the
population. What force of evolution is responsible for this genetic change in the
population?
A) Natural selection
B) Mutation and recombination
C) Genetic drift
D) Horizontal gene transfer
Q. 12: The evolution of new species is often triggered by separation or immigration
events. One of the most important geological forces on our planet which leads to the
separation of continents, formation of new islands or mountain ranges and is
responsible for recurrent volcanic activities is called _______ .
A) continental drift
B) plate tectonics
C) biogeography
D) rotational tilt
E) both, a and b
Q. 13: How is the merging of continents, e.g. to form the super-continent Pangaea,
believed to have altered the Earth’s environment at that time?
A) it changed the pattern of ocean currents, which in turn affected climates on land
B) it reduced the amount of coastal and shallow-sea environments, and it brought
organisms into competition with unfamiliar organisms
C) it made the inland climate on Pangaea more wet
D) it made the inland climate on Pangaea very dry
E) all of the above, except c
26
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 14: Long-legged cheetahs are well adapted to catching prey. The ancestor of the
cheetah is believed to have had relatively short legs. Accounting to Darwinian views, the
evolution of long-legged cheetahs is best explained by :
A) directional selection
B) the theory of use and disuse
C) the theory of acquired characteristics (= Epimutations)
D) stabilizing selection
E) both, b and d
Q. 15: Which force of evolution is NOT considered random or circumstantial?
A) Natural selection
B) Mutation
C) Genetic drift
Q. 16: A cheetah population was once quite large and was reduced to a single familial
group by a devastating virus epidemic, before reestablishing itself again in large
numbers. The new population shows gene frequencies that differ from the original
cheetah population. Which term of the evolutionary theory best describes this situation?
A) Bottle neck
B) Founder effect
C) Genetic isolation
Q. 17: Thirty people are assigned to live in a spaceship that is exploring another solar
system. The journey will take several hundred years and will be completed by the
descendants of these crew members. The gene pool of the population on the returning
ship is most likely to reflect
A) a founder effect
B) a bottleneck effect
C) gene flow
D) selection pressure
E) polymorphism
Q. 18: Genetic drift resulting from a natural disaster that drastically reduces population
size, e.g. earthquake, volcanic eruption, viral or bacterial epidemic, etc., is called:
A) natural selection
B) gene flow
C) a bottle neck effect
D) nonrandom mating
E) a founder effect
27
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 19: In the Utah desert, two varieties of sunflower hybridized to produce a new species
of sunflower that will not breed back to either parental type. All three coexist in the same
habitat. What type of speciation describes this scenario?
A) Allopatric speciation
B) Sympatric speciation
C) Parapatric speciation
Q. 20: Speciation that involves a population that has become separated from the rest of
the species by a geographical barrier that prevents gene flow, and that evolves into a
new species, is called ________ speciation
A) genetic isolation
B) founder effect
C) sympatric
D) allopatric
E) biogeographic
Q. 21: Speciation, i.e. formation of new species, may arise as a result of reproductive
isolation. Reproductive isolation can occur when individuals in two populations of
organisms
A) can’t mate with each other anymore because mating occurs at different times
B) mate with each other but produce offspring that are nonviable or sterile
C) use different types of behaviors to attract mates
D) have anatomical features that make it difficult for organisms from different
populations to mate and transfer sex cells
E) all of the above
Q. 22: The numerous types of mammals currently populating earth evolved from a group
of small, shrew-like mammals that managed to survive the Cretaceous mass extinction
about 65 million years ago. Knowing the concepts of the evolutionary theory, which
choice best describes this scenario?
A) it is an example of adaptive radiation
B) it is an example of stabilizing selection
C) it is an example of directed selection
D) there is no natural explanation for the scenario
Q. 23: Some researchers have noted that the fossil record on earth is marked by at least
four major mass extinctions, which in turn were all followed by the explosive increase in
numbers of different species. Which of the following terms best applies?
A) Punctuated equilibrium
B) Genetic drift
C) Continental drift
D) Bottleneck effect
28
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 24: Which statement is NOT true of mutations?
A) Mutations are directed out of need, i.e. if a species needs a certain mutation to
produce a “useful” trait, it is more likely to mutate to produce that trait, than it is to
generate a “non-helpful” or neutral trait
B) Mutations are random events and they are not directed
C) Mutations produce new gene versions and eventually new traits within a population
D) Forces of nature decide the value of the new traits caused by mutations by testing an
organism’s ability to survive and reproduce
E) Mutations are a major factor in the creation of genetic variation
Q. 25: Which statement is NOT true of natural selection?
A) Natural selection causes differential reproductive success in a population, allowing
genes that confer some reproductive advantage to accumulate (increase in
frequency) in a population
B) Natural selection always reduces the genetic diversity in a population
C) Natural selection leads to organisms that are adapted to their habitat over time
D) Natural selection explains many if not most structures and body features of living
organisms
Q. 26: Using the Hardy-Weinberg equation (p+q = 1; or p2 + 2pq + q2 = 1), what statement
is true of a population in which p = 0.2?
A) the frequency of the dominant allele A in the population is 0.2
B) the frequency of the dominant homozygotes (AA) in the population is 0.2
C) the frequency of the recessive allele a in the population is 0.2
D) the frequency of the recessive homozygotes in the population is 0.8
E) the frequency of the heterozygotes in the population is 0.32
Q. 27: The genotype of a homozygous recessive trait (= q2) in humans is observed in 2%
of a population. By applying the Hardy-Weinberg law (under its assumptions), what
would be the percentage of the heterozygous (= 2pq) genotype in that population?
A) 80%
B) 48%
C) 24%
D) 12%
E) 2%
29
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Chapter 34-36: ECOLOGY
Q. 1: Which of the following statements best defines a species
A) a species is a form of life capable to successfully interbreed with another form of life
to create vital offspring of the same form
B) species are forms of life that can’t mate with each other anymore because mating
occurs at different times
C) species are forms of life that mate with each other but produce offspring that are
nonviable
D) species are forms of life that use different types of behaviors to attract mates
E) have anatomical features that make it difficult for organisms from different populations
to mate and transfer sex cells
Q. 2: In which of the following choices are levels of organization arranged from most to
least inclusive?
A) community, ecosystem, individual, population
B) ecosystem, community, population, individual
C) population, ecosystem, individual, community
D) individual, population, community, ecosystem
E) individual, community, population, ecosystem
Q. 3: Which of the following shows the most complex level of organization and
organismal interactions in nature
A) a community
B) a population
C) an ecosystem
D) parasitism
E) symbioses
Q. 4: Which of the following conceptual levels of ecologic organization incorporates
abiotic factors?
A) community
B) ecosystem
C) population D) species
E) symbioses
Q. 5: While on a walk through a forest you notice birds on trees, earthworms in the soil,
small amphibians in a moist depression and fungi on the bark of trees. Based on this you
can conclude that each of these organisms occupies a different
A) habitat
B) biome
C) ecosystem
D) biosphere E) community
Q. 6: The sum of all Earth’s ecosystems is called the
A) stratosphere
B) lithosphere
C) biosphere
D) hydrosphere
E) troposphere
Q. 7: Which of the following environmental factors usually has the greatest direct effect
on the distribution and stability of terrestrial plant groups?
A) soil type and composition
B) prevailing winds
C) amount of sunlight
D) amount of available water/moisture
E) none of the above
30
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 8: Disturbances (in an ecological sense) usually trigger the formation of new
communities in a process called
A) sucessful recovery
B) succession
C) co-evolution
D) ecological niching
E) none of the above
Q. 9: The ecological process currently observable in the Cuyamaca Rancho State Park
after the devastating wild fire last year is referred to as:
A) complete recovery
B) primary succession
C) secondary succession
D) remission
Q. 10: Which of the following plants would you find amongst the pioneering plants in the
former wild fire areas of Cuyamaca Rancho State Park?
A) Coastal cholla
B) California goldenrod
C) Coastal black oak
D) Ponderosa pine
E) Guard lupine
Q. 11: Which of the following animals is the top predator in the coastal waters of
California?
A) the sea lion
B) the great white shark
C) the bottle neck dolphin
D) the sea bass
E) the Pacific oyster
Q. 12: In the aquatic food chain, crustaceans, such as lobsters, are considered to be:
A) primary producers
B) primary carnivores
C) secondary carnivores
D) top carnivores
E) parasites
Q. 13: The animal-plant interaction of a food chain, where the animal eats the plant, the
predator is called the
A) top carnivore
B) herbivore
C) omnivore
D) consumer
Q. 14: The “competitive exclusion principle” which has been shown to apply to different
ecosystems and affects different species states:
A) that every ecosystem has the capacity for only 150 different species to live in
B) the different ecosystems are populated by different species
C) that two very similar species competing for the same limiting resource cannot co-exist
in the same place
D) that if competition occurs in an ecosystem it excludes at least two species
E) none of the above
31
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 15: The existence of immune systems in diverse, highly developed biological
organisms is considered to be the result of ________________ and interpreted as an
adaptive response to the presence of _____________ in the environment.
A) mimicry … gases
B) mimicry … toxins
C) co-evolution … toxins
D) co-evolution … microbes, e.g. viruses and bacteria
E) competition … repellents
Q. 16: The presence of the protozoan Giardia lamblia in the intestine of a human is an
example of
A) commensal parasitism
B) parasitic symbiosis
C) commensal symbiosis
D) mutualism
E) mimicry
Q. 17: The symbiotic interaction between certain fungi and a plant species occurring in
form of mycorrhiza is referred to as
A) camouflage
B) mimicry
C) mutualism
D) parasitism
E) commensalism
Q. 18: The primary energy source of a typical terrestrial ecosystem is:
A) the sun
B) wind
C) volcanic activity
D) the organic soil components
E) the decaying matter
Q. 19: An area within an ecosystem which defines an organism's place of residence,
including the role of that organism in the community, factors limiting its life, and how it
acquires food is referred to as the
A) biome
B) adaptive zone
C) ecological niche
D) breeding place
Q. 20: In food pyramids the amount of energy available at each successive, next higher
trophic level always shows a __________ because of ____________________ .
A) increase … biomass accumulation
B) increase … first law of energy
C) decrease … loss of heat energy due to the second law of energy
D) decrease … first law of energy
Q. 21: The the habitat of a distinct species within an ecosystem is often referred to as the
so-called
A) biome
B) biosphere
C) ecological niche
D) survival corner
32
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 22: Freshwater and sea water mix in a(n)
A) pelagic zone
B) estuary
C) benthic zone
D) limnetic zone
D) abyssal zone
Q. 23: Which of the following is the ultimate raw material of the nitrogen cycle which is
used by nitrogen fixing bacteria?
A) water
B) N2
C) nitrate
D) ammonia
E) nitrite
Q. 24: Which of the following nitrogenous molecules can be directly taken up by green
plants and are used to build up nitrogen-containing organic molecules, such as amino
acids and nucleotides?
A) N2
B) nitrate
C) ammonia D) nitrite
E) both, b and c
Q. 25: The reason why the cells of green plants cannot directly use atmospheric nitrogen
(= N2) for build-up of nitrogenous compounds, such as amino acids, nucleotides, is:
A) because N2 cannot reach the hair root cells in the soil which is the place of nitrogen
uptake
B) because they lack the nitrogen-fixing enzyme nitrogenase
C) because they lack the nitrogen-fixing enzyme Rubisco
D) because they live in mutual beneficial partnership with fungi
Q. 26: An environmental pollutant kills the Rhizobium bacteria in the root nodules of
Alfalfa plants agricultured in a certain region. Which of the following is mostly likely to
happen with the yield of this agricultural plant?
A) the Alfalfa yield will increase because the plant pathogen Rhizobium is destroyed
B) the yield will decrease because the Alfalfa plants will have more difficulties to satisfy
their nitrogen demand with the help of the Rhizobia bacteria
C) the yield will decrease because they cannot take up soil minerals as effectively
D) the yield will decrease because their photosynthesis rate will slow down
Q. 27: Why are the run-offs from fertilized agricultural fields, even if free of pesticides,
often harmful to the ecosystems of temperate lakes?
A) certain fertilizer compounds, such as ammonia and nitrates, are extremely toxic to
fishes
B) the dissolved fertilizer components in the run-offs may trigger surface algal blooms,
which slowly reduces the lakes oxygen by cutting off the sunlight and fouling the
water with the dead and decomposing algal bodies
C) the runoff raises the levels of inorganic nutrients in the surface waters to levels that
are toxic for algae and other lake organisms
D) runoff water pools at the lake’s bottom, where the fertilizer compounds react with
materials in the sediment to form toxic substances
E) both, a and b
33
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 28: Which of the following is/are (a) true statement(s) about biomes, the major
terrestrial ecosystems covering the Earth?
A) each of the nine major biomes is restricted to mostly one or two continent
B) the major factors affecting the distribution of biomes are temperature and sunlight
C) nowadays, most biomes are affected by human activity and disturbances
D) natural disturbances, such as fire, are very important for some biomes
E) both, c and d
Q. 29: Which of the following biomes would have the highest number of different species
per square mile?
A) tropical deciduous forest
B) tropical thorn forest
C) tropical rain forest
D) tropical savanna
E) temperate deciduous forest
Q. 30: The major factor contributing to tropical deforestation and species decay is
A) lumber and mining companies clearing land for industrial production
B) people clearing forests to open agricultural land
C) governments of developing countries selling of land to earn cash
D) governments clearing forests to build cities
E) both, a and b
Q. 31: Chaparral vegetation occurs around much of the central valley of central and
southern California. This biome is very similar to that found
A) along the coast of New Zealand
B) in the Australian interior
C) in the Mediterranean region, e.g. Italy, Spain
D) in the southeast coast of China
E) along the coast of Great Britain
Q. 32: Most of the best agricultural soils in the United States occur in areas that formerly
were
A) grasslands
B) savanna
C) taiga forest
D) tropical rain forest
E) deciduous forest
Q. 33: Which of the following biomes generally has the shortest growing season?
A) chaparral
B) deciduous forests
C) savanna
D) taiga
E) temperate grasslands
Q. 34: The feeding relationships among the species of a community is the community’s
A) niche
B) diversity
C) density
D) richness
E) trophic stucture
34
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 35: In an ecosystem, you would most expect to find interspecific competition between
A) males and females of a species in which both sexes occupy the same niche
B) population of two species that occupy the same niche
C) males of a species during the breeding season
D) a prey species and its predator
E) Two wasp species that mimic each other’s appearance
Q. 36: According to the competitive exclusion principle, two species cannot continue to
occupy the same
A) environmental habitat
B) ecological niche
C) territory
D) range
E) biome
Q. 37: The relationship between Heliconius caterpillars, which feed on passionflower
vines, and the passion flower vines, which combat the caterpillars by various means,
would best be described as
A) predation.
B) parasitism.
C) mutualism
D) commensalism
E) interspecific competition
Q. 38: What, if any, is the adaptive value to a tobacco plant of producing nicotine?
A) Nicotine attracts pollinating moths
B) Nicotine attracts seed-dispersing birds
C) Nicotine serves as a defense against predation
D) None-tobacco plants produce nicotine because humans bred them to
E) None-nicotine is present because it is an intermediate in a metabolic pathway
used by tobacco plants
Q. 39: The relationship between a cow and the cellulose-digesting bacteria in the rumen
of its alimentary tract would best be described as
A) predation
B) parasitism
C) mutualism
D) commensalism
E) interspecific competition
Q. 40: The prokaryotes that cause tooth decay have a ______ relationship with humans.
A) parasitic
B) commensalistic
C) mutualistic
D) competitive
E) ammensalistic
35
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 41: When a New England farm is abandoned, its formerly plowed fields first become
weedy meadows, then shrubby areas, and finally forest. This sequence of plant
communities is an example of
A) evolution
B) a phylogenetic trend
C) a trophic chain
D) plant succession
E) genetic drift
Q. 42: In an average ecosystem, about how much energy is present in the organisms at a
given trophic level compared to the organisms at the next higher trophic level?
A) a tenth as much
B) half as much
C) twice as much
D) ten times as much
E) It is impossible to say without knowing which trophic levels are involved
Q. 43: Which of the following substances is not cycled between organic matter and
abiotic reservoirs?
A) water
B) carbon
C) nitrogen
D) phosphorus
E) all of the above are cycled between biotic and abiotic reservoirs
Q. 44: Given that CO2 is produced by respiration, why does the amount of CO2 in the
atmosphere remain relatively constant? (When answering this question, exclude the
impact of human activities on atmospheric CO2)
A) CO2 is converted in photosynthesis to carbohydrates
B) CO2 is split apart during photosynthesis
C) CO2 mostly forms carbonate rocks
D) CO2 is trapped in dead organisms’ bodies
E) CO2 is a buffer
Q. 45: Which of the following is an ecological problem that can be caused by fertilizing a
golf course with phosphorous-rich fertilizer?
A) too much phosphorus can kill the grass
B) too much phosphorus will promote the growth of weed
C) much of the phosphorus will be washed away and end up polluting lakes and
rivers
D) phosphorus can accumulate to toxic levels in animals in the vicinity, especially
those higher on the food chain
E) phosphorus is in short supply worldwide, and using it on golf courses is wasteful
Q. 46: The current rate of species extinction is ________ than at any other time in the
past 100,000 years.
A) 10 times higher
B) lower
C) 100 times higher
D) 1000 times higher
E) 50 times higher
36
MESA COLLEGE, SAN DIEGO
School of Mathematics & Natural Sciences
General Biology Lecture (BIOL 107): Instructor: Elmar Schmid, Ph.D.
Q. 47: The single greatest threat to biodiversity is
A) global warming
B) habitat destruction
C) the introduction of exotic species
D) overpopulation
E) overexploitation of populations for food
Q. 48: The increase in the concentration of a substance in the tissues of organisms as it
is passed up a food chain is called
A) concentration of toxins
B) biological magnification
C) maximization
D) imcrementalization
E) predatory accumulation
Q. 49: Measures of atmospheric carbon dioxide levels taken in Hawaii have shown that
these levels have increased _______ in the last 40 years.
A) 14%
B) 18%
C) 20%
D) 23%
E) 27%
Q. 50: The increase in global temperature that is the greenhouse effect is due to
A) CO2 allowing more solar radiation to penetrate to the Earth’s surface.
B) CFCs slowing the escape of heat from Earth.
C) The loss of ozone that trapped cooling UV radiation in the atmosphere.
D) CO2 slowing the escape of heat from Earth.
E) CO2 slowing the escape of UV radiation from Earth.
37