Download Structure-Function Studies of Bacteriophage P2 Integrase and Cox Protein

Structure-Function Studies of
Bacteriophage P2 Integrase and
Cox Protein
A Detailed Study of Two Proteins Involved in the Choice of
Bacteriophage Reproductive Mode
Jesper Eriksson
Department of Genetics, Microbiology and Toxicology
Stockholm University
Stockholm 2005
1
Abstract
Probably no group of organisms has been as important as bacteriophages
when it comes to the understanding of fundamental biological processes like
transcriptional control, DNA replication, site-specific recombination, e.t.c.
The work presented in this thesis is a contribution towards the complete
understanding of these organisms. Two proteins, integrase, and Cox, which
are important for the choice of the life mode of bacteriophage P2, are investigated. P2 is a temperate phage, i.e. it can either insert its DNA into the host
chromosome (by site-specific recombination) and wait (lysogeny), or it can
produce new progeny with the help of the host protein machinery and thereafter lyse the cell (lytic cycle). The integrase protein is necessary for the
integration and excision of the phage genome. The Cox protein is involved
as a directional factor in the site-specific recombination, where it stimulates
excision and inhibits integration. It has been shown that the Cox protein also
is important for the choice of the lytic cycle. The choice of life mode is regulated on a transcriptional level, where two mutually exclusive promoters
direct whether the lytic cycle (Pe) or lysogeny (Pc) is chosen. The Cox protein has been shown to repress the Pc promoter and thereby making transcription from the Pe promoter possible, leading to the lytic cycle. Further,
the Cox protein can function as a transcriptional activator on the parasite
phage, P4. P4 has gained the ability to adopt the P2 protein machinery to its
own purposes.
In this work the importance of the native size for biologically active integrase and Cox proteins has been determined. Further, structure-function
analyses of the two proteins have been performed with focus on the proteinprotein interfaces. In addition it is shown that P2 Cox and the P2 relative
WΦ Cox changes the DNA topology upon specific binding. From the obtained results a mechanism for P2 Cox-DNA interaction is discussed.
The results from this thesis can be used in the development of a gene delivery system based on the P2 site-specific recombination system.
© Jesper Eriksson, Stockholm 2005
ISBN 91-7155-128-X pp1-82
Typesetting: Intellecta Docusys
Printed in Sweden by Intellecta Docusys, Stockholm 2005
Distributor: Stockholm University Library
2
To Sara, Moa and Ida
3
Munen Muso Meikyo Shisui
-“Clear Mind Reflects Like Quiet Water”
Kendo Philosophy
4
List of publications
This thesis is based on the following articles as well as unpublished results:
I.
Eriksson, J.M. and Haggård-Ljungquist, E. 2000. The multifunctional bacteriophage Cox protein requires oligomerization for biological activity. Journal of Bacteriology 182:6714-6723.
II.
Ahlgren-Berg, A., Eriksson, J.M., and Haggård-Ljungquist, E.
2005. A comparative analysis of the multifunctional Cox proteins
of the two heteroimmune phages P2 and WΦ. Manuscript.
III.
Frumerie, C., Eriksson, J.M., Dugast, M., and HaggårdLjungquist, E. 2005. Dimerization of bacteriophage P2 integrase
is not required for binding to its DNA target but for its biological
activity. Gene 344: 221-231.
The cover illustration is a modified image of the central section of the bacteriophage
P2 head, published in “Dokland, T., Lindqvist, B:H: and Fuller, S.D. (1992) EMBO
Journal 11:839-846”.
5
6
Contents
Abstract ...........................................................................................................2
List of publications...........................................................................................5
Introduction ...................................................................................................11
Background ...................................................................................................13
Bacteriophage P2 .......................................................................................................13
P2 propagation ......................................................................................................15
P2 lytic-lysogeny switch.........................................................................................16
P2 site-specific recombination ...............................................................................17
P2-P4 interaction ...................................................................................................19
P2 Cox protein and its DNA substrates..................................................................21
P2 integrase and its DNA substrates .....................................................................22
P2 Int regulation ....................................................................................................22
WΦ - a P2 relative .................................................................................................23
Conservative site-specific recombination ....................................................................24
Introduction............................................................................................................24
Tyrosine Recombinases ........................................................................................25
Recombination directionality factors (RDFs) ..........................................................27
The mechanism of conservative site-specific recombination..................................29
Regulation of active sites.......................................................................................31
Cis versus trans cleavage......................................................................................32
Intasome formation-putting the pieces together .....................................................32
Regulation of transcriptional initiation..........................................................................37
Introduction............................................................................................................37
The RNA polymerase ............................................................................................37
The promoter element ...........................................................................................37
Initiation of transcription.........................................................................................38
Regulation of transcriptional initiation ....................................................................39
DNA-Bending and transcriptional regulation ..........................................................41
The lysis-lysogeny switch of bacteriophage λ ........................................................42
Present investigation.....................................................................................45
Aim of the study ..........................................................................................................45
Specific Methods.........................................................................................................45
Results and Discussion...............................................................................................46
List and brief summary of the papers.....................................................................46
P2 Cox forms multimers in vivo (Paper I)...............................................................47
P2 Cox forms dimers, trimers, tetramers and octamers in vitro (Paper I and II) .....47
P2 Cox binds cooperatively to DNA (Paper I) ........................................................48
Oligomerization is essential for DNA binding and P2 Cox activity (Paper I) ...........48
The C-terminal part of the P2 Cox protein is involved in oligomerization (Paper I).48
7
Investigation of the WΦ Cox binding sites (Paper II) ..............................................49
Comparison of P2 and WΦ Cox in vitro oligomerization (Paper II).........................50
Domain swapping between P2 Cox and WΦ Cox (Paper II) ..................................50
DNA length requirement for specific P2 Cox-DNA interactions (Unpublished) .......50
Specific P2 Cox and WΦ Cox binding induces a large bend in the DNA targets
(Paper II)................................................................................................................52
P2 Cox does not bend DNA when binding non-specific substrates (Paper II) ........53
P2 integrase forms dimers in vivo, but does not show cooperative binding or
oligomerization (Paper III)......................................................................................53
Sequencing of int defective mutants (Unpublished) ...............................................54
Residues affecting Int dimerization are located in the C-terminal part of the protein
(Unpublished results).............................................................................................55
The absolute C-terminal end is also involved in dimerization of P2 integrase (Paper
III) ..........................................................................................................................56
Residue E197 in P2 integrase is involved in Int dimerization (Paper III) ................56
Capacities of the mutated and truncated Int proteins to complement the int1
defective P2 prophage (Paper III and unpublished results)....................................57
The C-truncated integrase proteins and E197A Int protein bind normally to the
phage attachment site but do not retain full recombination activity (Paper III)........57
P2 Int cleaves single stranded DNA (Unpublished results) ....................................58
Conclusions and speculations.....................................................................................59
The Cox boxes of phage P2 - a closer inspection and thoughts ............................59
A hypothetical mechanism for the formation of Cox oligomers...............................61
A speculative model for Cox-DNA interaction ........................................................61
Summary of the Cox action at the different DNA targets........................................62
Speculation about the nature of the protein-protein interaction between Int
monomers..............................................................................................................63
Future perspectives.......................................................................................65
Structural determination of integrase and Cox .......................................................65
Extended structure-function studies of integrase and Cox .....................................65
Protein-protein interactions within the Intasome ....................................................65
RNA-polymerase – Cox interactions ......................................................................66
Integrase cleavage sites ........................................................................................66
Int auto regulation ..................................................................................................66
Identify and exchange the core recognition domain of integrase ...........................67
IHF independent integrase.....................................................................................67
Intasome structure .................................................................................................67
Studies of protein-DNA interactions .......................................................................67
Acknowledgements .......................................................................................69
References ....................................................................................................72
8
Abbreviations
aa
attB
attP
Bp
CAT
CFU
Cox
CTD
DSR
EMSA
HTH
IHF
Int
kDa
Kb
mRNA
mIHF
Nt
NTP
ORF
PAGE
PFU
pI
RDF
RNAP
SDS
Wt
amino acids
Attachment site, bacterium
Attachment site, phage
Base pair
Chloramphenicol acetyltransferas
Colony forming units
Control of excision
c-terminal domain
Downstream sequence region
Electromobility shift assay
Helix-turn-helix
Integration host factor
Integrase
Kilo Dalton
Kilo base
Messenger ribonucleic acid
Mycobaterial integration host factor
nucleotides
Nuclotide tri phosphate
Open reading frame
Polyacryl amide gel electrophoresis
Plaque forming units
Isoelectric point
Recombinational direction factor
RNA-polymerase
Sodium dodecyl sulfate
Wild type
9
10
Introduction
During World War I, while ferocious battles were fought in central Europe,
two scientists, Frederick Twort and Felix d´Herelle discovered viruses that
can grow on bacteria. D´Herelle named the agents bacteriophages (“bacterium eaters”).
As a researcher in Institut Pasteur, d´Herelle was asked to investigate the
outbreak of dysentery which was afflicting soldiers engaged in fighting
World War I. He found the cause of the disease (Shigella), but did also notice that clear areas could be seen on plates of bacteria. He performed a direct test, where he took the material from a plaque and mixed it with a flask
containing growing bacteria.
“The next morning, on opening the incubator, I experienced one of those
moments of intense emotion which reward the research worker for all his
pains: at the first glance I saw that the culture which the night before had
been very turbid, was perfectly clear: all the bacteria had vanished, they had
dissolved away like sugar in water. As for the agar spread, it was devoid of
all growth and what caused my emotion was that in a flash I understood:
what caused my clear spots was in fact an invisible microbe, a filterable
virus, but a virus which is parasitic on bacteria” (From: The bacteriophage
by Dr. Felix d´Herelle, Science News 14: 44-59 (1949). Translation by J.L.
Crammer).
Science is beautiful!
It is also notable that the same year (1917), when d´Herelle was intensively working on finding vaccines to save lives, not far away (Flandern),
400 000 soldiers died while advancing 8 (!) km in 3 months.
However, since the discovery of bacteriophages, they have been at the
forefront of molecular biological research, both as model systems and as
biological tool boxes. They are also interesting when studying bacterial virulence and evolution and for their potential for treating bacterial infections.
The diversity of the genome sizes ranges from 4 kb to 600 kb (19). It is predicted that there are 100 million phage species, and in the order of
10 000 000 000 000 000 000 000 000 000 000 phages in the world (134).
One interesting bacteriophage derived biotechnology is the use of integrases of temperate bacteriophages for the engineering of mammalian cells.
The aim is to be able to insert DNA into specific sites in the genome of
mammalian cells, and thereby enable effective gene transfer and safe gene
11
therapy. There is a vast amount of research remaining to understand the
mechanisms for site-specific recombination and for how they could be designed to work in mammalian systems. The work presented in this thesis is a
contribution to the overall knowledge of bacteriophages and biological interactions, with a focus on site-specific recombination and transcriptional regulation.
12
Background
Bacteriophage P2
In 1951 G. Bertani isolated Bacteriophage P2 from the Lisbonne and Carrère strain of Escherichia coli (11). Over 55 years has past since then and a
large number of P2 like phages have been isolated. Some of the more studied
P2 like phages are 186, HP1, HK239, and WΦ, but P2 is still the most well
characterized member of this family. Some intensively studied areas of
phage P2 include site-specific recombination, gene regulation, DNA replication, phage exclusion and virion assembly.
The phages in the P2 family share a common virion structure and are
classed with T4 and P1 in Myoviridae. The members in the P2 family are
temperate phages that are unrelated to λ. Further shared characteristics
within the P2 family of coliphages, are that they are non-inducible by ultraviolet irradiation, the chromosomes have a unique class of cohesive DNA
ends and they are able to support growth of satellite phage P4.
The P2 phage can multiply in most strains of E. coli, as well as in strains
of Serratia marcescens, Salmonella typhimurium, Klebsiella pneumoniae,
and Yersinia sp. The P2 virion consists of an icosahedral head (60 nm in
diameter) and a complex tail (135 nm long) with a contractile sheath. The
entire genome has been sequenced (accession number AF063097) and consists of a 33 592 bp long, linear, double-stranded DNA genome with cohesive ends. The 42 genes can be divided in three, classes: (i) genes involved
in lytic growth, (ii) genes required to establish and maintain lysogeny (int,
C), and (iii) the nonessential genes (old, tin, and Z/fun). Furthermore P2 contains a number of open reading frames (ORFs) that may encode functional
proteins (see Table I and Figure 1 for a summary of the P2 genes and their
functions).
13
Table I. P2 genes and their functions.
Gene
Function of the gene product (comment)
Q
Capsid portal vertex
P
Large terminase subunit
O
Capsid scaffold
N
Major capsid protein
M
Small terminase subunit
L
Head completion
X
Tail
Y
Lysis-holin
K
Lysis-endolysin (Homologous to λ R)
lysA lysB
Lysis-timing
orf30
Unknown
R,S
Tail completion
V
Tail spike
W
Baseplate? (Homology to T4 baseplate wedge)
J
Baseplate/tail fiber
I
Tail
H
Tail fiber (Partial homology with many phages)
G
Tail fiber assembly (Partial homology with many phages)
Z/fun
Confers T5 resistance on lysogen
FI
Tail sheath
FII
Tail tube
E, T , U, D
Tail
ogr
Late promoter activator (Zinc finger DNA binding protein)
int
Integrase
C
Immunity repressor
cox
Excision and transcriptional control
orf78
Unknown
B
Replication (DnaC analogue?)
orf80-83
Unknown
A
Replicase (Rolling circle replication)
orf 91
Unknown
tin
Makes lysogen resistant to T-even phages
old
Makes lysogen resistant to λ
14
P2
Q P O N M L X Y K lysAB R S V W J I H G Z/fun FI FII E T U D ogr int C cox BA tin old
PP PO
PV
PF
Pgop
P4
PcII Pint
gop β cII
Pogr PC PE
Pold
PLE PLL Psid
int α cnr 151 ε kil cI vis sid δ psu
Figure 1. Schematic drawing of the genomes of bacteriophage P2 and P4, and the
interactions between the phages.
P2 propagation
During an infection, the free P2 phage particle adsorbs to the core region
of the lipopolysaccharide of E. coli and injects its DNA into the cytoplasm
(Figure 2).
As a temperate phage, it can propagate lytically, which means directing
the host cell to produce phage progeny, or establish lysogeny, i.e. insert its
DNA into the host chromosome.
During the lytic cycle, the P2 DNA is replicated by a modified rolling circle mechanism (26, 146). DNA replication is initiated by a single-stranded
endonucleolytic cut by the A gene product in the origin sequence (ori)
whereby the A protein gets covalently linked to the DNA (93, 116). The P2
B protein seems to function as a helicase loader and interacts with E. coli
DnaB (117). The late promoters, PP, PO, PV, and PF are activated by the Ogr
protein and direct the transcription of the genes encoding the building blocks
for the phage particles and lytic functions. During lysogeny, the P2 genome
is inserted into the host-chromosome by site-specific recombination and the
lytic functions are repressed by the C protein. The prophage is non-inducible
by ultraviolet irradiation, since the C repressor is not inactivated by the
SOS/Rec A system of E. coli. However, even if P2 C is inactivated, for example by heat inactivation of a temperature sensitive C mutation, the P2
prophage is unable to excise, due to lack of int expression (12). How the
15
phage solves this induction-excision paradox is not known (For review of
phage P2, see (13, 108)).
Adsorption
P2
production
Lytic cycle
DNA
replication
Injection
DNA
circularization
Lysogeny
Cell division
P2
prophage
Figure 2. The lifecycle of bacteriophage P2. The lifecycle starts with the adsorption
of the phage to the host. Thereafter the phage DNA is injected into the host and the
DNA is circularized. At this stage the phage can either integrate its DNA into the
host chromosome and establish itself as a prophage, or grow lytically by replicating
its DNA, producing new phage particles and lysing the host cell. The integrated
prophage has the capability to excise and enter the lytic cycle.
P2 lytic-lysogeny switch
The transcriptional switch controlling lysogenization versus lytic growth,
consists of the two promoters, Pc and Pe, which are located face-to-face. The
Pc promoter directs transcription of the C repressor that down regulates the
Pe, promoter which is active under lytic growth. The Pe promoter, on the
other hand, directs transcription of the Cox protein that acts as a repressor on
the Pc promoter and thereby prevents lysogenization (Figure 3) (139, 140).
In this way the promoters are mutually exclusive. The Pc transcript also encodes the integrase, and the Pe promoter also controls the expression of pro16
teins required for DNA replication, i.e. A and B. The C protein binds to the 10 region of the Pe promoter (140) and the C repressor has been shown to
form dimers (91). The -10 region contains a direct-repeated sequence of
eight basepairs, which is important in repressor binding (Ahlgren-Berg, Henriksson-Peltola, and Haggård-Ljungquist unpublished results). The Cox
binding site is overlapping the Pc promoter and it contains an imperfect 9 bp
long sequence repeated 7 times (Cox boxes) (138, 185).
The control of the transcriptional switch is fine-tuned by the ability of
both the C and the Cox repressor to down-regulate their own promoters at
high concentrations (139, 140). The decision between lytic and lysogenic
lifecycle is thought to be a consequence of the relative concentrations of the
Cox protein and the C repressor. The hypothesis is based on that 95 % of P2
infections undergo lytic development, and that the Pc promoter is 5 times
weaker than the Pe promoter (139).
C
Lytic
Pe
C
cox
Pc
Lysogenic
+/-
Cox
Figure 3. The transcriptional switch of bacteriophage P2. The block arrows represent transcripts directed from the promoters Pe and Pc, respectively. The Cox protein inhibits transcription from the Pc promoter, down regulating the expression of
the C protein and initiating the lytic life mode. The C repressor on the other hand
represses transcription from the Pe promoter, thereby establishing the lysogenic
lifemode.
P2 site-specific recombination
The integration-excision reaction of phage P2 is among the better characterized phage recombination systems (Figure 4), while the most studied system is that of bacteriophage λ. In P2, recombination occurs between a 27 bp
long sequence (core) which is identical in the phage and in the bacterial
chromosome. The core sequence is in the phage genome flanked by binding
17
sites for different proteins involved in the recombination reaction. The whole
region is called the attachment-site phage, attP. On the other hand, the attachment site in the bacterial chromosome, attB, only contains the core sequence. The core region consists of an imperfect inverted repeat, flanking a
7 base pair long sequence, which probably constitutes the overlap region.
Strand exchange occurs by conservative site-specific recombination, i. e.
precise breakage and joining in absence of DNA synthesis or loss of nucleotides. For a general review of site-specific recombination, see (33).
P2 genome
attP
Host genome
genome
attB
Int
IHF
Cox
Int
IHF
attL
attR
IHF binding site
Int arm binding site
Cox boxes
Int core binding site
Figure 4. The site-specific recombination system of bacteriophage P2. Int and IHF
are required for integration of the phage genome into the host genome. Recombination occurs between the core binding sites of the DNA substrates, and results in the
integrated prophage flanked by the hybrid attL and attR sites. For excision a third
additional phage protein, Cox, is required.
The integration process is mediated by the phage encoded integrase and
the host encoded IHF (Integration Host Factor) (184), which forms a nucleoprotein complex called an intasome. This structure is believed to make con18
tact with the recognition site on the host chromosome, attB. The integrase
has been shown to bind to both the inverted repeat in the core region and to
two arm binding sites in attP, the P and P´ arms, whereas IHF binds to one
region localized between the left arm, P-arm, and the core region (184). The
integrase catalyses the DNA cleavage and joining reaction (183), while IHF
has the ability to bend DNA (165), and thereby forming a recombinational
active intasome. Excision requires the P2 Cox protein in addition to integrase and IHF (185). The fact that both integrase and Cox are needed for
excision but are produced from two mutually exclusive promoters, may explain why P2 lysogenic cells produce phages spontaneously at a low frequency (approximately 1 out of 50 000 lysogenic bacteria/generation). Six
Cox recognition sequences, Cox boxes, are situated between the core and the
right arm site, P´-arm in attP, i.e. near attL in the P2 prophage. Integrase has
been shown to interact cooperatively with both IHF and Cox to attP (51).
At least 10 different attB sites have been defined in E. coli C. One site,
called locI, located at 48 minutes between the bacterial genes metG and his,
is preferred (183), which is encoding a small conserved RNA (174). P2 is the
only known example where the location of attB is something other than
tRNA or protein (176). DNA nicking and joining occurs within the 27 bp
core sequence in attB and attP. For review of the site-specific recombination
system of phage P2, see (59), and for a more detailed information about P2
Cox protein and the integrase see sections “P2 Cox protein and its DNA
substrates” and “P2 integrase and its DNA substrates” below.
P2-P4 interaction
Bacteriophage P4 was isolated 1963 from E. coli K-235 as a phage capable of forming plaques only on a P2 lysogenic strain (74). P4 is not related to
P2 and only the cos sites and the delta gene shows homology to P2 DNA. P4
is, like P2, a temperate phage, with the exception that it in the absence of a
helper phage it can either integrate into the host chromosome as a repressed
prophage, or it can establish itself as a derepressed multicopy plasmid. The
P4 genome does not encode any structural genes or genes required for cell
lysis, and P4 is therefore dependent on a helper phage, like P2, for lytic
growth. P4 can redirect the assembly process of the helper phage capsid
making the head too small to contain the P2 genome, thus favoring the production of phage particles containing the P4 genome. Since P4 is dependent
on the expression of the P2 structural gene products for its lytic growth, P4
has evolved several ways to manipulate the helper P2 (Figure 1 and Figure
5).
There are three different infection scenarios (i) P2-P4 mixed infection (ii)
P4 infection of a P2 lysogenic cell and (iii) P2 infection of a cell containing
P4 as a prophage or a derepressed plasmid. It is also possible to obtain a P2P4 double lysogen. Reciprocal regulatory interactions involve mutual derep19
ression of the prophages and mutual trans activation of the late promoters.
The P4 Delta protein can directly transactivate the P2 late promoters and P2
Ogr protein can activate the two late P4 promoters (35). During P4 superinfection of a P2 lysogenic cell, P4 has the ability to derepress the P2 lysogen.
This is mediated by the binding of the P4 Ε protein to the P2 C repressor
thereby lowering its affinity to the P2 Pe promoter (92). The early genes are
transcribed and due to inefficient prophage excision the DNA is replicated in
situ in the bacterial chromosome (62).
P2+P4 production
P4 production
Helper phage
superinfection
Derepressed
plasmid
P4 lysogen
No helper phage
present
E. coli
Mixed infection
P4
E. coli
E. coli (P2)
Helper phage
present
P4 production
P2+P4 production
P2-P4 lysogen
Figure 5. The different life modes of bacteriophage P4. Without helper, a P4 infection leads to P4 prophage or plasmid establishment. After superinfection of a helper
phage, lytic propagation of P4 can occur. During P4 superinfection of a helper lysogenic cell P4 can either lysogenize its host creating a double lysogen or the lytic
cycle may be initiated and P4 particles are produced. In a mixed infection, both P4
and helper phage particles are produced.
20
The repressed P4 prophage is derepressed upon infection by the action of
the P2 Cox protein, which like Ogr, is capable of activating the P4 PLL promoter, controlling the α gene, which is required for P4 replication (138).
For a review of phage P4, see (31) and (88).
P2 Cox protein and its DNA substrates
The P2 Cox protein is multifunctional and has at least three different
functions, (i) as a structural component in site specific recombination (185),
(ii) as a repressor of the P2 Pc promoter (139), and (iii) as a transcriptional
activator of the P4 PLL promoter (138). It is a basic peptide (theoretical isoelectric point=10.3) consisting of 91 amino acids (10.3 kDa), including a
N-terminal helix-turn-helix motif, believed to be the domain involved in
DNA recognition. P2 Cox belongs to the class of recombination directionality factors (RDFs) summarized in section “Recombination directionality
factors (RDFs)”.
Cox is binding to specific DNA regions, as shown by foot-print analysis,
containing repeats of a sequence, called Cox boxes, with a consensus sequence of 5´-TTAAAAGNCA-3´ (138, 185). An inspection of the different
DNA targets revealed that there are six or eight Cox boxes at the DNA substrates and their orientation and spacing differ (Figure 6).
a. P2 PePc region
Pe
cox
C
Pc
b. P2 attP region
int
ogr
c. P4 PLE and PLL region
α
cI
PLE
vis
PLL
Figure 6. Schematic drawing of the Cox boxes in the (a) P2 PePc region, (b) P2 attP
region, and P4 PLEPLL region. The direction of the arrows indicates the direction of
the Cox boxes. Solid bar represents the well-protected regions in DNaseI footprint
analysis, while ticked bars symbolize less well-protected regions.
21
P2 integrase and its DNA substrates
When the lysogenic pathway is chosen, the integrase is expressed from
the Pc promoter, resulting in a 337 amino acid (37.9 kDa) protein. The P2
integrase is responsible for nicking and joining DNA, thereby integrating or
excising the phage DNA into or out of the host chromosome. The attP region
contains several Int binding sites, the core site and the arm sites. The Int
recognition sequence in the arm sites (TGTGGACA) differs from the core
(AA(T/A)(T/A)(C/A)(T/G)CCC), which implies that the integrase has two
different DNA binding domains with different DNA recognition sequences
(184).
The P2 genome integrates preferentially into a site called locI, which
shows 100% identity to the core site in attP. If the preferred site is disrupted,
the P2 genome can be integrated into several alternative locations. These are
identical in 20 bp (locII) and 17 bp (locH), and 16 bp (locIII) to the attP core
sequence. A comparison of attP with the alternative attB sites shows only
nine conserved bases and the consensus sequence is 5´ ----A----GC----GAAG-G---T-3´, which means that P2 integrase can accept at least up to 37%
mismatches within the core sequence (7) (see Table II). The P2 integrase is
classified as a tyrosine recombinase (see section “Tyrosine Recombinases”).
Table II. Comparison of alternative integration sites in E. coli
Attachment site
Sequence (5´ to 3´)
nt identity to attP
attP, core
AAAAAATAAGCCCGTGTAAGGGAGATT
-
attB locI
AAAAAATAAGCCCGTGTAAGGGAGATT
27/27
attB locII
AAAtAAatcGCCCGTGgAAGtGAcATT
20/27
attB locIII
cAgtAcaggGCCaGcGTAAGGGAtATa
16/27
attB locH
ggAAAtaAAGCtgtTGTAAGGGcGtTc
17/27
P2 Int regulation
It has been shown that only about 1% of lysogenic cells are induced and
produce P2 phages upon inactivation of the C repressor (12). The P2 phage
production can be increased to 10% when providing P2 integrase in trans
from a plasmid (94). The low expression of Int from the P2 prophage may
have several explanations (182):
(i) The transcript from the Pc promoter ends in the bacterial chromosome,
which may affect RNA stability.
(ii) There is a partial transcription terminator between the C and the int
genes.
22
(iii) Integrase expression is autoregulated post-transcriptionally by binding integrase to its own RNA. The Int protein is believed to bind to a sequence capable of forming a stem-loop structure, situated in the untranslated
leader region overlapping the ribosome binding site and initiation codon of
the integrase gene (182).
WΦ - a P2 relative
Bacteriophage WΦ is closely related to P2 based on serological relatedness and morphology (79, 125). Further WΦ is qualified in the P2 family of
coliphages by its ability to function as a helper for bacteriophage P4, its noninducability by UV radiation and inability to recombine with phage λ. Despite their antigenic relationship WΦ and P2 are not co-immune, i.e. WΦ
grows on a P2 lysogen and vice versa (79). The genetic organization of the
sequenced parts of WΦ, i.e. from attP to the end of the cox gene, is identical
to P2 (90).
attP-int region
The 47 bp-core sequence of WΦ shows no homology to the P2 core, but
the arm-type sites are identical (90). The fact that there is a high similarity at
the N-terminal end (18 out of 20 amino acid residues are identical) between
WΦ and P2 integrase, strengthens the hypothesis that the N-terminal domain
of P2 Int is believed to bind to arm-sites (184). Further, the WΦ integrase
shows similarities at the amino acid level to members of the tyrosine family
of recombinases, and the motifs, including the catalytic site at the C-terminal
end, are present (see section “Tyrosine Recombinases”).
P2-like Cox boxes are not found in the attP of WΦ, and since WΦ is unable to complement a P2 cox defective P2 lysogen, it has been assumed that
WΦ and P2 Cox do not recognize the same DNA sequence (90).
Transcriptional switch of WΦ
Φ
The transcriptional switch of WΦ contains, like P2, two face-to-face promoters that are mutually exclusive, see section “P2 lytic-lysogeny switch”
above. The WΦ repressor has been shown to bind to two directly repeated
operators, which are different compared to the P2 operators (90). The C protein of WΦ shows 42% identity to the C repressor of P2, and secondary predictions result in similar secondary structures. The WΦ Cox protein can act
as a repressor of the WΦ Pc promoter, analogous to P2 Cox protein (90).
WΦ
Φ-P4 interaction
Bacteriophage P4 can utilize WΦ as a helper phage. The P4 Ε antirepressor can turn the WΦ transcriptional switch from the lysogenic to the lytic
state. WΦ Cox is however not able to activate the P4 PLL promoter, which
23
results in that a WΦ infection of a P4 lysogen will not lead to any P4 phage
production (90).
Conservative site-specific recombination
Introduction
Recombination is used to reorganize pieces of DNA, leading to genetic
exchange between or within DNA molecules. Three main mechanisms are
found in nature: homologous recombination, transpositional recombination
and conservative site-specific recombination.
Homologous recombination
Homologous recombination is essential to all organisms, where it is important for genetic diversity and DNA repair. In homologous recombination
both DNA molecules involved in the reaction have to share long stretches of
homologous DNA, and at least 24 different proteins are involved in the reaction in E. coli. The primary mechanism in E. coli involves DNA strand exchange where single stranded DNA is formed in the partners that are homologous aligned, followed by strand invasion and formation of a fourstranded branched structure (Holliday junction). Thereafter the junction migrates (branch migration) to extend the region of heteroduplex DNA and the
interlinked molecules are resolved leading to recombinant progeny. The
most important proteins in homologous recombination of E. coli (reviewed
in (46, 153)) are: (i) RecA, which induces the exchange of DNA strands; (ii)
RecBCD complex which is involved in the formation of single stranded
DNA which acts as substrate for the RecA protein; (iii) RuvAB complex,
which promotes branch migration; (iv) RuvC which catalyses the resolution
of the holliday structure. Specific sites in the DNA, called chi sites, have
been shown to enhance homologous recombination.
Transpositional recombination
Transpositional recombination involves specific DNA segments, called
transposones or transposable elements that can move from one genetic location to another. Transpositional recombination is independent of the components of homologous recombination. The nonreciprocal nature and the involvement of DNA replication are typical features of transpositional recombination. Transposition can occur by two different mechanisms generating
either a simple insertion, or a co-integrate. In the simple insertion pathway,
both ends of a single copy of the element are fused to the target, while in the
co-integrate pathway two copies of the transposones are formed, and each
copy has one end attached to the parental end and the other is attached to
24
new target sequences. The co-integrate pathway is a replicative process,
while the simple insertion pathway either can be a replicative process or a
conservative process. There are three distinct classes of transposons, the IS
elements, the Tn3 family and the transposing bacteriophage Mu. See (56)
and (34) for reviews about, and examples of, transpositional recombination
in prokaryotes.
Conservative site-specific recombination
Conservative site-specific recombination shows, compared to homologous recombination and transpositional recombination, high specificity for
both DNA partners and the exchange mechanism involves exact cleavage
and joining without DNA synthesis or loss. There are two major families of
recombinases in this class of reactions. In the serine recombinase (resolvases/invertase) family a conserved serine, located about 10 amino acids
from the N-terminal, is important in catalysis. The serine recombinases can
be divided into three structural/phylogenic groups, represented by the resolvase/invertases, large serine recombinases, and relatives of IS607 transposase (154). This family is rather homogenous and contains members like the
Gin invertase from bacteriophage Mu, the Hin invertase from Salmonella
sp., the resolvases from Tn3 and γδ transposons, and the integrases from
phage ΦD31 and TP901-1 (see (25) for a comparison of tyrosine and serine
recombinases). The members of tyrosine recombinases are less conserved by
sequence but share, in addition to the catalytic tyrosine, five amino acids
(Arg, Lys, His, Arg, His (Trp)) which have been shown to be involved in
catalysis (113). The tyrosine recombinases are further divided into simple
systems, which do not require additional proteins other than the integrase to
function both in integration and excision, like the Cre system of bacteriophage P1, the FLP system of Saccharomyces cerevisiae 2µ plasmid, and the
XerCD system of E. coli. In the complex systems, like bacteriophage λ, P2
and HP1, additional host- and/or phage-encoded proteins are required.
Several important biological processes are mediated by conservative sitespecific recombination, like transposon co-integrate resolution, bacteriophage integration and excision, bacteriophage host range variation, antigenic
variation, chromosome monomerisation, and spreading of antibiotic resistance genes through integrons. See (33) for a review on conservative sitespecific recombination.
Tyrosine Recombinases
Conserved residues and motifs
More than 300 members of the integrase family of tyrosine recombinases
are known (http://www.mywebpages.comcast.net/domespo/trhome.html),
including P2 integrase. For several of them, the three-dimensional structure
25
has partly and/or completely been solved; the N-terminal (177) and Cterminal part of λ integrase (83), the whole λ integrase complexed with
DNA (14), the C-terminal part of HP1 integrase (67), and the XerD of E. coli
(160). In addition, the Flp recombinase (28, 32), the C-terminal domain of λ
integrase (77, 159) and the C-terminal part of Cre recombinase of phage P1
have been structurally determined complexed with DNA (53, 57, 58). The
catalytic domains of the tyrosine recombinases spans 180 amino acids, and
contains a conserved, catalytically active tyrosine and an Arg, Lys, His, Arg,
His (Trp) pentad, which is the common motif for tyrosine recombinases.
- Arm binding
- Intermolecular
interaction
- Core binding
- Catalytic domain
- Intermolecular
interaction
C
N
Patch I
Box I
Arg-I
Patch II
Lys-I
Box II
Patch III
His-II
Tyr
Arg-II
His-III
Figure 7. Schematic organization of tyrosine recombinases. Three distinct domains,
arm binding, core binding and catalytic domain are outlined. The magnified catalytic
domain shows the different motifs and the conserved amino acids. See text for further explanation.
When the primary sequences of the recombinases are aligned, two conserved regions, box I and II becomes apparent (113) (see Figure 7). Box I,
which contains the first Arg (Arg-I) in the pentad, is well conserved among
prokaryotic recombinases and, with some variations, between prokaryotic
and eukaryotic recombinases. Box II, containing the first His (His-II), the
second Arg (Arg-II) and, the second His (His-III) in the pentad, is also relatively strongly conserved among prokaryotic recombinases, but less so between prokaryotic and eukaryotic recombinases (48). The Lys in the pentad
is situated in the loop between β strands 2 and 3. The three dimensional
models of tyrosine recombinases reveal that the Arg, Lys, His, Arg, His
(Trp) residues form a cluster on the surface of the protein (57, 67, 83, 160),
and are located at the center of the DNA interaction surface of the Cre-DNA
26
complex. Apart from the boxes, three patches of conserved sequences have
been identified (113).
Structure of the λ integrase
Apart from the catalytic C-terminal domain, an N-terminal and a corebinding domain have been identified (Figure 7). The N-terminal domain of
λ integrase is involved in arm-type binding (177), and protein-protein interactions (see section “Intasome formation in bacteriophage λ site-specific
recombination system” below). It has also been shown to be a contextsensitive modulator of integrase functions. The N-terminal domain inhibits
core-DNA binding and cleavage. This inhibition is overcome when arm-type
sequences are present. Further, when the N-terminal domain is present in
trans, it has been shown to stimulate core-DNA binding and cleavage (144).
A third domain, the core binding domain, has been identified in bacteriophage λ integrase, which show structural similarities to XerD and Cre recombinases (162).
The C-terminal domain has further been implied to be involved in intermolecular contact with another Int-molecule (164). Another interesting finding is the involvement in the C-terminal tail in the resolution of the Holliday
junction (65).
Structure of the HP1 integrase
The three-dimensional structure of the integrase of P2 related Haemophilus phage HP1 has been determined. The structure revealed, apart from the
catalytic domain, a C-terminal tail which nestled into a cleft of an adjacent
integrase subunit leading to a yin-yang shaped dimer (67). The results confirmed the structural resemblance to the λ integrase, and the XerD and Cre
recombinases (113).
Recombination directionality factors (RDFs)
The control of the directionality in site-specific recombination reactions is
achieved through a class of small accessory factors that favor one reaction
while inhibiting the other. This strict control prevents undesirable rearrangements and, in the case of bacteriophages, permits efficient switching
between lifestyles, such as lysogenic versus the lytic pathways. The RDFs
are small, often basic proteins, which have an architectural role in the formation of the nucleoprotein complexes involved in site-specific recombination.
RDFs have been identified in conjunction with both tyrosine and serine recombinases. The RDFs can be grouped in different subgroups depending on
their sequence similarities. A subset of RDFs, the Cox proteins, also functions as transcriptional regulators. Most RDFs have pIs in the range 8-11,
and contain a helix-turn-helix motif (87).
27
The λ Xis
The best characterized member of the RDFs is the λ Xis protein. Xis is a
small (72 residues) and basic (pI=11.16) protein which is required for the
excisive recombination and inhibits integrative recombination (23, 24). It
binds to two directly oriented imperfect 13 bp repeats (X1 and X2) in attP
(and attR) and introduces a significant bend in the DNA upon binding (165).
It also facilitates the binding of integrase to the P2 arm-type sites through
direct protein-protein interactions (24, 109, 181). Xis stimulates excision by
enabling formation of a specific protein-DNA structure that is required for
the synapsis of attL and attR DNA. It inhibits integrative recombination by
preventing formation of a complex needed for synapsis of attP and attB (3).
An additional feature of λ excision is the involvement of the host encoded
protein FIS, that can also stimulate excisive and integrative recombination
and does so by binding to a site, F, that partially overlaps X2 (5, 47, 111,
166).
From the structure-determination it was concluded the Xis DNA binding
motif does not comprise a helix-turn-helix motif. Instead, the Xis protein
adopts a winged-helix structure (141, 142). There are two Xis binding sites
between the core sequence and the P-arm sites in the attP of phage λ. Upon
binding to its DNA substrate, Xis bends the DNA sharply. It has also been
shown that the Xis interacts cooperatively with λ integrase (see section
“Intasome formation in bacteriophage λ site-specific recombination system”
below) (29, 161, 173).
HP1 Cox
The Cox protein of bacteriophage HP1 belongs to the same group of
RDFs as P2 Cox. In phage HP1 the RDF, Cox, also influences the binding of
integrase. In this system it inhibits the binding of HP1-Int to the adjacent Int
binding site, resulting in the inhibition of integration (see Figure 10) (49,
50).
The Xis-L5
The RDF of mycobacteriophage L5 (Xis-L5) is a 56 residue long basic
protein that contains a putative helix-turn-helix DNA binding motif. It does
not show any sequence similarities with λ Xis. L5 excision requires the XisL5 as well as mIHF, but DNA supercoiling is not essential for the reaction.
Xis-L5 potently inhibits integrative recombination by preventing the formation of a recombinaogenic synaptic complex. Unlike the case in the λ and
HP1 systems (49, 100), there are no direct interactions between Xis-L5 and
Int-L5, but Xis-L5 determines the directionality of recombination through its
ability to bind and bend DNA.
28
The mechanism of conservative site-specific recombination
Site-specific recombination can be divided in synapsis and strand exchange. During synapsis, a synaptic complex is formed where the two recombination sites are juxtaposed. Thereafter strand exchange occurs, i.e. the
cleavage of the two sites and their rejoining in a new, recombinant configuration. One or both steps may require that the DNA substrate is (-) supercoiled (10), that the recombination sites have the same or homologous DNA
sequences (20, 114, 131), and that the sites have a particular orientation
along the DNA substrate (64). At the protein level, different domains of the
recombinase may be required for specific binding to the recombination site,
for the protein-protein interactions required to bring sites together, and for
the catalytic steps of DNA cleavage and rejoining (69, 70, 101, 168).
The two families of site-specific recombinases, the serine and the tyrosine
recombinase superfamilies (61, 76, 84, 106, 137, 155) are, apart from the
conserved amino acid residues at the active sites, also distinguished by their
mechanisms of synapsis and strand exchange. The strand exchange mechanism for the serine recombinases begins with concerted double-strand breaks
at both recombination sites. During DNA breakage, an intermediate is
formed in which the 5´-phosphoryl ends of the cleaved DNA are esterified to
serine hydroxyl groups of the protein. Following breakage, the subunits
which are linked to the recombinase subunits translocate and the DNA ends
are rotated 180° and rejoined to form a recombinant product (38, 154).
Strand-swapping isomerisation model for the tyrosine recombinases
The mechanism of strand exchange is different for the tyrosine recombinases than for the serine recombinases. In 1995 a model for integrasemediated recombination mechanism was proposed (112) which explained
how strand exchange could proceed without branch migration across the
entire overlap region (see Figure 8). In this strand-swapping isomerisation
model the two DNA partners are aligned at nearly right angles to minimize
the repulsive forces of the negatively charged phosphates. Thereafter the topstrands are cleaved and the recombinase remains covalently joined to the
DNA through a phosphodiester bond. The cleavage is followed by melting
of two to three nucleotides of the released overlap strands and interchanging
them between the active site pockets of the two partner Int protomers (the
swap). Joining of the incoming strands restores the phosphate backbone of
the DNA and a Holliday junction is formed. Thereafter, a transition from an
isomer with top-strand crossover to one with a bottom-strand crossover occurs, which includes a shift of the branch point by one to three basepairs in
the center of the overlap region (the isomerization). This isomerization induces the correct position of the cleavage points for the second strand swap,
which resolves the Holliday junction after Int cleavage at the bottom strand
sites. (53, 112, 156). This step of the recombination is stimulated by inte29
grase binding to the arm sites (14). DNA breakage involves reversible formation of an esther between a 3´-phosphoryl end of the transiently broken
DNA and a tyrosine of the enzyme (118).
I
Cleavage
II
5´
I
II
5´
5´
I
5´
Cleavage
+
Exchange
+
Joining
I
5´
5´
II
5´
I
Exchange
+
Joining
II
Y
Isomerization
I
5´
5´
I
I
II
II
Y
II
Y
Y
5´
5´
5´
5´
5´
II
Y
Y
5´
II
I
5´
5´
5´
I
II
5´
5´
Figure 8. Strand-swapping isomerization model for tyrosine recombinases. The
light gray Int subunits are active for top strand cleavage and the dark gray subunits
are active for bottom strand cleavage. The first step is the top strand cleavage, followed by strand exchange and joining leading to the formation of a Holliday structure. Thereafter the Holliday junction is isomerized, and the bottom strand exchange
is executed, resulting in recombination products. Roman numbers indicate the type
of intermolecular interaction between Int molecules, see section “Regulation of
active sites”.
Catalytic mechanism of tyrosine recombinases
At the molecular level, a complete cleavage-rejoining reaction proceeds in
four steps (151). The initial protein-DNA complex is converted to a stable
covalent enzyme-DNA adduct involving a 3´phosphotyrosine linkage at the
active site, before completion of the reaction by rejoining of the DNA. In the
active site, the conserved triad, Arg-I, His-II, and Arg-II, together with HisIII, functions as proton donors in the stabilization of the pentacoordinate
transition state of the phosphate.
The reaction involves two similar transition states involving a pentavalent
phosphate. Two arginine (Arg-I and Arg II) residues contact the oxygen
atoms of the scissile phosphate moiety and probably contribute to catalysis
in two ways. The first is to promote a nucleophilic attack on the phosphorous
atom due to an inductive effect upon the electrons around it, while the sec30
ond is to stabilize the charge that develops on these oxygens in the transition
states. In this mechanism two additional residues work reciprocally as acids/bases during catalysis. One residue (base) serves alternately to increase
the nucleophilicity of the attacking tyrosine residue and then to reprotonate
it, while the other (acid) acts in a similar fashion upon the attacking
5´hydroxyl and phosphodiester oxygen, respectively. The same general
scheme can be applied to catalysis on ribonucleoside-containing substrates.
It has been proposed that during catalysis the proton of the tyrosine nucleophile could be transferred to a water molecule, which could be acting as a
base (157). Alternatively, this base could be an appropriately positioned
histidine in Cre (57) and other tyrosine recombinases. The role of a conserved lysine in a β hairpin present in all of the determined recombinase and
topoisomerase structures remains unclear, although its mutation leads to
dramatic loss of catalytic activity. The lysine is believed to play a structural
role in organizing the active site, where it could act as an acid, protonating
the 5´leaving group (172).
Regulation of active sites
An interesting mechanistically aspect is the regulation of the active sites
of the tyrosine recombinases.
For λ integrase it has been shown that DNA binding stabilizes the global
fold of the protein, which proposes that the integrase is inactive when unbound to DNA (77). Once bound to DNA further control is achieved by turning on one pair of the recombinase subunits and turning off the other pair.
The activation of recombinases involves a conformational change at the Cterminus of the protein that moves the active site tyrosine into position ready
to attack the scissile phosphate (160). This conformational change could
either be triggered by binding to DNA or more likely, in the case of the recombinases, by interactions between protein monomers during synapsis. The
current model favors the latter, since changes in the intersubunit interactions
during the recombination reaction have been detected (54, 172, 178). In fact
it has been shown that when the integrase is unbound, the active tyrosine is
located about 20 Å from the catalytic site. Upon DNA binding, the tyrosine
residue moves to the catalytic site. This switch also includes the release of
strand β 7, which is interacting in trans with a neighboring Int molecule (1),
(159). This switch has also been shown to be important for the coordination
of strand exchange (164).
In the Cre system, during synapsis, the recombinases bound to the same
substrate interacts with a type I interaction, while the interfaces between
subunits bound at different recombination sites are called type II. Upon
isomerization of the Holliday intermediate, the type II interfaces become
type I and vice versa. The different interfaces results in an activation/inactivation switch. An active site involved in a type I interaction is not
31
active, while an active site involved in a type II interaction is active (Figure
8). This switch depends on conformational changes, i.e. structural changes of
the interface are affecting the active site. Differences between the interfaces
include the positioning of the Tyr-nucleophile and the Lysine in the β2-β3
loop (172).
Cis versus trans cleavage
In the tyrosine recombinase family, two different cleavage modes are evident. In trans cleavage, the active site from one recombinase subunit positions the DNA for the tyrosine attack, which is performed by the other subunit. This results in that two subunits are required for a cleavage active complex. In cis cleavage, the active site and the attacking tyrosine come from the
same subunit. Flp and Cre recombinases have been shown to cleave in trans
(27, 39, 85, 149), while λ integrase and the Xer system cleave in cis (2, 115).
Intasome formation-putting the pieces together
In the complex systems of conservative site-specific recombination, the
formation of a recombinagenic active nucleoprotein complex, the intasome,
is the prerequisite for efficient recombination. The intasome is a large nucleoprotein complex which mediates the integration of phage DNA into the
host chromosome. In recent years several mechanisms for intasome formation have been proposed (see examples below).
Intasome formation and DNA-bending
In some cases, for example λ, the phage encoded integrase and the host
encoded IHF (integration host factor) are binding to several sites in attP. The
bivalent integrase can bind simultaneously to two different segments of attP.
For the formation of a correct intasome these binding sites have to be close
to each other. This is accomplished by the formation of a loop which contains a binding site for IHF. IHF bends the DNA and thus defines the trajectory of the loop (99). For this trajectory to be correctly defined in the intasome, the bends introduced by the three IHF molecules need to be correctly phased relative to each other. Replacing one IHF site by a site with
high affinity for CAP, a protein which can bend DNA to an extent comparable to that of IHF, significant recombination function was only observed in
the presence of CAP and its activator cAMP (52). This suggests that bending, not protein-protein contacts, is necessary for the assembly of a functional intasome. This conclusion was confirmed by finding that an intrinsically bent DNA sequence, with an estimated bend of approximately 120°,
can also substitute for this same IHF binding site, provided that the bend is
correctly phased and is sufficiently curved (52).
32
It has also been shown that some recombinases can bend DNA, for example the yeast FLP recombinase (147).
Intasome formation in the site-specific recombination system of
mycobacteriophage L5
Mycobacteriophage L5 is a temperate phage that forms stable lysogen in
Mycobacterium smegmatis. Integration and excision of the phage DNA is
mediated by the phage encoded integrase (Int-L5), a member of the large
family of tyrosine recombinases (48, 113). Integration requires the mycobacterial integration host factor, (mIHF), integrase, attP DNA, and attB DNA.
There are a total of seven arm-type sites, six of which are arranged as adjacent pairs in direct orientation. Only four of these sites are required for integrative recombination, P6, P7, and P3 are fully dispensable for integration
(see Figure 9) (123).
INTEGRATION
attP
attB
P1/P2
core
EXCISION
P4/P5
attR
X1-X4
Synaptic
complex 2
Intasome-P
Synaptic
complex 1
Recombinagenic
synaptic
intermediate
core
P1/P2
core
P4/P5
X1-X4
Intasome-R
Intasome-L
Synaptic
complex
Components
Int Xis
Figure 9. Proposed intasome formation in mycobacteriophage L5. See text for details.
33
attL
mIHF does not bind to attP in the absence of Int-L5, although it promotes
the formation of an intasome complex (intasome-P), by presumably stabilizing a DNA bend between the core and arm sites, facilitating Int mediated
protein bridges between the core and the P4/P5 sites (119). The P1/P2 arm
type sites are not required for intasome-P formation, but they are important
in the capture of attB DNA (121). Two different synaptic complexes have
been identified, where in the synaptic complex 1 (SC1), P1/P2, and P4/P5
arm type sites are occupied (121). This complex is not fully competent for
recombination, still it is presumably a direct precursor of the recombinagenic
synaptic complex (120). The other, synaptic complex 2 (SC2), forms independently of mIHF, and involves intermolecular Int-mediated bridges between the attB core and the P1/P2 arm-type sites. The formation of the L5
intasome does not require supercoiling of the attP substrate and only the
arm-type sites in the right arm (P4/P5) are involved (120, 121). Supercoiling
of the substrate however stimulates the post-synaptic step in the reaction
(122). The L5 integrase has, like λ Int, dual DNA binding activities, with a
small N-terminal domain that binds to arm-type sites and a large C-terminal
domain that binds to the core sites and contains the catalytic residues (101,
123). The intasome formation model for L5 (86) is summarized in Figure 9.
Intasome formation in the bacteriophage HP1 site-specific
recombination
The integration substrates of the P2 related phage HP1 are a 500 bp phage
attachment site (attP), containing binding sites for integrase and IHF, and
Cox, and a 18 bp host site (attB), see Figure 10. The attP substrate contains
six sets of integrase binding sites (IBS) arranged in pairs of direct or inverted
repeats. HP1 integrase has two DNA binding specificities: it binds tightly to
type II sites (IBS1, IBS2, and IBS5) and more weakly to type I sites (IBS3,
IBS4, IBS6) (60). Recombination occurs between the IBS4 and the single
type I site in the chromosomal attB site, IBSB. Two adjacent cox sites are
present in attP, positioned between the IBS4 and IBS5 sites on the attL arm
of the substrate (49), and two IHF binding sites are situated on either side of
the core (71).
A model for intasome formation has been proposed (50) (see Figure 10).
In the synapsis of a complex protein-bound attP with an unbound attB site,
the attP DNA contains an IHF-mediated loop on the left (attR) arm. This
loop brings the IBS2 and the IBS4 into proximity to each other. Since IBS2
is a direct repeat and IBS4 is an inverted repeat, only half site of each can be
bridged by integrase. IBS5 can thereafter be aligned with IBS4 in a reverse
direction compared to IBS2, and in the same manner as for the IBS2-IBS4
bridging, the half-site is occupied by an integrase molecule. The two “free”
Integrases are thereafter able to bind to the attB, and a recombinational ac-
34
tive intasome is accomplished. The intasome is held together by bridging
between IBS1 and IBS6.
A similar model has been proposed for the excisive recombination, where
the complex formed at attR is identical to that arm of attP in integration,
while the attL structure looks different. During the formation of the attL
structure, Cox protein inhibits the binding of integrase to the IBS5. Therefore no type II binding site is available and consequently no bridging structure can be formed within the substrate. Instead the necessary structure of the
complex is formed by IHF and Cox. When the two excision substrates come
together the integrase bound at IBSL can bridge the free half-site on IBS2,
and the IBSL and IBSR are aligned for strand exchange.
INTEGRATION
IBS1 IBS2
IBS3 IBS4 IBS5 IBS6
EXCISION
IBS1 IBS2
IBS3 IBSR
IBSL
IBS6
IBSB
Components
Int
IHF
Cox
Figure 10. Proposed intasome formation in bacteriophage HP1. See text for details
Intasome formation in bacteriophage λ site-specific recombination
system
The λ integration reaction requires the phage-encoded Int-protein, the
host-encoded protein IHF, and two recombination sites attP and attB. The
direction of the recombination is controlled by two accessory proteins, the
phage encoded, excision-stimulating Xis and the host encoded Fis, which
stimulates excision and integration (47). In the approximately 200 bp λ attachment site, attP, the integrase binds to the core and to the P and P´ arms.
The core site (COC’) is an inverted repeat interspersed by a short sequence
35
of seven bp, the overlap region. The P arm consists of an inverted repeat and
the P´arm of three direct repeats. The bacterial attachment site attB (BOB’)
is identical to the core (Figure 11). The formation of the intasome in the λ
system has been shown to be a complex network of protein-protein, and
protein-DNA interactions (for a review of the λ system, see (3)).
There is a different occupancy pattern of the protein binding sites in attP
during integration as compared to excision (110, 167). A three tiered hierarchy in binding affinities of Int to the arm-type sites have been reported. The
highest affinity is for the P1 and P’1 arm sites, both of which play important
anchoring roles in integrative and excisive recombination respectively (81,
110, 132, 167). The middle tier is occupied by P´2 arm, which is the only
arm that is important for both the integration and excision. The lowest affinity tier is composed of P2 and P´3, where P2 is only required for excisive
recombination, and P´3 is required only for integrative recombination. Efficient binding of Int to P´3 depends on cooperative interactions with another
Int bound at P´2, whereas Int binding at P2 depends on the occupancy of X1
by Xis (143). Recently it has been shown that arm binding interactions
stimulate isomerization in favor for the resolution of the Holliday junction
(14). The amino-terminus of the integrase is involved in the formation of
dimers, trimers, and tetramers (75), as well as in the interaction with Xis (29,
143, 161, 173). It has also been shown that the arm sequences contribute to
the formation and resolution of a specific Int/Holliday junction complex and
the catalytic function of the integrase (14). A model of the Int/Holliday junction complex has been proposed, which visualizes how Int molecules bound
at the core (inverted repeat) also can bind to an arm (direct repeat) (see
Figure 11) (129).
(a) lambda attP
P1 H P2 X X
H
C C´
H
P´1 P´2 P´3
IHF binding site
Int arm binding site
Xis binding site
Int core binding site
(b) Ternary complex
Core-binding domain
Arm-binding domain
Figure 11. Site-specific recombination system of bacteriophage λ. (a) Schematic
drawing of the attP region. (b) Ternary complex of the λ intasome.
36
Regulation of transcriptional initiation
Introduction
Transcriptional regulation is a key component in bacterial gene regulation. Transcription is often controlled at the stage of initiation, with the advantage that energy is not wasted when producing unnecessary transcripts.
The RNA polymerase
The multisubunit bacterial DNA-dependent RNA polymerase (RNAP), is
responsible for all transcription in bacteria (44). The core enzyme which is
not able to initiate promoter-directed transcriptional initiation is composed of
four different subunits, β, β´, α2 and ω. The active site is formed from the
large β, β´ subunits (82). The α subunits consist of one N-terminal domain
which is responsible for assembly of the β, β´ subunits, and one C-terminal
domain which is involved in DNA binding at some promoters (see Figure
12) (15, 55). The ω seems to have a chaperone-role in the folding of the β
subunits (63). For the RNAP to start transcription at a promoter, a holoenzyme has to be formed containing the core enzyme together with a σ subunit.
The σ subunit has three major functions: to recognize specific promoter sequences, to position the RNAP at a target promoter, and to assist in the unwinding of the DNA near the transcriptional start site (180). The σ factors
are multidomain proteins that have up to 4 different domains, where domain
2, 3, and 4 are involved in promoter recognition (104, 105, 175). There are
several different σ factors that recognize different binding sites, which allow
the differential expression of a particular subset of genes.
The promoter element
Promoter recognition by RNAP is a crucial step in gene expression and its
regulation.
Four different sequence elements have been identified that are involved in
promoter recognition (22). The two most important elements are the -10 and
the -35 hexamer which centre 35 and 10 bp upstream of the transcriptional
start site respectively (see Figure 12) (55).
The σ factor of RNAP interacts with these elements that define the core
promoter. The degree of correspondence of the -10 and -35 regions with the
consensus sequence largely correlates with promoter efficiency. Two other
important promoter elements are the extended -10 element and the upstream
(UP) element. The extended -10 element is located in the spacer region upstream of the -10 element (6), which consists of a non-conserved stretch of
17+/-1 bp. The linker region is important for keeping the correct distance
37
and angular position between the -35 and -10 elements. Some promoters,
show weak or no homology to the -35 region and are characterized by the
TG motif, one bp upstream of the -10 region. A second TG motif, located at
position -16 and -17, may also stimulate transcription through enhancing the
formation of open complex (21). The first TG motif is present in one out of
five E. coli promoters and the second TG motif is found in one out of nine
promoters.
The UP element consists of an AT-rich region located between the -35
element and about -60 bp upstream of the start site and it is directly interacting with the C-terminal domain of the α subunit of RNAP (55). A consensus
UP element, consisting of two sub sites, can activate transcription as much
as 340-fold (55). UPS (upstream activating sequences) are curved sequence
elements that contain AT-clusters or GGCC sequences repeated in a helical
phase, and are located between -150 and -50. These sequences may extend
the RNAP-DNA interactions or facilitate DNA unwinding during initiation
of transcription. In addition, for many strong promoters, like the early promoters of phage T5, downstream sequence regions (DSR), ranging from +1
to +20 have been identified, which also contribute strongly to promoter activity. The DSR region is made up of long purine clusters (170).
Binding
Isomerization
αNTD
αCTD
UP element
σ4
β + β´
σ3 σ2
-35
TGn -10
σ1
+1
Elongation
Initiation
Figure 12. RNA polymerase, promoter elements and the pathway of the transcriptional initiation at bacterial promoters. The transcriptional start site is denoted +1.
See text for details. Modified from (18).
Initiation of transcription
Transcription is initiated when the holoenzyme interacts with sequence
recognition elements in the promoter and anchors the RNAP to the transcriptional start site. After release of the σ factor, the core enzyme catalyses the
38
stepwise addition of ribonucleoside triphosphates into a growing RNA chain.
It is complementary in sequence to the non-coding strand and it is synthesized in a 5´ to 3´ direction.
Initiation of transcription can be divided into four main substeps, each of
which can be rate limiting (i) RNAP binding of DNA in a closed complex,
(ii) isomerization that forms the open complex, (iii) initiation, and (iv) elongation (148) (see Figure 12). For a review on promoter initiation, see (66)
and (18).
Formation of the closed complex involves recognition and binding of the
promoter sequence by RNAP. The non-specific DNA binding of RNAP
holoenzyme allows it to diffuse along the DNA molecule which facilitates
promoter localization. In the closed complex, the DNA is double-stranded,
and the overall stability of the closed complex is generally very low.
Conversion of the closed to open complex follows a sequence of conformational changes in both the DNA and the protein, which results in sitespecific strand separation about one helical turn of the promoter DNA, -10 to
+2 (169). Strand opening is catalyzed by the action of the σ subunit and is
strongly influenced by the DNA twist, the spacer length, and the template
topology. Several different open complexes can form. That opening of the
DNA helix occurs at temperatures below the melting point may be explained
by studies that indicate that the DNA is wrapped around the RNAP (133).
When substrates NTPs are bound to the binary complex, it is converted
into a ternary complex. The correct NTPs are discriminated by base pair
formation with free bases of the template strand exposed in the catalytic site.
Correctly bound nucleotides are linked to the proceeding nucleotide. The
initiating ternary complex starts to synthesize short RNA chains up to a
length of about 10 nucleotides. The short RNA chains are released as abortive products. This process is normally repeated many times, but at some
point the initiating complex is converted from the abortive to a processive
complex. This step is termed promoter escape or promoter clearance and is
characterized by the release of the σ factor.
Regulation of transcriptional initiation
There are five distinct mechanisms that regulate transcriptional initiation.
These involve transcription factors, promoter DNA sequences, σ factors,
small ligands and DNA structure (18). Activation and repression of transcription is primarily caused by regulatory proteins (activators or repressors),
which act by binding to specific sites on DNA. The regulatory proteins can
affect many steps in transcription, from initial binding to many of the intermediate structures the polymerase undergoes to its way to promoter clearance (43, 89, 95, 98, 102, 128, 145).
Transcription factors can be regulated in several ways: (i) they can be
modulated by small ligands (103), (ii) they can be modulated by covalent
39
modifications (36), (iii) by cellular concentration of the transcription factor
(37).
Mechanisms for transcriptional repression
Three general mechanisms are used for reducing transcriptional initiation
by transcription factors: (i) steric hindrance of RNA polymerase binding to
promoter DNA (103), (ii) DNA-looping, which shuts of transcription initiation in the looped part of the DNA (30), (iii) anti-activator, preventing the
initiation by binding to a transcriptional activator (152).
Mechanisms of repression
(a) Repression by steric hindrance
Mechanisms of activation
(d) Class I activation
αNTD
αCTD
σ4
αCTD
β + β´
σ3 σ2
αNTD
σ1
UP element
UP element
+1
-10
-35
σ4
β + β´
σ3 σ2
-35
TGn -10
+1
TGn -10
+1
σ1
(e) Class II activation
(b) Repression looping
-35
(f) Activation by modification of DNA
topology
-35
-10
+1
(c) Repression by modulation of an activator
UP element
-35
-10
+1
Reorientation of binding sites
-35
-10
+1
Repressor
Activator
Figure 13. Mechanisms for repression (a-c) and for activation (d-f) of transcriptional initiation. See text for details. Modified from (18).
Mechanisms for transcriptional activation
Transcription factors can utilize three general mechanisms for the activation of transcriptional initiation (18). In Class I activation, the activator binds
to the target situated upstream of the -35 element. Thereafter the RNA poly40
merase is recruited by an interaction with the αCTD of the RNA polymerase
(45). The Class II mechanism involves the binding of the activator to a target
that overlaps the -35 element and contacts the σ subunit (107). In the third
class of activation, the activator alters the topology of the target promoter to
facilitate the interaction between the RNA polymerase and the promoter
(17).
DNA-Bending and transcriptional regulation
Bending is a common property of transcription factors, both repressors
and activators (171). The bending angles may be important parameters in
regulation of gene expression, but rules deciding the relation between the
bending and transcription rates are not known (171).
Transcriptional repressors
For long it has been assumed that transcriptional repressors inhibit transcription by steric hindrance, i.e. by preventing the access of the RNA polymerase to promoter sequences. Lately it has been shown that DNA itself
could influence repression by playing a more dynamic role, leading to enhanced repression. RNA-polymerase binding is for example not mutually
exclusive to some repressors, such as KorB and LacI (158). Other repressors
have their binding sites located at a certain distance from the RNApolymerase binding site. In this case repressor binding may cause DNAlooping.
Many repressors bend the DNA at their target sites, which could contribute to repression efficiency. There are different ways repressor-induced
bending could repress transcription (124);
(i) assembly of complex repression structures, where a repressor-induced
bending could compensate for poor protein-protein interactions or proteinDNA recognition, or a nucleoprotein-complex with DNA wrapped around
the repressor, which could mask the promoter core and hinder the access of
RNA-polymerase.
(ii) inhibition of RNA-polymerase-promoter contacts by misoriented
DNA bending, i.e. repressors bending DNA in the opposite direction compared to RNA-polymerase-induced bending and thereby inhibiting the action
of RNA-polymerase.
(iii) repression by distant DNA curvatures, where bending, depending on
phase either can favor or inhibit upstream DNA-RNA polymerase interactions.
Transcriptional activators
Activator-dependent initiation of transcription frequently involves formation of protein-directed DNA bends and/or protein-protein contacts. Apart
from being the energetically most favorable conformational state of the
41
DNA-protein complex, bent DNA could function in several ways to enhance
transcription. (i) Bending might mediate the interaction of proteins bound to
dispersed sites or at unfavorable phasing. (ii) Alternatively, energy stored in
protein-DNA bends could cause local structural changes in the promoter that
in turn enhance or stabilize binding of other proteins or facilitate opening of
the DNA helix. (iii) Finally, this stored energy could also be used after initiation to promote the transition from initiation to elongation by increasing the
dissociation of RNA-polymerase from an initiation complex. These possibilities are not mutually exclusive (171).
In most promoters, activation elements are located at one of two positions
relative to the start of transcription. The proximal site (-40 to -80) is typically the target for activator proteins which contact RNA-polymerase directly, although in some cases curved DNA also appears. Distal sites might
be located within 200 bp upstream, and they frequently include intrinsically
curved DNA or target sites for proteins which bend DNA (typically IHF or
FIS).
Activators which bend DNA near RNA-polymerase binding sites always
favor formation of the closed complex and, in some cases, formation of open
complex. Within proximal sites, the independent contributions to transcription initiation of DNA curvature alone and of protein-protein contacts alone
are difficult to separate. Since RNA-polymerase-activator contacts are extremely weak in absence of DNA, activator binding and DNA bending could
be a prerequisite for closed complex formation.
The lysis-lysogeny switch of bacteriophage λ
One of the most thoroughly investigated transcriptional switches is the lysis-lysogeny switch from the temperate bacteriophage λ. After infection of
the host cell, the bacteriophage can either enter the lytic pathway, in which
case the host cell ultimately lyses to release progeny phages, or the bacteriophage enters the lysogenic pathway, in which case the phage genome is
stably integrated into the host genome. This choice of lifestyle is mediated
by a transcriptional switch, which consists of four promoters, and three proteins. For a short, recent review, see (41), and for a more extensive explanation see (127).
DNA sites
The two early promoters, PR and PL are essential for the lytic pathway.
Each promoter partially overlaps an operator region, called OR and OL respectively. The operator regions are separated by 2.4 kb and each consist of
three 17 bp operator sites, OR1, OR2, OR3, for OR, and OL1, OL2, OL3 for OL
(Figure 14). The CI repressor has the highest affinity for OR1 and OL1 sites,
and the lowest affinity for the OR3, and OL3 sites, while the affinity is reversed for the Cro protein
42
The PRM promoter is also controlled by the OR operator, and both negatively and positively regulates the production of the CI repressor.
The PRE promoter is activated by CII and therefore important for the initial establishment of the lysogenic state (126). It consists of a pair of direct
repeats bracketing the -35 element.
The Proteins
The CI repressor is the key component in the lytic-lysogeny switch. The
DNA binding N-terminal domain contains a helix-turn-helix motif. The Cterminal domain has been shown to be involved in intermolecular interactions between CI repressors and cooperative binding (8). The crystal structures of the tetrameric and octameric C-terminal domain revealed that the CI
dimers present two interfaces for interaction situated at approximately 90°
from each other, and contacts two other dimers simultaneously (8, 9).
The Cro protein is a helix-turn-helix motif containing repressor. It has
been shown to be dimeric in solution (97), and to bind DNA as a dimer (73).
Further the protein has been shown to bend the DNA target by about 40°
(16).
The stability of the CII protein determines whether the switch is turned to
the lysogenic or lytic state. The CII activator is tetrameric in solution. It
binds to PRE in the switch, and stimulates both the formation of the open and
closed complex. CII, σ and the α subunit of RNA polymerase form an interconnected complex (78, 96). The contacts are to be defined, and it is unknown if CII binds as a tetramer.
The lysogenic state
In the lysogen two CI dimers are bound cooperatively to OR1/OR2 and
OL1/OL2 to prevent transcription from PR and PL. A CI dimer bound at OR2
activates the transcription of the PRM promoter, while a CI dimer bound at
OR3 inhibits transcription. The repression is enhanced by an OL-CI-OR complex, which is formed by a long range interaction induced by the octamerization of the CI repressor (4, 40, 130). The resulting DNA-loop juxtaposes OL3
and OR3, enabling cooperative CI binding between OL3 and OR3 resulting in
PRM repression (Figure 14). This additional level of cooperativity leads to a
less concentration-sensitive regulation (163).
The activation of the PRM promoter by the CI repressor bound at OR2 is
accomplished by a direct protein-protein interaction between two residues in
the helix-turn-helix motif and four residues in region 4 of the σ subunit of
RNA polymerase (72). This cooperative binding accelerates the isomerization step, and thereby facilitates transcription from the PRM promoter (42).
The lytic state
To induce the prophage, PL and PR must be derepressed to initiate transcription of the lytic genes. This is accomplished by activation of the RecA
43
protease which binds to CI and promotes auto cleavage of CI. The early lytic
protein, Cro is transcribed after induction. Cro binds to the same three sites
at OL and OR as CI repressor, but with opposite affinities. When Cro binds to
OR3, it prevents transcription of cI from PRM. At higher concentrations it
binds to OR2 and OR3 and represses transcription from PR. Recent findings
indicate that Cro may have a less important role in prophage induction than
previously believed (40, 163).
OL
OR
2.3 kb
1 2
3 2
3
cI
Early lytic
1
PR
Early lytic
cro
PRM
PL
cI
RNAP
cro
cI
RNAP
cro
cI
cro
Figure 14. λ CI-mediated regulation of the PR, PL, and PRM promoters. Modified
from (41). See text for details.
44
Present investigation
Aim of the study
The aim of this thesis was to investigate two proteins involved in the
choice of the life mode of the temperate bacteriophage P2, the P2 integrase
and the P2 Cox protein. The main focus has been on a structure-function
level, trying to identify amino acid residues and parts of the proteins important for biological function and their mode of action.
Specific Methods
The methods used in this work are described in detail in the manuscripts,
but some general background to the methods is given below.
Repressor fusion system
To examine the ability of a protein to dimerise and bind cooperatively or
oligomerize, an in vivo system based on the λ CI repressor has been developed (68, 186). λ CI binds to the λ operator only if it is dimeric. The DNAbinding is mediated by the N-terminal domain while the dimerization domain is situated in the C-terminus. When fusing a protein of interest to the
DNA-binding N-terminal domain, one is able to investigate the ability of the
protein to dimerise, using a λ operator overlapping a promoter which is directing a lacZ gene as a reporter. Cooperative binding/oligomerization is
assayed in a strain with a strong upstream operator and a weak promoterproximal operator, where repression of a reporter gene will be correlated to
the capacity to bind cooperatively or form oligomers. The level of transcription is monitored by liquid β-galactosidase assay. Low activity means that
the fusion protein is binding DNA, which indicates that it is capable of forming dimers or oligomers.
45
Circular permutation analysis
As shown by Wu and Crothers (179), bent DNA can be detected by its
anomalous migration in native polyacrylamide gels. The positions of the
protein-induced bend determine the electrophoretic mobility of the proteinDNA complex, since the mobility of a DNA fragment is dependent on the
mean square end-to-end distance. Reduction of migration is maximal when
the bend is located at the centre of a DNA fragment and minimal when it is
located near the ends.
Different substrates were cloned into the bending vector pBend2 (80),
which contains two tandemly repeated restriction enzyme cleavage cassettes
with a cloning site in between. When cleaving this plasmid with different
restriction enzymes, DNA substrates of the same length but with the insert at
variable positions relative the ends, are produced. The protein of interest is
incubated with these fragments and run on a native PAGE. If the protein
bends the cloned fragments, they would migrate differently depending on
where the insert is situated relative to the ends (179). In this way one is able
to (i) examine if a protein is able to bend its targets, (ii) determine where the
bending centre is situated, and (iii) calculate the bending angle (165).
Results and Discussion
This chapter is a summary and also considers further speculations of the
results presented in the manuscripts.
List and brief summary of the papers
Paper I – The multifunctional bacteriophage P2 Cox protein requires
oligomerization for biological activity
In Paper I the protein-protein interaction between Cox protomers and the
biological impact of oligomerization of P2 Cox was investigated. This was
done by introducing single point mutations in the cox gene. The ability of the
mutated proteins to oligomerize and their biological activity were analyzed.
Paper II – A comparative analysis of the multifunctional Cox proteins of the
two hetero-immune bacteriophages P2 and WΦ
In Paper II a comparison between the Cox proteins of two coliphages, P2
and WΦ, are made. Furthermore, the interaction between Cox and DNA was
46
investigated, where the effects of Cox-DNA binding on the DNA topology
were analyzed.
Paper III - Identification and characterization of amino acids important for
dimerization of bacteriophage P2 integrase
Paper III concerns the dimerization of the P2 integrase and the amino acids involved in the protein-protein interaction. This was done by introducing
point mutations in specific parts of the P2 int gene, which have been shown
to result in defective integrase, and deleting a part coding for the C-terminal
tail of the integrase.
P2 Cox forms multimers in vivo (Paper I)
The oligomeric state of P2 Cox was examined to gain a deeper insight in
the action of the Cox protein at the different DNA targets. An in vivo system
was used, where the cox gene was cloned into the repressor fusion system
described above (section “Specific Methods”). In this assay the P2 cox construct dimerized as good as wild-type λ CI repressor. The construct was
thereafter transformed into another strain, where it was possible to distinguish oligomerization from dimerization. These results showed that P2 Cox
oligomerized in vivo. When aligning the P2 Cox amino acid sequence with
the related, multimeric HP1 Cox and the monomeric Apl protein of bacteriophage 186, it became evident that P2 Cox and HP1 Cox have some amino
acids in the C-terminal part that are identical, while the monomeric Apl
shows no identity in that part. This further strengthens the indications that
the C-terminal part is involved in oligomerization.
P2 Cox forms dimers, trimers, tetramers and octamers in vitro
(Paper I and II)
The results obtained from the repressor fusion assay were analyzed in vitro, where the aim was to characterise the exact number of Cox protomers
forming the oligomers. This was done by two in vitro techniques, size exclusion chromatography and cross linking assay. In the size exclusion experiment, highly concentrated Cox was analysed. Two distinct peaks eluted, one
corresponding to tetrameric Cox with a Stokes radius of 26 Å, and the other
corresponding to octameric Cox with a Stokes radius of 37 Å. To be able to
analyse Cox oligomerization at lower concentrations, a cross linking assay
using sulfo-DTS was developed. This gave the same result as the size exclusion chromatography, i.e. tetrameric and octameric Cox at 12.5 µM Cox
concentration. The Cox protein of the P2-related HP1 phage confirms this
finding since it also has been shown to form tetramers and octamers (49).
47
However, using glutaraldehyde as a cross-linking agent, also trimeric Cox
could be detected.
P2 Cox binds cooperatively to DNA (Paper I)
Previously performed footprint assays (138) have indicated a highly cooperative DNA-binding of the Cox protein. Cox cooperative binding to DNA
was therefore investigated by gel retardation assay in the nM-µM scale. Percent retarded DNA was plotted against Cox concentration, which resulted in
a sigmoid curve, suggesting that Cox binds cooperatively to its cognate sites.
Three shifts were detected, where the first shift probably consists of
tetrameric Cox bound to the DNA, target, while the second shift is the result
of octameric Cox forming a complex with DNA. The third shift is probably
Cox binding non-specifically to DNA. This interpretation of the results is
further strengthened by the fact that HP1 Cox has been shown to bind to
DNA as a tetramer and octamer (49).
Oligomerization is essential for DNA binding and P2 Cox activity
(Paper I)
Several Cox proteins with amino acids substitutions were analysed for
their function as transcriptional repressor/activator, excisionase, and DNA
binding. Cox repression and activation were monitored in CAT (Chloramphenicol acetyltransferase) assays and excision was monitored as production
of free phages from a cox defective P2 lysogen transformed with plasmids
encoding the different mutants. These cox mutants were further investigated
for their ability to oligomerize, both in vivo and in vitro. The results showed
that there is a correlation between the ability to oligomerize and biologically
active Cox. In fact 4 out of 5 cox defective mutants were incapable of forming oligomers. Thus it seems as if oligomerization is essential for DNA binding and biological activity.
The C-terminal part of the P2 Cox protein is involved in
oligomerization (Paper I)
The Cox protein from bacteriophage HP1 and the Apl protein from bacteriophage 186 are related and have analogous functions and similar sequences
to P2 Cox. The native size of both proteins has previously been determined.
The HP1 Cox forms tetramers which can self-associate to form octamers,
both in solution and when bound to DNA (49), while Apl is monomeric in
solution (150). When aligning the three proteins predicted secondary structure calculated according to (135, 136), the N-terminal parts show high similarity. The presumed DNA-binding domain is the helix-turn-helix motif at
48
the N-terminus, but in the case of the Apl protein the second helix is absent
in the predicted secondary structure. The oligomerization domain could be
situated at the C-terminus and there is in fact a patch which shows some
identities between the oligomer-forming HP1 Cox and P2 Cox, which is
absent in Apl.
The analysis of the mutants, together with the comparison of HP1 Cox
and 186 Apl, suggests that the oligomerization function is situated in the Cterminal half of the Cox protein. The results further imply that the Cox protein lacks distinctive domains, since a mutation (cox107) in the presumed
helix-turn-helix motif decreased the oligomerization ability of Cox, while
another mutation (cox3) resulted in a completely inactive and probably miss
folded protein.
One mutation (cox130) resulted in a protein with unexpected characteristics. Cox130 showed reduced repression, activation and excision functions.
But this reduction was not due to a reduced ability to form oligomers. On the
contrary the Cox130 protein showed an increased oligomerization capacity
compared to wild-type Cox in the cross-linking assay. Furthermore, the
Cox130 protein showed an increased DNA-binding capacity in the gel retardation assay compared to wild-type Cox. This could, however, be due to the
strong oligomerization function.
Another mutation turned out to be interesting as well, but from another
point of view. The cox2 mutation gave a protein that was still able to form
oligomers at a low frequency, but was defective in DNA-binding, transcriptional activation/repression and excision. In fact it was the mutation that
gave the most defective protein in transcriptional repression and prophage
excision. These results imply that there is no direct correlation between oligomerization deficiency and biological inactivity of the P2 Cox protein. On
the contrary, the cox2 mutation seems to directly alter the Cox proteins DNA
binding capacity.
Investigation of the WΦ Cox binding sites (Paper II)
The DNA substrate of WΦ Cox in the PePc region was determined by
DNaseI footprint assay. The Cox protein was protecting a 60 nucleotide region containing a directly repeated 12 nt sequence. The Pc transcriptional
start site was protected, but not the -10 and -35 region of WΦ Pc as is the
case in the P2 system. The assay also indicated that the WΦ Cox protein
binds cooperatively to the WΦ Pe Pc region.
49
Comparison of P2 and WΦ Cox in vitro oligomerization (Paper
II)
The oligomerization ability of P2 and WΦ Cox was investigated and
compared using glutaraldehyd as a cross-linking agent, resulting in dimeric
and trimeric complexes for the WΦ Cox. When comparing the oligomerization capacity, it becomes obvious that the P2 Cox protein has a higher tendency to form higher order complexes.
Domain swapping between P2 Cox and WΦ Cox (Paper II)
To clarify the function of the predicted α-2 helix in the presumed DNA
recognition motif of P2 and WΦ Cox, a stepwise modification of the helix
was performed, exchanging the amino acids in the WΦ Cox protein to amino
acids from the P2 Cox. From the results it was concluded that amino acid
residue T29, E28, and V32 in WΦ (corresponding to G26, T25, and R29 in
P2) are not involved in the binding specificity of Cox to the DNA substrates.
Residue K36 (D33 in P2) on the other hand is vital for DNA binding. Since
an amino acid substitution in that position abolishes DNA binding to both
WΦ and P2 DNA substrates, the residue could be context-sensitive, i.e. it is
dependent on other residues to function normally. Additionally three different hybrid proteins were constructed but neither bound to P2 DNA nor WΦ
DNA.
DNA length requirement for specific P2 Cox-DNA interactions
(Unpublished)
Most sequence specific DNA binding proteins have non-specific as well as
sequence-specific DNA binding capacity, and we were interested in elucidating the DNA requirements for specific P2 Cox binding. Four Cox box containing DNA fragments of different lengths, originating from the P2 Pc region, were used to analyze the Cox binding specificity in competitive gel
retardation assays. The respective 5´ end-labeled fragments cb28 (three Cox
boxes from the P2 Pc region), cb89 (six Cox boxes from the P2 Pc region),
cb150 (six Cox boxes + 60 nt), or cb300 (six Cox boxes + 110 nt) were incubated with the purified Cox protein and either unlabelled specific or nonspecific competitor DNA was added. The amount of Cox bound to the labeled DNA was determined by a non-denaturing PAGE followed by PhosphorImage analysis. The results obtained with the different substrates were
compared and are shown in Figure 15 and Figure 16, where the percent
shifted labeled DNA of the total labeled DNA is plotted against the ratio of
unlabelled and labeled DNA. The cb28 fragment contains the three Cox
boxes from the Pc region with the highest identity to the consensus sequence, i.e. Cox box 3, 4 and 5. Cox was found to bind non specifically to
50
the cb28 fragment, since there was almost no difference between using a
specific or nonspecific competitor DNA (Figure 15).
DNA bound (% of total)
20
15
non-specific
specific
10
5
0
0
20
40
60
80
100
Unlabelled/labelled DNA ratio
Figure 15. Competitive gel retardation assays with 5´ end-labelled cb28 fragments.
The specificity of Cox binding to the labelled 28 bp DNA fragment, cb28, containing 3 Cox boxes from the Pc region was analysed by plotting the amount of DNA
shifted out of the total labelled DNA against the unlabelled/labelled DNA ratio. 7.5
pmol of Cox protein was incubated with 1 pmol of the 5´ end-labelled DNA, and
different amounts of cold core (diamond symbols) or cold cb28 (square symbols and
dotted line) DNA fragments.
When using fragment cb89, that contains all six, well-protected Cox
boxes, a higher specificity was obtained compared to fragment cb28 (Figure
16). Increasing the length of the DNA flanking the Cox boxes, as with fragments cb150 and cb300, the specificity of the binding increased. The binding
capacity increased with increasing DNA-substrate length (from 67% (cb89)
to 88% (cb300)). Since the binding specificity and capacity increased with
the length of the flanking DNA, the low values obtained using cb28 can be
due to the lack of flanking DNA or/and lack of all six Cox boxes.
For all substrates the percent bound DNA decreased to 5% at a DNA ratio
of 25 when adding cold specific competitor (data not shown).
51
100
90
80
DNA bound (% of total)
70
60
cb300
cb150
cb89
50
40
30
20
10
0
0
25
50
75
100
125
150
Unlabelled/labelled DNA ratio
Figure 16. Competitive gel retardation assays with DNA fragments of different
length. Competitive gel retardation assays were performed with 5´ end-labelled cb89
(triangle symbols and dotted line), cb150 (square symbols and broken line) and
cb300 (diamond symbols) DNA fragments. 1.5 pmol Cox protein was incubated
with 0.05 pmol 5´-labelled Cox box containing DNA fragments, and cold specific
competitor DNA was added. The amount of labelled DNA shifted out of the total
labelled DNA was quantified and plotted against the unlabelled/labelled DNA ratio.
Specific P2 Cox and WΦ Cox binding induces a large bend in
the DNA targets (Paper II)
The topological effect of Cox binding on the DNA was investigated using
the circular permutation assay (for an explanation of the assay see section
“Specific Methods”). All three P2 Cox substrates, Pc, PLL and attP were
analysed and showed that Cox bends the targets substantially (app. 125°),
upon binding. The centre of the bend was located between Cox box 3 and 4
in the P2 substrates and between Cox box 4 and 5 in the P4 substrate. These
bending centres did not coincide with the centre of the substrate, since they
were designed to minimize the occurrence of an artificial bending in the
centre of the DNA molecule rather than the actual bending centre induced by
the Cox protein. The same targets were analysed for intrinsic curvature and
no bend was detected. When using a substrate with 4 Cox boxes cloned in
the circular permutation assay vector, neither bending nor specific binding to
the target was detected.
52
Since the organisation of the Cox boxes in the DNA targets of WΦ Cox is
different compared to P2 Cox DNA targets, it was decided to investigate
whether WΦ Cox could also bend its targets. Therefore the bending ability
of WΦ Cox was examined by the circular permutation assay against a DNA
substrate containing the Cox binding sequence of the WΦ Pe-Pc region. It
was shown that WΦ Cox could bend the DNA substrate and the bending
angle was estimated to be slightly larger (150°) than for P2 Cox. It should be
mentioned though, that the circular permutation assay only detects rather
large bends, so the results are a rough estimate when it comes to exact bending angles, i.e. minor differences in bending angles between the substrates
are not detected.
P2 Cox does not bend DNA when binding non-specific
substrates (Paper II)
The P2 Cox-DNA interaction was further investigated with focus on binding-specificity and bending. This was done by analysing how Cox topologically affects substrates containing 3 or 4 Cox boxes, i.e. substrates to which
P2 Cox does not bind specifically to (see above). This showed that Cox is
unable to bend DNA when binding non-specifically. This indicates that Cox
uses the energy gained by specific binding to induce the bend. In this case
the P2 Cox protein is different compared to the λ Cro protein, which has
been shown to bend when binding non-specific DNA.
P2 integrase forms dimers in vivo, but does not show
cooperative binding or oligomerization (Paper III)
To get a deeper understanding of the formation of the intasome and the
formation of the Holliday structure during recombination, the native size of
integrase was determined in vivo in the repressor fusion system (see
“Specific Methods”). These results show that P2 Int has a strong dimerization function, even stronger than the reference protein λ CI repressor. To
investigate if the results in the dimerization assay were due to oligomerization, P2 Int was tested in the oligomerization/cooperative binding strain of
the repressor fusion system. P2 Int showed in our experiments just a slight
oligomerization/cooperative binding. This could be due to several circumstances. (i) Fusing P2 Int to the N-terminal part of the CI repressor,
hides/destroys the part involved in the oligomerization/cooperative binding,
(ii) the DNA sites in the repressor fusion system are only separated by 7
basepairs, which is not enough for the DNA flexibility required for Int oligomeric protein interactions, or an active DNA bend is required for the correct alignment of the different Int molecules, (iii) there is no strong oli-
53
gomerization/cooperative binding function involved in biological active P2
integrase.
The cross linking assays showed that P2 Int only forms dimers in solution
under the conditions used.
Sequencing of int defective mutants (Unpublished)
The int genes from a previously isolated (by E.L. Bertani) collection of 48
P2 mutants, unable to form lysogeny, were sequenced. 28 of the mutants
were found to have single point mutations located within the coding part of
the gene (Figure 17). 21 different amino acid residues were affected and
they are clustered in five regions. One at the N-terminus, one region around
aa 130, one region at patch 1, one region in Box I and one region within Box
II. The characteristics of the point mutations and a comparison to the analogous amino acids in HP1, λ, and Cre recombinases are shown in Table III.
The sequencing further revealed several double point mutations and nonsense mutations (data not shown).
Seven single amino acid substitutions were chosen for the initial structure-function analysis of the P2 integrase, R26H, D57N, L83P, S131N,
E169K, E197K, and G283E (Figure 17).
100
200
PATCH 1
BOX 1
300
PATCH 2 PATCH 3
BOX 2
N
D14N
R16C
G22E
R24H
C
S62P
L83P
R26H D57N
S122N G132Y
S131N
Y164C
G192R A199V
E197K
E169K
G265E
R272K
T277I
G284R
G283E
Figure 17. Positions of the seven amino acid substitutions (in bold character) chosen
from the results obtained from the sequencing of the int mutants. The boxes represent regions conserved among the Int-family of recombinases.
54
Table III. A list of the different amino acid substitutions in the P2 integrase leading
to integration defective phage
aa-# aa subs.
Cons.
Analogous aa
Structural motif
Motif
*
HP1
λ
Cre HP1
λ
Cre
14
D -> N
16
R -> C
22
G -> E
24
R -> H
26
R -> H
57
D -> N
62
S -> P
83
L -> P
122
S -> N/L
131
S -> N
132
G -> Y
164
Y -> C
F173 R179 A136 L
L
L
169
E -> K
++
D178 E184 D141 αA
αA αA Patch 1
192
G -> R
++
G205 G210 L171 L
L
L
Box I
197
E -> K
++
E210 D215 E174 αC
Box I
αC
αC
199
A -> V
+
E212 C217 A178 αC
L
Box I
αC
265
G -> E
G276 S299
A275 L
L
L
272
R -> K
+++
R283 R311 R292 αF
Box II
αF
αF
277
T -> I
+
S288 A315 R297 αF
Box
II
αF
αF
283
G -> E
++
G294 Q321 G302 L
L
Box II
αF
284
G -> R
G295 I322
Y303 L
L
L
Box II
* Consensus when comparing 80 prokaryotic members of the tyrosine recombinases (113).
Residues affecting Int dimerization are located in the C-terminal
part of the protein (Unpublished results)
R26H, D57N, L83P, S131N, E169K, E197K, and G283E were introduced
into the repressor fusion system (Figure 18). The results showed that one
amino acid substitution, E197K, resulted in a dimerization defective integrase. Two additional amino acid substitutions did affect the ability of the
integrase to dimerize, E169K, and G285E. However the introduced amino
acid substitutions showed a residual dimerization function, although significant lower than that of wild type integrase. None of the other amino acid
substitutions (R26H, D57N, L83P nor S131N) did affect the dimerization
capacity of the integrases.
55
2500
2000
1500
1000
pKH101
CI
Int
R26H
D57N
L83P
L83P
pZ150
R26H
0
D57N
500
E169K
G283E
S131N
E197K
C o n stru cts
Figure 18. In vivo dimerization assays of selected int mutants. Each column shows
the results from three independent ß-galactosidase measurements of crude extracts
of E. coli transformed with the plasmids expressing the Int variants indicated below
the columns.
The absolute C-terminal end is also involved in dimerization of
P2 integrase (Paper III)
The integrase of the P2-related HP1 bacteriophage has been shown to
form dimers, mediated by a "Yin-Yang style" interaction between the Cterminal ends of the protomers (67). Due to the resemblance between the P2
Int and the HP1 Int, we were interested in the ability of C-terminal truncated
P2 Int to form dimers in the repressor fusion assay. Two different truncations
were made, lacking either 17 amino acids (C17) or 25 amino acids (C25).
The results show that the C-terminal truncated P2 integrases are unable to
dimerize. These results imply that the P2 Int dimer formation is mediated by
the C-terminal tail of the protomers, analogous to HP1 Int dimerization. In
the λ system the C-terminal seems to be involved in interaction between
protomers and the regulation of integrase activity.
Residue E197 in P2 integrase is involved in Int dimerization
(Paper III)
Amino acid residue E197 was in the initial study shown to be a candidate
amino acid important for protein-protein interaction as well as for biological
activity (see above). In the repressor fusion system it was shown that the
dimerization function of an E197A integrase was reduced. From these results
it was concluded that the amino acid E197 is either directly or indirectly
involved in dimerization. One interesting aspect is that analogous amino
56
acids in the structural determined HP1 integrase and the λ integrase have
been shown to be situated in the catalytic pocket.
Capacities of the mutated and truncated Int proteins to
complement the int1 defective P2 prophage (Paper III and
unpublished results)
To examine the ability of the mutants to complement the E197K substitution, the mutated int genes were cloned into pET8c, and transformed into
strain C-2810 which contains the int1 defective P2 prophage harbouring the
E197K substitution. The abilities of the transformed C-2810 strains to form
phages spontaneously during growth were analyzed. As can be seen in Table
IV, Int D57N is able to complement P2 int1. One interesting observation is
that a functional intasome can be formed between the dimerization defective
integrase encoded by the prophage, and the integrases containing the D57N
substitution.
Table IV. Spontaneous phage production of the P2 int1 defective prophage in strain
C-2810 containing Int expressing plasmids (unpublished results).
Plasmid
Int protein
Relative spontaneous phage
expressed
production *
pET8c
No Int
<2.5 x 10-5
pEE2001
wt Int
1
pEE2008
∆2-3Int
1
pEE2009
Int-R26H
7.5 x 10-4
pEE2010
Int-D57H
0.8
pEE2011
Int-L83P
<2.5 x 10-5
pEE2012
Int-131N
<2.5 x 10-5
pEE2013
Int-169K
2.5 x 10-2
pEE2014
Int-197K
<2.5 x 10-5
pEE2015
Int-G283E
3 x 10-5
*The PFU/CFU for strain C2810 containing plasmid pEE2001 is set to 1.
The C-truncated integrase proteins and E197A Int protein bind
normally to the phage attachment site but do not retain full
recombination activity (Paper III)
The C-truncated integrases and the Int-E197A were subjected to gel retardation assay to investigate the DNA binding abilities of the proteins. The
integrases were found to bind to substrate DNA in the same manner as the
wild type protein. When analysing the proteins in a complementation assay it
57
was shown that the truncated integrases were severely defective in recombination activity, while the E197A had a slightly reduced activity.
Table V. Summary of the Structure function study of P2 integrase.
Protein
Dimerization
Int
++++
IntR26H
++++
IntD57N
++++
IntL83P
++++
IntS131N
++++
IntE169K
++
IntE197K
IntE197A
IntG283E
++
Int ∆C17
Int ∆C25
n.d. = not determined
int1 complementation
+++
+++
+
++
-
DNA binding
+++
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.
+++
n.d.
+++
+++
P2 Int cleaves single stranded DNA (Unpublished results)
The P2 core region consists of 25 base pairs with a so called top-strand
and a bottom-strand. The exact cleavage site in the core region is not known
for P2 integrase. An assay was set-up, with the intention to localize the
cleavage site. When using double-stranded DNA substrates in the assay, no
cleavage products were detected. This could be due to difficulties in trapping
the cleaved DNA substrates, since the joining reaction probably is very fast.
Different suicide substrates were also tested, without success.
Instead, the top-strand or the bottom strand were radioactively 5´ and 3´
labelled and incubated with P2 integrase. In this assay, using a single
stranded substrate, the DNA was specifically cleaved as shown in Figure 19.
There was one base pair difference depending on whether the substrate was
5´or 3´ labelled. When combining the results from the assay, the results lead
to a substrate with 3´overhang as opposed to other related systems, where the
integrase-induced cleavages results in substrates with 5´overhangs.
58
5’-AAATAAGCCCGTGTAAGGGAGATTT-3’
3’-TTTATTCGGGCACATTCCCTCTAAA-5’
Figure 19. Summary of the results from the in vitro cleavage assay. The inverted
repeat is indicated by block arrows. The broken lines represent the fragments obtained with 3´labelled oligonucleotides and the filled lines represent the results obtained with 5´labelled oligonucleotides.
Conclusions and speculations
The Cox boxes of phage P2 - a closer inspection and thoughts
In previous articles (138, 184) it has been suggested that there are three
Cox boxes in the P2 Pc region, four in the P4 PLL region and six Cox boxes
in the P2 attP region. When inspecting the data obtained from these investigations, several other Cox boxes were identified, which where in the regions
protected by the Cox protein in foot-printing assays. This resulted in six Cox
boxes in the P2 Pc region and eight Cox boxes in the P4 PLL region (see
Table VI) were detected. Visualizing a model for Cox-DNA interactions is
challenging since the Cox boxes are arranged differently in respect to direction and phasing. The eight Cox boxes in the P4 PLL region could reflect the
need for the P4 phage to “win” the competition against the P2 Cox boxes
when it comes to Cox recruitment. The 8 Cox boxes at P4 PLL will result in
a larger DNA ”surface” which could ”catch” the Cox protein and it could
also increase the affinity for the Cox protein, compared to 6 Cox boxes in the
P2 substrates. When looking at the different substrates, it becomes obvious
that the P4 PLL region is the only substrate that contains 2 Cox boxes that
show 100% identity compared to the consensus sequence. Further, there is
72 % identity to the consensus sequence when investigating all 8 Cox boxes.
This should be compared to 61 % identity in the P2 Pc region.
When aligning the different Cox boxes (Table VI) a pattern becomes evident where the first five nucleotides show 73 % identity while the last four
show 55% identity. It can also be noted that the intact triplet of adenines can
be found in 15 out of 20 Cox boxes.
59
Table VI. Sequence comparison of Cox boxes (Modified from (184))
Phage
Cox
Direc-
and
box
tion *
region
no.
Sequence (5´-3´)
iden-
iden-
iden-
tity nt tity nt tity
1-5
6-9 **
nt 1-9
C
C
C
4/5
3/4
7/9
A
C
C
G
1/5
2/4
3/9
3
L
T
C
A
A
A
C
C
C
G
4/5
2/4
6/9
4
R
A
T
A
A
A
T
T
A
C
4/5
1/4
5/9
5
R
T
G
A
A
A
G
C
C
C
4/5
2/4
6/9
6
R
T
T
A
A
A
C
G
T
T
5/5
1/4
6/9
1
L
C
T
A
A
A
C
A
A
T
4/5
1/4
5/9
2
R
A
T
G
T
G
G
G
C
A
1/5
4/4
5/9
3
R
T
A
A
A
A
G
G
C
A
4/5
4/4
8/9
4
R
T
A
T
A
A
G
A
C
A
3/5
4/4
7/9
5
R
T
T
A
A
A
C
G
C
A
5/5
3/4
8/9
6
R
T
T
C
A
T
G
A
G
G
3/5
2/4
5/9
1
R
T
A
C
A
A
T
G
G
C
3/5
1/4
4/9
2
L
A
A
A
A
A
C
A
C
A
3/5
3/4
6/9
3
R
T
T
C
A
T
C
T
C
C
3/5
2/4
5/9
4
R
T
T
A
A
A
G
T
C
A
5/5
4/4
9/9
5
R
T
T
A
A
A
G
C
C
A
5/5
4/4
9/9
6
R
T
T
A
A
A
G
C
A
A
5/5
3/4
8/9
7
L
A
A
A
A
A
T
T
A
C
3/5
1/4
4/9
8
R
T
G
A
A
A
T
A
C
A
4/5
3/4
7/9
T
T
A
A
A
G
N
C
A
73/100
P2 Pc
P4 PLL
Consensus
% identity
50
G
T
65
A
G
-
A
T
45
A
T
85
G
A
90
T
L
75
L
2
50
1
70
P2
attP
73
53/80*
126/180
55 **
70
* Direction relative the numbering of the P2 genome.
** not including nt 7.
When estimating the size of Cox in the size exclusion chromatography,
one Cox protomer is about 10 Å in diameter, which would fit the distance,
10.2 Å, for three bases in B-DNA. A kink in the DNA substrate could facilitate the binding of the Cox oligomer to reach the next adenine triplet resulting in a bend in the DNA, or the bent DNA is an indirect result of Cox oligomers bridging the Cox boxes. This model can explain why the direction of
the Cox boxes is irrelevant for Cox binding and at the same time easily visualize the way Cox bends the DNA substrate. It can explain how the Cox
complex of 80 Å can cover a region spanning 218 Å to 330 Å. It is also
striking that in the cases where the adenine triplet is absent the first two
bases of the Cox box are either A or T, which perhaps could compensate and
function as an alternative binding site.
60
Another interesting feature of the P2 Cox boxes is the direction of the
Cox boxes and their phasing. A center-center spacing of 10 base pairs leads
to that the binding sites are situated on the same side of the DNA molecule,
while a center-center spacing of 5 would mean that they are situated on opposite sides. There seems to be a correlation between the direction of two
adjacent Cox boxes and their phasing. When the directions are different (inverted repeat), the Cox boxes are situated on the opposite side of the DNA
molecule (center-center spacing of 11-16 base pair), while Cox boxes with
the same relative orientation (direct repeat) are situated on the same side
(center-center spacing of 9-12 base pair). These findings could indicate that
when the Cox recognition sites are separated by 11-16 basepairs, there is
enough flexibility for the DNA to be twisted, resulting in the Adenine triplet
being on the same side facilitating Cox-Cox interactions.
A hypothetical mechanism for the formation of Cox oligomers
The results of the cross-linking studies can be used to propose a hypothetical mechanism for the assembly of the Cox oligomers, where Cox
monomers are added sequentially to each other in a stepwise manner, i.e.
monomers are added to monomers resulting in dimers. Thereafter another
monomer is added and trimers are formed followed by addition of a fourth
monomer resulting in a tetrameric, DNA-binding competent protein complex.
A speculative model for Cox-DNA interaction
A speculative model for Cox-DNA interaction can be proposed from the
results.
After being synthesised Cox monomers aggregates and form DNAbinding competent tetramers. The protein-protein interaction is mediated by
the hydrophobic β-strand 3 and the amphipatic α-helix 3. These tetramers
bind to DNA in a non-specific manner and diffuses on the DNA without
inducing DNA bends. When encountering a Cox box, specific binding is
mediated by Arg-30 in the second recognition helix, which contacts base
pair 4 (the second adenine in the triplet) and also reaches the two other adenines, i.e. base pair 3 and 5 in the Cox box. When reaching the region containing the Cox boxes the tetrameric Cox-complex will encounter other
tetramers, and octamers are formed. For these octamers to bind specifically
at least six Cox boxes are needed, i.e. six Cox molecules have to bind to
DNA to achieve a stable, specific protein-DNA complex. Upon the binding
of tetramers to the DNA and the formation of the octamers a substantial bend
is induced in the DNA. An alternative model could be that there is equilibrium between tetramers and octamers in solution. The tetramers can bind
non-specifically to DNA without affecting the DNA topology, while the
61
octamers can specifically bind and bend the DNA when encountering Cox
box containing DNA substrate.
(a)
(c)
(b)
(d)
(e)
Figure 20. Possible mechanisms for Cox-DNA interaction. Filled arrows represents
Cox boxes in the attP region, spheres represents Cox molecules. (a) Cox binds to
non specific DNA without bending. (b) Thereafter Cox diffuses along the DNA until
it (d) finds the Cox boxes, where Cox binds specifically and (e) bends the DNA. An
alternative mechanism could be that there is an equilibrium between tetrameric and
octameric Cox in solution. Tetrameric Cox binds non-specifically to DNA (a). (c)
and (d) octameric Cox can bind specifically to the Cox boxes, and (e) bends the
DNA.
Summary of the Cox action at the different DNA targets
The P2 Cox protein exhibits different functions at the different targets by
the same basic mechanism, specific DNA-binding and bending.
At attL, Cox induced bending is probable necessary for the right alignment of attL and attR which are separated by over 33 000 bp. Cox could also
prevent Int from binding to the P´1 arm, since footprint analysis has revealed
that Cox partly covers the site (185). Cox could interact with the other proteins in the nucleo-protein complex, i.e. Int and IHF.
At P2 Pc, Cox could sterically hinder the RNA-polymerase to bind to the
Pc promoter of P2 and thereby repress transcription, since the Cox boxes are
covering the promoter. The bending capability of Cox could additionally or
exclusively cause miss oriented DNA bending in the opposite direction
62
compared to RNA-polymerase-induced bending, which also could lead to
repression.
At P4 PLL on the other hand, the Cox boxes are situated upstream of the
promoter at a distance where activators usually contact RNA-polymerase
directly. It is also believed for this kind of activators that DNA-bending,
apart from RNA-polymerase-activator contacts, could be a prerequisite for
closed complex formation in general.
Speculation about the nature of the protein-protein interaction
between Int monomers
The results obtained in Paper III invites to speculations about how the P2
Int-Int interaction is mediated, the sequential order of the intasome formation, and the positioning of integrase in the Holliday junction and the nature
of the cleavage.
None of amino acid substitutions in the N-terminal part does affect
dimerization. This part of the integrase could be involved in Int interaction
with other proteins (IHF, Cox?), and Int binding to the arm sites. The Cterminal part on the other hand is involved in dimerization, which leads to
several speculations about the correlation between dimerization and cleavage. It was shown that an amino acid residue, which, in analogous HP1 integrase and λ integrase, has been shown to be situated closely or in the active
site, is involved in dimerization, since the λ analogue to E197 has been
shown to be a part of the catalytic pocket. Further the analogous amino acid
to E169 in λ Int, has been shown to protrude from the surface away from the
active site (83). There are other amino acid residues that are proposed to be
solely involved in dimerization, when comparing our results with the results
obtained from the three-dimensional structure of HP1 Int. The analogous
amino acid residue to G283 in HP1 Int could stabilise an interface which
interacts with the same interface on the other Int protomer.
The results from the dimerization experiments with the truncated P2 integrases implies that the P2 integrase could have the same Yin-Yang style of
protein-protein interaction as has been shown for the C-terminal tail of HP1
integrase.
The results with the truncated integrases suggest that DNA-binding does
not require the dimerization function, i.e. P2 Int can bind to DNA as a
monomer. Thereafter the Int-Int interaction, together with IHF mediates an
active intasome. This has been shown for the HP1 Int, which primarily exists
in monomeric form in solution under normal reaction conditions. Gel retardation and equilibrium sedimentation experiments have shown that the HP1
integrase is capable of forming dimers and tetramers through highly cooperative interactions. These results suggest that single integrase monomers
63
bind sequentially and cooperatively to an Int binding site in HP1, producing
a complex with two protomers of integrase and one DNA dyad.
One question is whether the protein-protein interacting surface is commonly situated in the N-terminal, and that integrases related to P2 Int, like
HP1 Int, have their own way of mediating protein-protein interactions, i.e.
by the C-terminal part. This is further implied by the structure of the Nterminal part of the λ integrase, where it is shown that protein-protein interactions may involve amino acids within a α-helix of the amino terminal domain. These amino acids form a solvent exposed hydrophobic surface that
might be involved in cooperative interactions with other Int molecules (177).
However, recently it has been shown that the C-terminal tail of λ integrase stimulates the resolution of the Holliday junction by positioning the
nucleophilic tyrosine in the adjacent integrase (65). Whether this mechanism
is similar in P2 Int action remains to be investigated.
64
Future perspectives
Structural determination of integrase and Cox
In order to get a complete image of the protein, structural determinations
should be performed. To be able to do this several key aspects has to be considered. A preparative protein purification process has to be setup, preferably
with high yield and most importantly giving proteins with high purity. Secondly a buffer has to be tested that gives high stability, at high protein concentrations and storage at a convenient temperature. Due to the small size of
the Cox protein, structural determination by NMR could be tried, while x-ray
crystallography should be tried for integrase.
Initially Circular dichroism could be used as well as performing a partial
protease cleavage of the proteins to determine the secondary structures and
domains.
Structural determinations with DNA could additionally give insight into
the mechanisms and the mode of action of the proteins.
Extended structure-function studies of integrase and Cox
A good complement to the three dimensional structure would be to perform extended structure-function studies based on the information obtained
from the structures. Amino acid residues should be chosen and substituted,
and thereafter the altered protein should be subjected to different assays, e.g.
recombinational activity, DNA binding capacity, dimerization ability etc. It
would also be interesting to investigate the determinants for core and arm
recognition, since P2 Int binding shows the reverse binding affinity compared to λ Int, i.e. strong binding to core and weak binding to the arm sites.
Protein-protein interactions within the Intasome
An interesting aspect of site-specific recombination is the formation of
the recombinational active nucleoprotein complex, the intasome. To gain a
deeper understanding of the intasome formation, protein-protein interactions
within the intasome, i.e. between IHF, Cox, and integrase could be investigated. This could be done by, for example, performing cross-linking assays,
gel filtration experiments, or cloning the proteins into a two-hybrid system.
65
The importance of DNA binding for protein-protein interactions could be
determined by adding DNA to the in vitro experiments above.
RNA-polymerase – Cox interactions
It would be interesting to investigate whether Cox interacts with the RNA
polymerase, and if so, if the interaction is the same regardless if Cox functions as a repressor or activator. Perhaps the Cox protein does not interact
with the RNA-polymerase. Instead it may be the change of DNA topology
that accommodates the different transcriptional regulatory activities.
Integrase cleavage sites
The exact cleavage site of the integrase is not known. Preliminary results
from experiments using single stranded DNA substrates, give a hypothetical
cleavage pattern. The cleavage points obtained from the experiments with
the 5´ labelled substrates do not coincide with the results obtained with 3´
labelled substrates, this could be due to the approximation that 3´ labelled
substrates migrates 2 nucleotides slower than 5´ labelled. One conclusion is
that the Int cleaves the core region with 3´ overhang as opposed to 5´ overhang, which is the case for λ integrase and HP1 Int. To confirm this, cleavage assays with double stranded DNA substrates has to be done. One problem is that the cleavage reaction seems to be a very fast reaction since no
intermediates can be detected, therefore suicide substrates has to be used. To
further stimulate cleavage, DNA containing the arm sites could be added to
the reaction, since it could be stimulatory to cleavage.
Int auto regulation
It is not known how the int gene is autoregulated. An int mutation (-9 int)
were amino acids 2 and 3 are deleted does not seem to be down-regulated
when over-expressing the gene in an expression system.
One experiment to find out whether this effect is due to the alteration of
the protein or the nucleotide exchange in the mRNA, could be fusing the wt
int gene and the -9 int gene to the lacZ gene. Thereafter Int or -9 Int could be
added in trans, and the level of expression could be detected by the βgalactosidase assay.
Another aspect of the auto regulation is the fact that the P2 integrase possible can cleave single stranded DNA. Therefore it would be interested to
test if it is able to cleave RNA and to investigate whether this cleavage could
be involved in the stability of int transcript.
66
Identify and exchange the core recognition domain of integrase
From the structure-function studies and the structure determination experiments of the integrase, the core recognition domain could be determined.
This knowledge could be used to try to exchange this domain to other DNAbinding domains to see if the DNA recognition specificity could be altered.
Alternatively the core binding domain could be subjected to mutagenesis.
This alteration could be a major advantage in developing the P2 site-specific
recombination system to a gene-delivery system.
IHF independent integrase
In the P2 system it has been shown that the IHF binding site in the attP
region could be substituted to a HMG box retaining full recombinational
activity (C. Frumerie, personal communication). It would be convenient, if
an IHF independent P2 integrase could be developed. In the λ system one
integrase mutation has been isolated that leads to an IHF-independent integrase. The fact that P2 attP only contains one IHF binding site compared to
three in the λ attP, could indicate that the P2 system could be more insensitive to IHF. Combined with the strong binding of P2 integrase to the core
site perhaps a minor change in either the IHF contacting surface, alternatively the arm binding part could result in an IHF independent integrase. It
would also be interesting to analyze the effect of replacing the IHF binding
site with a poly A-tract.
Intasome structure
One way of determining the ternary structure of the Intasome could be to
make use of atomic force microscopy. This method allows the study of the
molecular structure of macromolecules with nanometer resolution without
crystallization. It provides three-dimensional surface images and quantitative
information on the heights of structures can be obtained from the images.
Studies of protein-DNA interactions
A Biacore –system (Biacore, Uppsala, Sweden) can be used for real time
kinetic analysis for different interactions. It would be interesting to investigate the protein-DNA interactions of Cox and integrase. The results could
give a deeper insight into mechanism for DNA binding, degree of cooperativity etc.
Another approach when investigating protein-DNA interactions could be
to clone the int and cox genes into the pET33b(+) vector (Novagen) which
carries a 15 bp sequence encoding the protein kinase A (PKA) site RRASV.
67
The expressed proteins could be labeled with 32P and used as direct probes in
e.g. protein-DNA interaction studies.
68
Acknowledgements
Many people have encouraged me, inspired me, helped me, supported me,
influenced me, and shaped me during the years while completing this work.
Elisabeth, thank for letting me go my own ways. Your friendly and
happy attitude no matter what, has made life easier. I will never forget your
efforts and help when welcoming me back to the academic world and letting
me finalize this thesis.
Sara, I admire you in every aspect of life, such as when it comes to working, sporting, parenthood, digging, sleeping, and laughing. Without you, this
thesis would never have been written. Working with you was a lesson in
enthusiasm, sequence dribbling, frantic cloning, honest criticism, and competitive attitude. Living with you means (apart from that mentioned above)
stability, fun, computer-games, great food and wine, kendo, raising our kids
etc. Thank you for putting up with me, for being a loving wife and a good
mother. You are truly my twin soul. Love You forever!
Richard, (aka Richi-Trickson, aka Richelieu), no one I know has ever
beaten me in as many sports as you. Frustrating! Thank you for all stimulating scientific and none-scientific discussions, and for all good times spent in
the lab and all other places we have been to! I think it is amazing that we
chare so many (odd?) interests like protein purification, lab machines, music
and sports, NHL99, WIF, FIFA99, ASL, Chess. I would also like to take the
opportunity to thank you for being a good and caring Godfather. And, finally, I have to admit that you are the king of Navel-fluff!
Alex, (aka Lalex, aka Alexandralianowitch), I have known you for a
long time, and I think our friendship is growing stronger for each year!
Thank you for the karate noise, for being the best singer in the jaming geneticists, and a good coffee partner (without drinking coffee). You are one of
the most devoted people I know, and I admire your focus and I love your
humour.
Clara (aka Trinity), I think you have made a huge effort when finishing
our manuscript. Thank you for our collaboration, and for being a good
friend.
Marc, thank you for all the fun in the lab for being a good friend, and
your analytical mind.
Tao, thank you for trying to learn me Chinese (I am sorry i do not remember a single word!)
69
Joakim, the dirtiest mind in the lab (and that says a lot!!). Your absurd
humour is fantastic!
Björn, thank you for your sarcastic comments, vast computer knowledge,
for learning me the mysteries of trapist beer and Scottish single malt whiskey.
Anders, thank you for good collaboration, for all innebandy-games, and
for always being ready to give a helping hand.
Pelle, thank you for learning me about the fruit-fly, bikes, and computer
games. I will never forget all fun and jokes on the course lab.
Hans, thank you for reminding me of the importance of statistics in all
type of research, and for the best ”kanelbullar” I have ever tasted.
Anette, its great to have someone keeping track of everybody and everything. Thank you for always being happy and friendly.
Irja, thank you for being a good ”mother” keeping everything clean and
neat.
Jeroen, I admire your efficiency and devotion.
Santanu, thank you for your bright ideas and experience.
Kattis, thank you for your positive attitude and for being frank.
Ingrid, Yohannes, Raul, and Olle, thank you for giving some eukaryoutic perspective on things.
Christina, thank you for all protein help, and article-digging.
Agneta, thank you for introducing me to teaching and proving the importance of engaging and stimulating people.
My Biovitrum colleges:
Magnus Löfgren, you are one of my best friends. Your sense of humour
and honesty are admirable. You are also always helpful and a caring person.
Its great to race against you in GT4 while eating “Sour cream and lime”
chips and drinking Cuba Libre.
Jakob Liderfelt (mini-me), thank you for your enthusiasm, friendship,
interest in golf, board-games, MODDE, and whiskey.
Pelle Sjöholm, working with you is great. Thank you for all jokes,
smiles, experience, and dirty e-mails.
Susanne Wood, you always have time for small talk, no matter how
much you have to do (which usually is a lot!). I also appreciate your vast
knowledge of chromatography, your humour and most of all your laughter.
Marcus Jöngård, its nice to know someone that is almost as childish as
myself. I am looking forward beating you up in board-games as well as in
golf!?
Maria Hedlund, thank you for helping me with proofreading this thesis,
and for support and encouragement both during the writing of this thesis as
well as during our everyday work.
Eva Gray, my boss, thank you for encouraging me and making it possible for me to finish this thesis. I really appreciate our “cigarette talks”
70
Louise Staffas, I miss your enthusiasm and crazy humour. Thank you for
introducing me to the industrial world.
People outside science:
Moa and Ida, thank you (?) for sleepless nights and endless joy. For being my most successful ”projects” and changing the way I look upon life. I
love you so much that it hurts!
Mamma and Pappa, thank you for raising me and guiding me through
life, for making me feel special and learning me the art of self-criticism. You
are not only good parents but also my best friends.
Fia, thank you for sharing the same sense of absurd humour, for being the
most honest person I know, for our fights as kids and for our friendship
nowadays.
Calle “Charlie X”, thanks for all laughs and good times over beers, on
golf courses and while playing badminton. I wonder if you realize how much
you have influenced me regarding my music taste and my dirty humour.
Mumme, I miss you! You were my first tutor in biology and my first
trainer in soccer and tennis. You were and are and will always be an important person in my life. R.I.P.
Inga-Britt and Bengt, I have not met many people that are as caring, loving and understanding as you. Thank you for your unconditional love towards me, Moa and Ida, for all the nice dinners and wine in Grödinge, and
for babysitting Ida and Moa.
Klas Grevelius, my former shrink, thank you for helping me bringing order in my life and giving me energy finishing this thesis. R.I.P. (Kau Lak
2004).
This thesis is also influenced by (in no special order):
Dagge, Gene, the Honnér Family, Stockholm Archipelago, J.S. Bach, Coffee, the
Ljung Family, PS2, The Cure, People at Biovitrum, Dive, David Beckham, Isaac
Asimov, Matrix, Star Wars, Prokofiev, System of a Down, Athlete, TLOTR, Pizza,
Novalocol, Alvedon, Ardbeg, Irish Coffee, Myst, Pesto, Gitta Sereny, Mats Sundin,
Kendo, Friends, Golf, the Widholm Family, the autumn, Ping, Mifune, D-day, the
Renberg Family, A-ha, Fetzer, Gary Larsson, Depeche Mode, Sushi, Band of Brothers, My Grand Parents, Pink Floyd, Small Town Urbans, M. Night Shyamalan,
Blues Brothers, the Smiths, GT4, Athlete, Wagner, Innebandy, Neighbours, and
Relatives.
This work was supported by grant number 72 from the Swedish Medical
Research Council.
71
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
72
Aihara, H., H. J. Kwon, S. E. Nunes-Düby, A. Landy, and T. Ellenberger. 2003.
A conformational switch controls the DNA Cleavage activity of lambda Integrase.
Molecular Cell 12:187-198.
Arciszewska, L. K., and D. J. Sherratt. 1995. Xer site-specific recombination in
vitro. EMBO Journal 14:2112-2120.
Azaro, M. A., and A. Landy. 2002. Lambda integrase and the lambda Int family,
p. 118-148. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.), Mobile DNA II. ASM Press, Washington D.C.
Baek, K., S. Svenningsen, H. Eisen, K. Sneppen, and S. Brown. 2003. Singel-cell
analysis of lambda immunity regulation. J. Mol. Biol 334:363-372.
Ball, C. A., and R. C. Johnson. 1991. Efficient excision of phage lambda from the
escherichia coli chromosome requires the Fis protein. J. Bacteriol. 173:4027-4031.
Barne, K., J. Bown, S. Busby, and S. Minchin. 1997. Region 2.5 of the Escherichia coli RNA polymerase σ70 subunit is responsible for the recognition of the
"extended -10" motifat promoters. EMBO J. 16:4034-4040.
Barreiro, V., and E. Haggård-Ljungquist. 1992. Attachment sites for bacteriophage P2 on the Escherichia coli chromosome: DNA sequences, localization on the
physical map, and detection of a P2-like remnant in E. coli K-12 derivatives. Journal of Bacteriology 174:4086-4093.
Bell, C. E., P. Frescura, A. Hochschild, and M. Lewis. 2000. Crystal structure of
lambda repressor C-terminal domain provides a model for cooperative operator
binding. Cell 101:801-811.
Bell, C. E., and M. Lewis. 2001. Crystal structure of the lambda repressor Cterminal domain octamer. J. Mol. Biol 314:1127-1136.
Benjamin, K. R., A. P. Abola, R. Kanaar, and N. R. Cozzarelli. 1996. Contributions of supercoiling to Tn3 resolvase and pkage mu gin site-specific recombination. J. Mol. Biol. 256:50-65.
Bertani, G. 1951. Studies on lysogenesis I. The mode of phage liberation by lysogenic Escherichia coli. J. Bact. 62:293-300.
Bertani, L. E. 1968. Abortive induction of bacteriophage P2. Virol. 36:87-103.
Bertani, L. E., and E. W. Six. 1988. The P2-like phages and their parasite, P4, vol.
volume 2. Plenum Publishing Corporation, New York and London.
Biswas, T., H. Aihara, M. Radman-Livaja, D. Filman, A. Landy, and T. Ellenberger. 2005. A structural basis for allosteric control of DNA recombination by
lambda integrase. Nature 435:1059-1066.
Blatter, E. E., W. Ross, H. Tang, R. L. Gourse, and R. H. Ebright. 1994. Domain organisation of RNA-polymerase α subunit: C-terminal 85 amino acids constitute a domain capable of dimerization and DNA binding. Cell 78:889-896.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
Brennan, R. G., S. L. Roderick, Y. Takeda, and B. W. Matthews. 1990. ProteinDNA conformational changes in the crystal structure of a lambda Cro-operator
complex. Proc. Natl. Acad. Sci. USA 87:8165.
Brown, N. L., J. V. Stoyanov, S. P. Kidd, and J. L. Hobman. 2003. The MerR
family of transcriptional regulators. FEMS Microbiol. Rev. 27:145-163.
Browning, D. F., and S. J. W. Busby. 2004. The regulation of bacterial transcription initiation. Nature Microbiology Reviews 2:1-8.
Brussow, H., and R. W. Hendrix. 2002. Phage genomics: small is beautiful. Cell
108:13-16.
Burgin, A. B. J., and H. A. Nash. 1995. Suicide substrates reveal properties of the
homology-dependent steps during integrative recombination of bacteriophage λ.
Curr. Biol. 5:1312-1321.
Burr, T., J. Mitchell, A. Kolb, S. Minchin, and S. Busby. 2000. DNA sequence
elements located immideately upstream of the -10 hexamer in Escherichia coli promoters. Nucl. Acid Res. 28:1864-1870.
Busby, S., and R. H. Ebright. 1994. Promoter structure, promoter recognition, and
transcritpion activation in prokaryotes. Cell 79:743-746.
Bushman, W., J. F. Thompson, L. Vargas, and A. Landy. 1985. Control of
directionality in lambda site-specific recombination. Science 230:906-911.
Bushman, W., S. Yin, L. Thio, and A. Landy. 1984. Determinants of directionality in lambda site-specific recombination. Cell 39.
Calos, M. P., and A. C. Groth. 2004. Phage integrases: Biology and applications.
J. Mol. Biol 335:667-678.
Chattoraj, D. K. 1978. Strand specific break near origine of bacteriophage P2
DNA replication. Proc. Nat. Acad. Sci. USA 75:1685-1689.
Chen, J. W., J. Lee, and M. Jayaram. 1992. DNA cleavage in trans by the active
site tyrosine during Flp recombination. Cell 69:647-658.
Chen, Y., U. Narendra, L. E. Iype, M. M. Cox, and P. A. Rice. 2000. Crystal
structure of a Flp recombinase-holliday junctioncomplex: assembly of an active oligomer by helix swapping. Molecular Cell 6:885-897.
Cho, E. H., R. I. Gumport, and J. F. Gardner. 2002. Interactions between integrase and excisionase in the phage lambda excisive nucleoprotein complex. J. Bacteriol. 184:5200-5203.
Choy, H., and S. Adhya. 1996. In F. C. Neidhardt (ed.), Escherichia coli and Salmonella: Cellular and molecular biology. ASM Press, Washington.
Christie, G. E., and R. Calendar. 1990. Interactions between satellite bacteriophage P4 and its helpers. Annu. rev. Genet 24:465-490.
Conway, A. B., Y. Chen, and P. A. Rice. 2003. Structural plasticity of the Flpholliday junction complex. J. Mol. Biol 326:425-434.
Craig, N. L. 1988. The mechanism of conservative site specific recombination.
Annu. Rev. Genet.:77-105.
Craig, N. L., R. Craigie, M. Gellert, and A. M. Lambowitz. 2002. Mobile DNA.
ASM Press, Washington, D.C.
Dale, E. C., G. E. Christie, and R. Calendar. 1986. Organization and expression
of the satellite bacteriophage P4 late gene cluster. J. Mol. Biol. 192:793-803.
Darwin, A. J., and V. Stewart. 1996. p. 343-359. In E. C. C. Lin and A. S. Lynch
(ed.), Regulation of gene expression in E.coli. R.G. Landes, New York.
73
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
74
Demple, B. 1996. Redox signalling and gene control in the Escherichia coli soxRS
oxidative stress regulon-a review. Gene 179:53-57.
Dhar, G., E. R. Sanders, and R. C. Johnson. 2004. Architecture of the Hin synaptic complex during recombination: the recombinase subunits translocate with the
DNA strands. Cell 119:33-45.
Dixon, J. E., A. C. Shaikh, and P. D. Sadowski. 1995. The Flp recombinase
cleaves Holliday junctions in trans. Mol. Microbiol. 18:449-458.
Dodd, I. B., A. J. Perkins, D. Tsemitsidis, and J. B. Egan. 2001. Octamerization
of lambda CI repressor is needed for the effective repression of PRM and efficient
switching from lysogeny. Genes Dev. 15:3013-3022.
Dodd, I. B., K. E. Shearwin, and J. B. Egan. 2005. Revisited gene regulation in
bacteriophage lambda. Curr. Opin. Gen. Dev. 15:145-152.
Dove, S. L., F. W. Huang, and A. Hochschild. 2000. Mechanism for a transcriptional activator that works at the isomerization step. Proc. Nat. Acad. Sci USA
97:13215-13220.
Dove, S. L., J. K. Joung, and A. Hochschild. 1997. Activation of prokaryotic
transcription through arbitrary protein-protein contacts. Nature 386:627-630.
Ebright, R. H. 2000. RNA polymerase: structural similarities between bacterial
RNA polymerasae and eukaryotic RNA polymerase II. J. Mol. Biol 304:687-698.
Ebright, R. H. 1993. Transcription activtion at class I CAP-dependent promoters.
Mol. Microbiol. 8:797-802.
Eggleston, A. K., and S. C. West. 1996. Exchanging partners: recombination in E.
coli. Trends Genetics 12:20-25.
Esposito, D., and G. F. Gerard. 2003. The Escherichia coli Fis protein stimulates
bacteriophage lambda integrative recombination in vitro. J. Bacteriol. 185:30763080.
Esposito, D., and J. J. Scocca. 1997. The integrase family of tyrosine recombinases: evolution of a conserved active site domain. Nucleic Acids Res. 25:36053614.
Esposito, D., and J. J. Scocca. 1997. Purification and characterization of HP1 Cox
and definition of its role in controlling the direction of site-specific recombination.
Journal of Biological Chemistry 272:8660-8670.
Esposito, D., J. S. Thrower, and J. J. Scocca. 2001. Protein and DNA requirements of the bacteriophage HP1 recombination system: a model for intasome formation. Nucleic acids research 29:3955-3964.
Frumerie, C., L. Sylwan, A. Ahlgren-Berg, and E. Haggård-Ljungquist. 2005.
Cooperative interactions between bacteriophage P2 integrase and its accessory factors IHF and Cox. Virology 332:284-294.
Goodman, S. D., and H. A. Nash. 1989. Functional replacement of a proteininduced bend in a DNA recombination site. Nature 341:251-254.
Gopaul, D. N., F. Guo, and G. D. Van Duyne. 1998. Structure of holliday junction
intermediate in Cre-loxP site-specific recombination. EMBO J. 17:4175-4187.
Gopaul, D. N., and G. D. Van Duyne. 1999. Structure and mechanism in
site.specific recombination. Curr. Opin. Struct. Biol. 9:14-20.
Gourse, R. L., W. Ross, and T. Gaal. 2000. UPs and downs in bacterial transcription initiation: the role of the alpha subunit of RNA polymerasein promoter recognition. Mol. Microbiol. 37:687-695.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
Grindley, N. D. F., and R. R. Reed. 1985. Transpositional recombination in prokaryotes. Ann. Rev. Biochem. 54:863-896.
Guo, F., D. N. Gopaul, and V. D. G.D. 1997. Structure of Cre recombinase complexed with DNA in a site-specific recombination synapse. Nature 389:40-46.
Guo, F., D. N. Gopaul, and G. D. Van Duyne. 1999. Assymetric DNA bending in
the Cre-loxP site specific recombination system. Proc. Natl. Acad. Sci. USA
96:7143-7148.
Haggård-Ljungquist, E., A. Yu, and L. E. Bertani. 1994. Site-specific recombination in bacteriophage P2. Current Topics in Mol.Genet. (Life Sci. Adv.) 2:75-86.
Hakimi, J. M., and J. J. Scocca. 1994. Binding sites for bacteriophage HP1 integrase on its DNA substrates. J. Biol. Chem. 269:21340-21345.
Hallet, B., and SherratD.J. 1997. Transposition and site-specific recombination:
adapting DNA cut-and-paste mechanisms to a variety of genetic rearrangments.
FEMS Microbiol. Rev. 21:157-178.
Halling, C., and R. Calendar. 1990. Bacteriophage P2 ogr and P4 delta genes act
independently and are essential for P4 multiplication. J. Bact. 172:3549-3558.
Hampsey, M. 2001. Omega meets its match. Trends Genet. 17:190-191.
Hatful, G. F., and N. D. F. Grindley. 1988. Resolvases and DNA-invertases: a
family of enzymes active in site-specific recombination, p. 357-396. In R. S.
Kucherlapati, G.R. (ed.), Genetic recombination. American Societyfor Microbiology, Washington, DC.
Hazelbaker, D., M. Radman-Livaja, and A. Landy. 2005. Receipt of the Cterminal tail from a neighboring lambda Int protomer allostericalyy stimulates
Holliday junction resolution. J. Mol. Biol 351:948-955.
Helman, J. D., and P. L. deHaseth. 1999. Protein-nucleic acid interactions during
open complex formationinvestigated by systematic alteration of the protein and
DNA binding partners. Biochem. 38:5959-5967.
Hickman, A.B., S. Waninger, J. J. Scocca, and F. Dyda. 1997. Molecular organization in site-specific recombination: the catalytic domain of bacteriophage HP1 integrase at 2.7A resolution. Cell 89:227-237.
Hu, J. C., E. K. O´Shea, P. S. Kim, and R. T. Sauer. 1990. Sequence requirements for coiled-coils: analysis with repressor-GCN4 leucine zipper fusions. Science 250:1400-1403.
Hughes, R. E., G. F. Hatful, P. Rice, T. A. Steitz, and N. D. F. Grindley. 1990.
Cooperativity mutants of the γδ resolvase identify an essential interdimer interaction. Cell 63:1331-1338.
Hughes, R. E., P. Rice, T. A. Steitz, and N. D. F. Grindley. 1993. Protein-protein
interactions directing resolvase site-specific recombination: a structure-function
analysis. EMBO J. 12:1447-1458.
Hwang, E. S., and J. J. Scocca. 1990. Interaction of integration hast factor from
Escherichia coli with the integration region of the Haemophilus influenzae bacteriophage HP1. J. Bacteriol. 172:4852-4860.
Jain, D., B. E. Nickels, L. Sun, A. Hochschild, and S. A. Darst. 2004. Structure
of a ternary transcription activation complex. Molecular Cell 13:45-53.
Jana, R., T. R. Hazbun, J. D. Fields, and M. C. Mossing. 1998. Single chain
lambda Cro repressors confirm high intrinsic Dimer-DNA affinity. Biochemistry
37:6446-6455.
75
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
76
Jesaitis, M. A., and J. J. Hutton. 1963. Properties of a bacteriophage derived from
Escherichia coli K-235. J Exp. Med 117:285-302.
Jessop, L., T. Bankhead, D. Wong, and A. M. Segall. 2000. The amino terminus
of bacteriophage lambda integrase is involved in protein-protein interactions during
recombination. J. Bact. 182:1024-1034.
Johnson, R. C. 1995. Site-specific recombinases and their interactions with DNA.
In D. M. J. Lilley (ed.), DNA-protein: structural interactions. IRL Press at Oxford
University Press, Oxford, New York.
Kamadurai, H. B., S. Subramaniam, R. B. Jones, K. B. Green-Church, and M.
P. Foster. 2003. Protein folding coupled to DNA binding n the catalytic domain of
bacteriophage lambda integrase detected by mass spectrometry. Protein Science
12:620-626.
Kedzierska, B., D. J. Lee, G. Wegrzyn, S. J. W. Busby, and M. S. Thomas.
2004. Role of the RNA polymerase alpha subunit in cII-dependent activation of
bacteriophage lambda PRE promoter: identification of important residues and positioning of the alpha C-terminal domains. Nucleic Acids Research 32:834-841.
Kerszman, G., S. W. Glover, and J. Aronowitch. 1967. The restriction of bacteriophage lambda in Escherichia coli strain W. J. Gen. Virology 1:333-347.
Kim, J., C. Zwieb, C. Wu, and S. Adhya. 1989. Bending of DNA by generegulatory proteins: construction and use of a DNA bending vector. Gene 85:15-23.
Kim, S.-H., and A. Landy. 1992. Lambda Int protein bridges between higher oder
complexes at two distant chromosomal loci attL and attR. Science 256:198-203.
Korzheva, N., and et.al. 2000. A structural model for transcription elongation.
Science 289:619-625.
Kwon, H. J., R. S. Tirumalai, A. Landy, and T. Ellenberger. 1997. Flexibility in
in DNA recombination: structure of the lambda integrase. Science 276:126-131.
Landy, A. 1993. Mechanistic and structural complexíty in the site-specific recombinationpathways of Int and Flp. Curr. Opin. Gen. Dev. 3:699-707.
Lee, J., M. Jayaram, and I. Grainge. 1999. Wild-type Flp recombinase cleaves
DNA in trans. EMBO Journal 18:784-791.
Lewis, J. A., and G. F. Hatfull. 2003. Control of directionality in L5 integrasemediated site-specific recombination. J. Mol. Biol 326:805-821.
Lewis, J. A., and G. F. Hatfull. 2001. Control of the directionality in integrasemediated recombination: examination of recombination directionality factors
(RDFs) including Xis and Cox proteins. Nucleic Acids Research 29:2205-2216.
Lindqvist, B. H., G. Dehò, and R. Calendar. 1993. Mechanisms of genome
propagation and helper exploitation by satellite phage P4. Microbiological Reviews
57:683-702.
Lis, J., and C. Wu. 1993. Protein traffic on the heat shock promoter: parking,
stalling, and trucking along. Cell 74:1-4.
Liu, T., and E. Haggård-Ljungquist. 1999. The transcriptional switch of bacteriophage Wphi, a P2 related but heteroimmune coliphage. J. Virol. 73:9816-9826.
Liu, T., and S. K. Renberg. 1998. The E protein of satellite phage P4 acts as an
anti-repressor by binding to the C protein of helper phage P2. Mol. Microb.
30:1148-1155.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
Liu, T., S. K. Renberg, and E. Haggård-Ljungquist. 1997. Derepression of Prophage P2 by Satellite Phage P4: Cloning of the P4 ε gene and Identification of its
product. Journal of Virology 71:5402-5408.
Liu, Y., and E. Haggård-Ljungquist. 1994. Studies of bacteriophage P2 DNA
replication: localization of the cleavage site of the A protein. Nucleic Acids Research 22:5204-5210.
Ljungquist, E., and L. E. Bertani. 1983. Properties and products of the cloned int
gene of bacteriophage P2. Mol. Gen. Genet. 192:87-94.
Malan, T., A. Kolb, H. Buc, and W. McClure. 1984. Mechanism of CRP-cAMP
activation of lac operon transcription initiation activation of the P1 promoter. J.
Mol. Biol. 180:8881-909.
Marr, M. T., J. W. Roberts, S. E. Brown, M. Klee, and G. N. Gussin. 2004.
Interactions among cII protein, RNA polymerase and the lambda PRE promoter:
contacts between RNA polymerase and the -35 region of PRE are identical in the
presence and the abscence of cII protein. Nucleic Acids Research 32:1083-1090.
Matsuo, H., M. Shirikawa, and Y. Kyogoku. 1995. Three-dimensional dimer
structure of the lambda-Cro repressor in solution as determined by heteronuclear
multidimensional NMR. J. Mol. Biol 254:668-680.
Menendez, M., A. Kolb, and H. Buc. 1987. A new target for CRP action at the
malT promoter. EMBO J. 6:4227-4234.
Moitoso De Vargas, L., S. Kim, and A. Landy. 1989. DNA looping generated by
DNA bending protein IHF and the two domains of lambda integrase. Science
244:1457-1461.
Moitoso De Vargas, L., and A. Landy. 1991. A switch in the formation of alternative DNA loops modulates lambda site-specific recombination. Proc. Natl. Acad.
Sci. USA 88:588-592.
Moitoso de Vargas, L., C. A. Pargellis, N. M. Hasan, E. W. Bushman, and A.
Landy. 1988. Autonomous DNA binding domains of lambda integrase recognize
two different sequence families. Cell 54:923-929.
Morett, E., and E. Buck. 1989. In vivo studies on the interaction of RNA polymerase-sigma 54 with the Klebsiella pneumoniae and Rhizobium meliloti nifH
promoters. The role of NifA in the formation of an open promoter complex. Proc.
Natl. Acad. Sci. USA 85:9401-9405.
Muller-Hill, B. 1996. The Lac operon: a short history of the genetic paradigm.
Walter de Gruyter, New York.
Murakami, K. S., S. Masuda, E. A. Campbell, O. Muzzin, and S. A. Darst.
2002. Structural basis of transcription initiation: and RNA-polymerase holoenzymeDNA complex. Science 296:1285-1290.
Murakami, K. S., S. Masuda, and S. A. Darst. 2002. Structural basis of transcription initiation: RNA polymerase holoenzyme at 4Å resolution. Science 296:12801284.
Nash, H. A. 1996. Site-specific recombination. Integration, excision, resolution,
and inversion of defined DNA segments, p. 2363-2376. In F. C. Neidhardt, Curtiss,
R.I., Ingraham, J.L., Lin, E.C.C., Low, K.B. Magasanik, B., Reznikoff, W.S., Riley,
W, Schaechter, M. & UmbergerH.E. (ed.), Escherichia coli and Salmonella typhimurium. ASM Press, Washington.
77
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
78
Nickels, B. E., S. L. Dove, K. S. Murakami, S. A. Darst, and Hochschild. 2003.
Protein-protein and protein-DNA interactions of σ70 region 4 involved in transcription activation by lambda cI. J. Mol. Biol 324:17-34.
Nilsson, A., and E. Haggård-Ljungquist. 2005. The P2 like bacteriophages. In R.
Calendar (ed.), The bacteriophages. Oxford Press, Oxford.
Numrych, T. E., R. I. Gumport, and J. F. Gardner. 1992. Characterization of the
bacteriophage lambda excisionase (Xis) protein: the C-terminus is required for xisintegrase cooperativity but not for DNA binding. EMBO Journal 11:3797-3806.
Numrych, T. E., R. I. Gumport, and J. F. Gardner. 1992. A comparison of the
effects of single base and triple base changes in the integrase arm-type binding sites
on the site-specific recombination system of bacteriophage lambda. Nucleic Acids
Research 18:39-3959.
Numrych, T. E., R. I. Gumport, and J. F. Gardner. 1991. A genetic analysis of
Xis and Fis interactions with their binding sites in bacteriophage lambda. J. Bacteriol. 173:5954-5963.
Nunes-Düby, S. E., M. A. Azaro, and A. Landy. 1995. Swapping DNA and sensing homology without branch migration in λ site-specific recombination. Curr. Biol.
5:139-148.
Nunes-Düby, S. E., H. J. Kwon, R. S. Tirumalai, T. Ellenberger, and A. Landy.
1998. Similarities and differences among 105 members of the Int family of sitespecific recombinases. Nucleic Acids Res. 26:391-406.
Nunes-Düby, S. E., and A. Landy. 1997. Sensing homology at the strandswapping step in lambda excisive recombination. J. Mol. Biol. 272:493-508.
Nunes-Düby, S. E., R. Tirumalai, L. Dorgai, E. Yagil, R. A. Weisberg, and A.
Landy. 1994. Lambda integrase cleaves DNA in cis. EMBO Journal 13:4421-4430.
Odegrip, R., and E. Haggård-Ljungquist. 2001. The two active-site tyrosine
residues of the A protein play non-eqivalent roles during initiation of rolling circle
replication of bacteriophage P2. J. Mol. Biol 308:147-163.
Odegrip, R., S. Schoen, E. Haggård-Ljungquist, K. Park, and D. K. Chattoraj.
2000. The interaction of bacteriophage P2 B with Escherichia coli DnaB helicase. J.
Virol. 74:4057-4063.
Pargellis, C. A., S. E. Nunes-Düby, L. Moitoso de Vargas, and A. Landy. 1988.
Suicide recombination substrates yield covalent l integrase-DNA complexes and
lead to identification of the active site tyrosine. J. Biol. Chem. 263:7678-7685.
Pedulla, M. L., M. H. Lee, D. C. Lever, and G. F. Hatfull. 1996. A novel host
factor for integration of mycobacteriophage L5. Proc. Natl. Acad. Sci. USA
93:15411-15416.
Peña, C. E., J. M. Kahlenberg, and G. F. Hatfull. 2000. Assembly and activation
of site-specific recombination complexes. Proc. Natl. Acad. Sci. USA 97:77607765.
Peña, C. E., J. M. Kahlenberg, and G. F. Hatfull. 1999. Protein-DNA complexes
in mycobacteriophage L5 integrative recombination. J. Bacteriol. 181:454-461.
Peña, C. E., J. M. Kahlenberg, and G. F. Hatfull. 1998. The role of supercoiling
in mycobacteriophage L5 integrative recombination. Nucleic Acids Research
26:4012-418.
Peña, C. E., M. H. Lee, M. L. Pedulla, and G. F. Hatfull. 1997. Characterization
of the mycobacteriophage L5 attachment site, attP. J. Mol. Biol 266:76-92.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
Pérez-Martin, J., F. Rojo, and V. deLorenzo. 1994. Promoters responsive to
DNA bending: a common theme in procaryotic gene expression. Microbiological
Reviews 58:268-290.
Pizer, L. I., H. S. Smith, M. Miovic, and L. Pylkas. 1968. Effect of prophage W
on the propagation of bacteriophages T2 and T4. J. Virol. 2:1339-1345.
Ptashne, M. 1992. A genetic switch phage λ and higher organisms., second ed. Cell
Press & Blackwell Scientific Publications.
Ptashne, M. 2004. A genetic switch: Phage lambda revisited, 3rd ed. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, New York.
Ptashne, M., and A. Gann. 1997. Transcriptional activation by recruitment. Nature
386:569-577.
Radman-Livaja, M., C. Shaw, M. A. Azaro, T. Biswas, T. Ellenberger, and A.
Landy. 2003. Arm sequences contribute to the architecture and catalytic function of
a lambda integrase-Holliday junction complex. Molecular Cell 11:783-794.
Revet, B., B. von Wilcken-Bergmann, H. Bessert, A. Barker, and B. MullerHill. 1999. Four dimers of lambda repressor bound to tw suitable spaced pairs of
lambda operators form octamers and DNA loops over large distances. Curr. Biol.
9:151-154.
Richet, E., P. Abcarian, and H. A. Nash. 1988. Synapsis of attachment sites during lambda integrative recombination involves capture of naked DNA by a proteinDNA complex. Cell 52:9-17.
Richet, E., P. Abcarian, and H. A.-. Nash. 1986. The interaction of recombination
proteins with supercoiled DNA: defining the role of supercoiling in lambda integrative recombination. Cell 46:1011-1021.
Rivetti, C., M. Guthold, and C. Bustamante. 1999. Wrapping of DNA around the
E. coli RNA polymerase open promoter complex. EMBO J. 18:4464-4475.
Rohwer, F. 2003. Global phage diversity. Cell 113:141.
Rost, B., and C. Sander. 1994. Conservation and prediction of solvent accessibility. Proteins 20:216-226.
Rost, B., and C. Sander. 1993. Prediction of protin structure at better than 71 %
accuracy. J. Mol. Biol. 232:584-599.
Sadowsky, P. D. 1995. The Flp recombinsae of the 2 µm plasmid of Saccharomyces cerevisiae. Prog. Nucl.Acid Res. Mol. Biol. 51:53-91.
Saha, S., E. Haggård-Ljungquist, and K. Nordström. 1989. Activation of prophage P4 by the Cox protein and the sites of action of the Cox protein on the two
phage genomes. Proc. Nat. Acad. Sci. USA 86:3973-3977.
Saha, S., E. Haggård-Ljungquist, and K. Nordström. 1987. The Cox protein of
bacteriophage P2 inhibits the formation of the repressor protein and autoregulates
the early operon. EMBO J. 6:3191-3199.
Saha, S., B. Lundqvist, and E. Haggård-Ljungquist. 1987. Autoregulation of
bacteriophage P2 repressor. EMBO J. 6:809-814.
Sam, M. D., D. Cascio, R. C. Johnson, and R. T. Clubb. 2004. Crystal structure
of the excisionase-DNA complex from bacteriophage lambda. J. Mol. Biol 338:229240.
Sam, M. D., C. V. Papagiannis, K. M. Connolly, L. Corselli, J. Iwahara, J. Lee,
M. Phillips, J. M. Wojciak, R. C. Johnson, and R. T. Clubb. 2002. Regulation of
79
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
80
directionality in bacteriophage lambda site-specific recombination: structure of the
Xis protein. J. Mol. Biol 324:791-805.
Sarkar, D., M. A. Azaro, H. Aihara, C. V. Papagiannis, R. Tirumalai, S. E.
Nunes-Düby, R. C. Johnson, T. Ellenberger, and A. Landy. 2002. Differential
affinity and cooperativity functions of the amino terminal 70 residues of lambda integrase. J. Mol. Biol 324:775-789.
Sarkar, D., M. Radman-Livaja, and A. Landy. 2001. The small DNA binding
domain of lambda integrase is a context-sensitive modulator of recombinase functions. EMBO Journal 20:1203-1212.
Sasse-Dwight, S., and J. D. Gralla. 1988. Probing the Escherichia coli glnALG
upstream activation mechanism in vivo. Proc. Natl. Acad. Sci. USA 85:8934-8938.
Schnös, M., and R. B. Inman. 1971. Starting point and direction of replication in
P2 DNA. J. Mol. Biol. 55:31-38.
Schwartz, C. J. E., and P. D. Sadowsky. 1989. FLP recombinase of the 2 µm
plasmid of Saccharomyces cerevisiae bends its DNA target. J. Mol. Biol. 205:647658.
Severinov, K. 2000. RNA polymerase structure-function: insights into points of
transcriptional regulation. Curr Opin. Microb. 3:118-125.
Shaikh, A. C., and P. D. Sadowski. 1997. The Cre recombinase cleaves the lox
site in trans. J. Biol. Chem. 272:5695-5702.
Shearwin, K. E., and J. B. Egan. 1996. Purification and self-association equilibria
of the lysis-lysogeny switch proteins of coliphage 186. Journal of Biological Chemistry 271:11525-11531.
Sherrat, D. J., and D. B. Wigley. 1998. Conserved themes but novel activities in
recombinases and topoisomerases. Cell 93:149-152.
Shin, M., S. Kang, S. Hyun, N. Fujita, A. Ishihama, P. Valentin-Hansen, and H.
Choy. 2001. Repression of deoP2 in Escherichia coli by CytR: conversion of a transcription activator into a repressor. EMBO Journal 20.
Shinagawa, H., and H. Iwasaki. 1996. Processing the holliday junction in homologous recombination. Trends. Biol. Sci. 21:107-111.
Smith, M. C. M., and H. M. Thorpe. 2002. Diversity in the serine recombinases.
Molecular Microbiology 44:299-307.
Stark, W. M., M. R. Boocock, and D. J. Sherrat. 1992. Catalysis by site-specific
recombinases. Trends Genet. 8:432-439.
Stark, W. M., D. J. Sherrat, and M. R. Boocock. 1989. Site-specific recombination by Tn3 resolvase: topological changes in the forward and reverse reactions.
Cell 58:779-790.
Stewart, L., M. R. Redinbo, X. Qiu, W. G. Hol, and J. J. Champoux. 1998. A
model for the mechanism of human topoisomerase I. Science 279:1534-1541.
Straney, S. B., and D. M. Crothers. 1987. Lac repressor is a transient geneactivating protein. Cell 51:699-707.
Subramaniam, S., A. Tewari, S. E. Nunes-Düby, and M. P. Foster. 2003. Dynamics and DNA substrate recognition by the Catalytic domain of lambda integrase.
J. Mol. Biol 329:423-439.
Subramanya, H. S., L. K. Arciszewska, R. A. Baker, L. E. Bird, D. J. Sherrat,
and D. B. Wigley. 1997. Crystal structure of the site-specific recombinase, XerD.
EMBO J. 16:5178-5187.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
172.
173.
174.
175.
176.
Swalla, B. M., E. H. Cho, R. I. Gumport, and J. F. Gardner. 2003. The molecular basis of co-operative DNA binding between lambda integrase and excisionase.
Molecular Microbiology 50:89-99.
Swalla, B. M., R. I. Gumport, and J. F. Gardner. 2003. Conservation of structure
and function among tyrosine recominases: homology-based modeling of the lambda
integrase core-binding domain. Nucleic Acids Research 31:805-818.
Svenningsen, S., N. Costantino, D. L. Court, and S. Adhya. 2005. On the role of
Cro in lambda prophage induction. Proc. Nat. Acad. Sci USA 102:4465-4469.
Tekle, M., D. J. Warren, T. Biswas, T. Ellenberger, A. Landy, and S. E. NunesDüby. 2002. Attenuating functions of the C-terminus of lambda integrase. J. Mol.
Biol 324:649-665.
Thompson, J. F., and A. Landy. 1988. Empirical estimation of protein-induced
DNA bending angles: applications to lambda site-specific recombination complexes. Nucleic Acd Research 16:9687-9705.
Thompson, J. F., L. Moitoso De Vargas, C. Koch, R. Kahmann, and A. Landy.
1987. Cellular factors couple recombination with growth phase: characterization of
a new component in the lambda site-specific recombination pathway. Cell 50:901908.
Thompson, J. F., L. Moitoso De Vargas, S. E. Skinner, and A. Landy. 1987.
Protein-protein interactions in a higher order structure direct lambda site-specific
recombination. J. Mol. Biol 195:481-493.
Tirumalai, R. S., H. J. Kwon, E. H. Cardente, T. Ellenberger, and A. Landy.
1998. Recognition of core-type sites by lambda integrase. J. Mol. Biol 279:513-527.
Tsujikawa, L., O. V. Tsodikov, and P. L. deHaseth. 2002. Interaction of RNA
polymerase with forked DNA: evidence for two kinetically significant intermediates
on the pathway to the final complex. Proc. Natl. Acad. Sci. USA 99:3493-3498.
Wagner, R. 2000. Transcription regulation in prokaryotes. Oxford University Press
Inc., New York.
van der Vliet, P. C., and C. P. Verrijzer. 1993. Bending of DNA by transcription
factors. BioEssays 15:25-32.
Van Duyne, G. D. 2002. A structural view of tyrosine recombinase site-specific
recombination. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.),
Mobile DNA II. ASM Press, Washington D.C.
Warren, D., M. D. Sam, K. Manley, D. Sarkar, S. Y. Lee, M. Abbani, J. M.
Wojciak, R. T. Clubb, and A. Landy. 2003. Indentification of the lambda integrase surface that interacts with Xis reveals a residue that is also critical for Int
dimer formation. Proc. Natl. Acad. Sci. USA 100:8176-8181.
Wasserman, K. M., F. Repoila, C. Rosenow, G. Storz, and S. Gottesman. 2001.
Identification of novell small RNAs using comparative genomics and microarrays.
Genes Dev. 15:1637-1651.
Vassylyev, D. G., and et.al. 2002. Crystal structure of a bacterial RNA polymerase
holoenzyme at 2.6 Å resolution. Nature 417:712-719.
Williams, K. P. 2002. Integration sites for genetic elemnts in prokaryotic tRNA and
tmRNA genes: sublocation preference of integrase subfamilies. Nucleic Acids Research 30:866-875.
81
177.
178.
179.
180.
181.
182.
183.
184.
185.
186.
82
Wojciak, J. M., D. Sarkar, A. Landy, and R. T. Clubb. 2002. Arm-site binding
by lambda integrase: solution structure and functional characterization of its aminoterminal domain. Proc. Natl.Acad. Sci. USA 99:3434-3439.
Voziyanov, Y., S. Pathania, and M. Jayaram. 1999. A general model for site
specific recombination by the integrase family of recombinases. Nucleic Acids Research 27:930-941.
Wu, H.-M., and D. M. Crothers. 1984. The locus of sequence-directed and protein-induced DNA bending. Nature 308:508-514.
Wösten, M. M. S. M. 1998. Eubacterial sigma factors. FEMS Microbiol. Rev.
22:127-150.
Yin, S., W. Bushman, and A. Landy. 1985. Interaction of the lambda site-specific
recombination protein Xis with attachment site DNA. Proc. Natl. Acad. Sci. USA
82:1040-1044.
Yu, A., V. Barreiro, and E. Haggård-Ljungquist. 1994. Regulation of int gene
expression in bacteriophage P2. Journal of Virology 68:4220-4226.
Yu, A., L. E. Bertani, and E. Haggård-Ljungquist. 1989. Control of prophage
integration and excision in bacteriophage P2: nucleotide sequences of the int gene
and att sites. Gene 80:1-12.
Yu, A., and E. Haggård-Ljungquist. 1993. Characterization of the binding sites of
two proteins involved in the bacteriophage P2 site-specific recombination system.
Journal of Bacteriology 175:1239-1249.
Yu, A., and E. Haggård-Ljungquist. 1993. The Cox protein is a modulator of
directionality in bacteriophage P2 site-specific recombination. Journal of Bacteriology 175:7848-7855.
Zeng, X., and J. C. Hu. 1997. Detection of tetramerization domains in vivo by
cooperative DNA binding to tandem lambda operator sites. Gene 185:245-249.