Download Physiologia Plantarum

Copyright ª Physiologia Plantarum 2007, ISSN 0031-9317
Physiologia Plantarum 129: 737–746. 2007
Transcriptional regulation of host enzymes involved in the
cleavage of sucrose during arbuscular mycorrhizal symbiosis
Sonia Garcı́a-Rodrı́guez, Concepción Azcón-Aguilar and Nuria Ferrol*
Departamento de Microbiologı́a del Suelo y Sistemas Simbióticos, Estación Experimental del Zaidı́n, Consejo Superior de Investigaciones Cientı́ficas,
C. Profesor Albareda 1, 18008 Granada, Spain
Correspondence
*Corresponding author,
e-mail: [email protected]
Received 17 July 2006; revised 18 October
2006
doi: 10.1111/j.1399-3054.2007.00873.x
To investigate plant carbon metabolism in arbuscular mycorrhizas, we have
analyzed expression of the tomato invertase (EC 3.2.1.26) gene family
members and the sucrose synthase (EC 2.4.1.13) gene TOMSSF in roots of
non-mycorrhizal, Glomus mosseae- and Glomus intraradices-colonized plants.
Furthermore, root soluble carbohydrate contents have been determined. Gene
expression analyses showed that the cell wall invertase Lin6, the vacuolar
invertase TIV1 and TOMSSF were upregulated in mycorrhizal roots and that
this effect was caused by a direct effect of the colonization by the arbuscular
mycorrhizal (AM) fungi and not mediated by an improved phosphorus
nutrition. This study shows for the first time upregulation of a cell wall invertase
gene in an AM association, which supports the general assumption that carbon
transfer across the symbiotic interface requires host sucrose hydrolysis by a cell
wall invertase. Transcriptional upregulation of sucrose-splitting enzymes
during early colonization development agrees with the decreased levels of
sucrose detected in these roots. Mycorrhizal plants had lower root glucose and
fructose concentrations, which indicate consumption of the products of
sucrose breakdown. The promoter sequences of Lin6, TIV1 and TOMSSF were
analyzed in silico to get insights into the causes of their transcriptional
activation in mycorrhizal roots. Upregulation of Lin6, TOMSSF and TIV1
expressions by salicylic acid and of TOMSSF and TIV1 by abscisic acid suggest
that these compounds might mediate upregulation of these genes in
mycorrhizal roots.
Introduction
Arbuscular mycorrhizal (AM) fungi belong to the phylum Glomeromycota (Schüßler et al. 2001) and form
mutualistic symbioses with the roots of the majority of
terrestrial plants. These fungi biotrophically colonize the
cortex of the root to obtain carbon compounds from the
host plant while assisting the plant with the supply of
phosphate and other mineral nutrients that the external
mycelium takes up from the soil (Harley and Smith 1983).
AM fungi form asexual spores able to germinate in the
absence of any host plant and able to produce a limited
mycelium at the expenses of the spore reserves; however,
they can only complete their life cycle after colonization
of a host root (Azcón-Aguilar et al. 1998). Although the
reasons for the obligate biotrophy of AM fungi are
unknown, it is believed that the fungus, during the long
evolution of its symbiotic relationship with the host plant
(more than 450 million years), lost some of the carbon
acquisition capabilities needed for saprophytic growth
and became completely dependent on the host plant
Abbreviations – ABA, abscisic acid; AM, arbuscular mycorrhizal; P, phosphorus; PCR, polymerase chain reaction; pI, isoelectric
point; RT, reverse transcription; RT–PCR, reverse transcription–polymerase chain reaction; SA, salicylic acid.
Physiol. Plant. 129, 2007
737
for fixed carbon supply. Therefore, the AM symbiosis
represents an additional carbon demand to the photosynthetic organs, which adds to the demand of the root
sink. Measurements of carbon flux indicate that mycorrhizal plants direct from 4 to 20% more photoassimilates
to the root system than non-mycorrhizal plants (Graham
2000, Jakobsen and Rosendahl 1990, Pearson and
Jakobsen 1993).
Utilization of sucrose, the major long-distance transport form of fixed carbon in higher plants, as a source of
carbon and energy by sink tissues depends on its cleavage
into hexoses either by a sucrose synthase (EC 2.4.1.13) or
an invertase (EC 3.2.1.26). Sucrose synthase is a cytoplasmic enzyme that catalyzes the reversible hydrolysis of
sucrose to yield UDP-glucose and fructose, and two or
more closely related isoforms of this enzyme have been
identified in most plants (Sturm et al. 1999). This enzyme
is assumed to be important for synthesizing storage
compounds (Weber et al. 1996) and for determining sink
strength in association with symplastic unloading via
plasmodesmata (Koch 2004). Invertases catalyze the
irreversible hydrolysis of sucrose to glucose and fructose.
Based on their solubility, subcellular localization, optimum pH and isoelectric point (pI), three different types of
invertase isozymes can be distinguished: vacuolar (acidic
pH – optimum, neutral pI and vacuolar localization), cellwall-bound (acidic pH – optimum, basic or neutral pI
and apoplastic localization) and cytoplasmic invertases
(neutral or alkaline pH – optimum, neutral pI and cytoplasmic localization) (Avigad 1982). Extracellular and
vacuolar invertase isozymes are key metabolic enzymes
that are involved in regulating carbohydrate partitioning,
developmental processes, hormone responses, biotic
interactions and responses to abiotic stresses; however,
the function of the cytosolic isoform is currently unknown
(Roitsch and González 2004, Sturm 1999).
Studies using in vivo nuclear magnetic resonance
coupled with isotopic labeling in AM roots (Shachar-Hill
et al. 1995) and radiorespirometry measurements on
isolated intraradical hyphae (Solaiman and Saito 1997)
have shown that the internal phase of the AM fungus can
only take up and use hexoses, mainly glucose. Therefore,
it is assumed that in AM symbioses, sucrose is delivered
into the apoplast at the plant–fungus interfaces and
hydrolyzed via cell wall invertases. The resulting hexoses
are then taken up by the fungus as well as by the plant root
cells. Accumulation of sucrose synthase and vacuolar
invertase transcripts in arbuscule-colonized and the
surrounding cortical cells have led to hypothesize that
these enzymes provide metabolites and generate sink
strength during the active phase of the mycorrhizal symbiosis (Blee and Anderson 2002, Hohnjec et al. 2003).
However, there is no experimental evidence about the
738
role of cell-wall-bound invertases in the symbiosis.
Blee and Anderson (2002) found that a carrot cell wall
invertase gene was not expressed in cortical cells containing arbuscules, but it cannot be excluded that other
cell wall invertase isoforms are upregulated by the AM
symbiosis. To get further insights into the regulation
of host carbon metabolism by the symbiosis, we have
analyzed in roots of plants colonized by Glomus mosseae
or Glomus intraradices transcriptional regulation of all
tomato invertase and sucrose synthase genes present in
the database.
Materials and methods
Plant materials
Tomato seeds (Solanum lycopersicum, formerly Lycopersicon esculentum Mill, cv 76R; Peto Seed Company,
Woodland, CA) were surface sterilized and sown in
autoclaved vermiculite. Plantlets were transplanted to
500-ml pots when the first true leaf was expanded. Pots
contained a sterile mixture of soil and sand (1:2, v/v).
Plants were grown in a greenhouse with 16-h photoperiod, 25/18C day/night temperature and 60% relative
humidity. They were watered three times per week with
half-strength Hoagland nutrient solution (Hoagland and
Arnon 1938), with different phosphorus content.
The treatments applied were as follows: non-inoculated control plants fed with nutrient solution containing
20, 100 or 500 mM KH2PO4 and plants inoculated with
the AM fungus G. mosseae (Nicol. and Gerd.) Gerd and
Trappe BEG119 or G. intraradices Smith and Schenck
BEG123. All treatments had five replicates. Plants
inoculated with the AM fungi were watered with nutrient
solution containing 20 mM KH2PO4. Mycorrhizal inoculation was performed as described by Benabdellah et al.
(1999) using a sand–vermiculite-based inoculum of the
AM fungi. Control plants received an aliquot of a filtrate
(<20 mm) of both AM inocula to provide the microbial
populations accompanying the mycorrhizal inocula but
free from AM propagules. Plants were harvested 4 and 6
weeks after inoculation with the AM fungi. After fresh
weight determination of shoots and roots, root samples
were frozen in liquid nitrogen and stored at 280C.
Mycorrhizal development was estimated in root samples
after trypan blue staining (Phillips and Hayman 1970),
using the Giovannetti and Mosse (1980) method.
For treatments with phytohormones and sugars, the
standard protocol and concentrations described in the
literature were used (Rausch and Grenier 2004, Sinha
et al. 2002). Briefly, 25-day-old seedlings grown in sterile
vermiculite and watered with half-strength Hoagland
nutrient solution were transferred to Falcon tubes
Physiol. Plant. 129, 2007
containing nutrient solution supplemented with H2O
(control), 100 mM abscisic acid (ABA), 100 mM salicylic
acid (SA), 40 mM glucose or 20 mM sucrose. Roots were
harvested 12 and 24 h after the treatment, frozen in liquid
nitrogen and stored at 280C.
RNA isolation and gene expression analyses
Total RNA was isolated from frozen roots of 4- and 6week-old plants and of hormone- and sugar-treated plantlets by phenol/chloroform extraction (Kay et al. 1987).
Lin5 (accession number X91389), Lin6 (AB004583),
Lin7 (X91391), Lin8 (X91392), TIV1 (AF4656131) and
TOMSSF (L19762) gene expressions were studied by
real-time reverse transcription–polymerase chain reaction (RT–PCR) using iQ-Cycler (Bio-Rad, Hercules, CA).
cDNAs were obtained from 1 mg of total DNase-treated
RNA from the different treatments in a 20-ml reaction
containing 200 U SuperScript II RNase H2 Reverse Transcriptase (Invitrogen, Groningen, The Netherlands), 5 mM
random hexamer primers, 0.5 mM each deoxyribonucleotide triphosphate (dNTP), 20 U RNase inhibitor and 1X
reverse transcription (RT) buffer. Each 25-ml polymerase
chain reaction (PCR) reaction contained 1 ml of a dilution
1:10 of the cDNA, 200 mM dNTPs, 200 nM each primer,
3 mM MgCl2, 2.5 ml 1X SyBR Green (Molecular Probes,
Eugene, OR) and 0.5 U Platinum Taq DNA polymerase
(Invitrogen, Carlsbad, CA) in 1X PCR buffer (20 mM Tris–
HCl pH 8.4, 50 mM KCl). The gene-specific primers used
for the different genes are listed in Table 1. The PCR
program consisted of 5 min of incubation at 95C to
activate the hot-start recombinant Taq DNA polymerase,
followed by 35 cycles of 30 s at 95C, 45 s at 58C and 45 s
at 70C, where the fluorescence signal was measured. The
Table 1. List of primers used in this study
Primer
Sequence
Lin5F
Lin5R
Lin6F
Lin6R
Lin7F
Lin7R
Lin8F
Lin8R
TIV1F
TIV1R
TOMSSFF
TOMSSFR
R1
R2
PSS
GGTACTTGGTCTGGATCATCAACT
TCTCAATCCCTTCCAACCATCAATT
AGCACATTTATTCAGCACATTTATTCGCCTTCAACAA
TTTGTGACGTGGCATAATAAGAT
GAACCTGCAATTTACCCATCAAAGCC
AAGTCTCAACCCCTTCCAACCATCGA
CAAAACTATGCAATCCCAGCG
CAATGACCATCCTGACCCAAC
TCCGCCTCTCGTTACACATTACTC
CGGTGACTGGTTGTTGAGGATAGG
GGATTGAAAGCCACGGAAAAGG
ACCAGGCCTCAAACGAATAGCA
AAAAGGTCGACGCGGGCT
CGACAGAAGGGACGAGAC
CATTCAGTTTGTCTTTGTCATCTTGG
Physiol. Plant. 129, 2007
specificity of the PCR amplification procedure was
checked with a heat dissociation protocol (from 70C
to 100C) after the final cycle of the PCR. The efficiency of each primer set was evaluated by performing
real-time PCR on several dilutions of tomato genomic
DNA. In all cases, the results obtained for the different
treatments were standardized to the 18S rRNA levels,
which were amplified with the tomato-specific primers
R1 and R2 (Table 1). Real-time PCR determinations
were performed on three independent biological
replicates. Three technical replicates for each biological sample were included. The relative levels of
transcription were calculated using the 22DDCt method
(Livak and Schmittgen 2001). In all RT–PCR reactions,
a non-RT control was used to detect any possible DNA
contamination.
Carbohydrate analysis
Carbohydrates were extracted from approximately 1 g of
frozen roots as described by Bligh and Dyer (1959). The
methanolic extract was evaporated to dryness and
re-dissolved in sterile water. The contents of sucrose,
glucose and fructose were estimated by enzyme-coupled
reactions using the Sucrose/D-Glucose/D-Fructose kit
(r-biopharm, Darmstadt, Germany), as described by the
manufacturer.
Isolation of TOMSSF promoter
To isolate the 5# non-coding sequence of TOMSSF, four
GenomeWalker libraries were constructed using the
GenomeWalker kit (Clontech, Palo Alto, CA) according
to the manufacturer’s manual. Tomato genomic DNA
was extracted from frozen tomato leaves (Murray and
Thompson 1980) and digested to blunt ends with DraI,
EcoRV, PvuII and StuI. Each pool of DNA fragments
was then ligated to the GenomeWalker Adaptor, and
upstream genomic regions were amplified from each
library using a nested adaptor primer and the genespecific primer PSS (Table 1). PCR products were cloned
in the TA Cloning kit (Invitrogen, Carlsbad, CA) and
sequenced. Promoter sequences were screened for the
presence of cis-regulatory elements using PLACE (Higo
et al. 1999) and PlantCARE programs (Lescot et al.
2002).
Statistical analyses
Plant growth data were subjected to ANOVA, followed
by the Fisher’s protected least significant test when
appropriate.
739
Results
AM colonization and plant growth
Mycorrhizal colonization and growth of the tomato
plants used for gene expression analyses are shown in
Table 2. Although mycorrhizal colonization was low
4 weeks after inoculation, all characteristic fungal structures were present in both G. mosseae- and G. intraradicescolonized tissues. Two weeks later, the percentage of
root colonization was considerably higher, reaching 30
and 38% for G. mosseae- and G. intraradices-inoculated
plants, respectively. To make realistic comparisons
between mycorrhizal and non-mycorrhizal plants, it is
important to verify that the different sets of plants have
comparable growth characteristics. As shown in Table 2,
growth of non-mycorrhizal plants was clearly limited
by phosphorus supply. Four weeks after inoculation,
G. mosseae-colonized plants performed slightly, but
significantly, better than G. intraradices-colonized plants;
however, no significant differences were found between
both mycorrhizal plants 2 weeks later. At both harvest
times, growth of G. mosseae- and G. intraradicescolonized plants were more similar to those of nonmycorrhizal plants fed with 500 mM P than with lower
phosphorus levels. Therefore, gene expression levels in
mycorrhizal plants were compared with those of nonmycorrhizal plants fed with 500 mM P.
Regulation of tomato invertase genes by
the AM symbiosis
Expression of the five tomato invertase genes Lin5, Lin6,
Lin7 and Lin8 encoding cell wall isozymes (Godt and
Roitsch 1997) and TIV1 encoding a vacuolar invertase
(Klann et al. 1992) was assessed by real-time RT–PCR in
RNA isolated from non-mycorrhizal and mycorrhizal
roots. All primer sets used in this study amplified tomato
genomic DNA. However, Lin6 was the only cell wall
invertase gene detected in cDNA from mycorrhizal and
non-mycorrhizal tomato roots (data not shown), which
agrees with previous observations by Godt and Roitsch
(1997) in roots of non-mycorrhizal tomato plants. Lin6
mRNA levels were higher in symbiotic than in control
roots at both harvest times. Upregulation of Lin6
gene expression was similar in G. mosseae- than in
G. intraradices-colonized roots (Fig. 1A).
As shown in Fig. 1B, TIV1 gene expression was regulated by the development of the symbiosis. Four weeks
after inoculation, TIV1 mRNA levels were similar in
control and in G. mosseae- or G. intraradices-colonized
roots. However, 2 weeks later, upregulation of TIV1
mRNA levels was observed in mycorrhizal roots, with
the increase being significantly higher in G. mosseaecolonized (4.4-fold) than in G. intraradices-colonized
(2.2-fold) roots.
Expression analysis of a tomato sucrose
synthase gene
The relative transcript abundance of the tomato sucrose
synthase gene TOMSSF (Wang et al. 1993) was also
investigated in mycorrhizal and non-mycorrhizal
roots. In relation to non-mycorrhizal roots, the transcript levels of TOMSSF were slightly but consistently
increased in both G. mosseae- and G. intraradicescolonized roots at the first harvest time (4 weeks after
inoculation). Two weeks later, 5.7- and 4.5-fold
increases in TOMSSF mRNA levels were detected in
the roots colonized by G. intraradices or G. mosseae,
respectively (Fig. 2).
Table 2. Shoot and root fresh weight and mycorrhizal colonization of tomato plants subjected to different phosphate (20, 100 or 500 mM P) and
mycorrhizal (20 mM P and inoculated with G. mosseae or G. intraradices) treatments after a growing period of 4 (first harvest) or 6 (second harvest) weeks
after transplanting. Data in the same column sharing a letter in common do not differ significantly (P 0.05) according to Fisher’s least significant
difference test.
First harvest
Second harvest
Fresh weight (g)
Plant treatments
Phosphorus (mM)
20
100
500
Mycorrhizal
G. mosseae
G. intraradices
740
Fresh weight (g)
Shoots
Roots
0.50 a
1.35 b
5.14 c
0.20 a
0.57 b
2.03 cd
7.35 d
5.60 c
2.79 d
1.51 c
Shoots
Roots
Mycorrhizal
colonization (%)
0a
0a
0a
0.55 a
8.89 b
18.19 d
0.21 a
3.75 b
5.61 c
0a
0a
0a
10 b
14 b
15.25 c
14.88 c
7.35 c
5.60 c
30 b
38 c
Mycorrhizal
colonization (%)
Physiol. Plant. 129, 2007
Fold change in TOMSSF expression
Fold change in Lin6 expression
A
5
4
3
2
1
5
4
3
2
1
0
C1
0
C1
C2
Gi
Gm
C1
4 weeks
C2
Gi
Gm
C2
Gi
4 weeks
Gm
C1
C2
Gi
Gm
6 weeks
6 weeks
Fig. 2. Effect of mycorrhizal colonization and P fertilization on sucrose
synthase (TOMSSF) gene expression in tomato roots. RNAs were extracted
from roots of non-mycorrhizal tomato plants fed with 100 (C1) or 500 mM
P (C2) and from G. intraradices (Gi) or G. mosseae (Gm) mycorrhizal plants
harvested 4 and 6 weeks after inoculation with the AM fungi. RNAs were
reverse transcribed, and the expression levels were determined by
quantitative real-time RT–PCR using gene-specific primers for TOMSSF
and 18S rRNA. The relative levels of transcription were calculated by the
22DDCt method using the 500 mM P-fed plants as calibrator. Data
represent the average of three independent biological replicates. Error
bars represent SD.
B
Fold change in TIV1 expression
6
5
4
3
2
1
and TOMSSF mRNA levels in mycorrhizal roots is not
mediated by an improved phosphorus nutrition.
0
C1
C2
Gi
4 weeks
Gm
C1
C2
Gi
Gm
6 weeks
Fig. 1. Effect of mycorrhizal colonization and P fertilization on the
expression of genes encoding (A) cell wall (Lin6) and (B) vacuolar (TIV1)
invertases in tomato roots. RNAs were extracted from roots of nonmycorrhizal tomato plants fed with 100 (C1) or 500 mM P (C2) and from
G. intraradices (Gi) or G. mosseae (Gm) mycorrhizal plants harvested 4
and 6 weeks after inoculation with the corresponding AM fungus. RNAs
were reverse transcribed, and the expression levels were estimated by
quantitative real-time RT–PCR using gene-specific primers for Lin6, TIV1
and 18S rRNA. The relative levels of transcription were calculated by the
22DDCt method using the 500 mM P-fed plants as calibrator. Data
represent the average of three independent biological replicates. Error
bars represent SD.
Regulation of tomato invertase and sucrose
synthase genes by phosphorus
To determine if regulation of the investigated genes was
because of a direct effect of the colonization of the roots
by the AM fungi or because of an indirect effect through
an improvement in phosphorus nutrition, expression
level of these genes was determined in roots of nonmycorrhizal plants fed with 100 or 500 mM P. As shown
in Figs 1 and 2, Lin6, TIV1 and TOMSSF mRNA levels
showed no significant changes in response to phosphate.
This indicates that the observed increase in Lin6, TIV1
Physiol. Plant. 129, 2007
Effect of mycorrhizal colonization on root soluble
carbohydrate content
The levels of sucrose, glucose and fructose in control and
mycorrhizal roots were determined to try to correlate the
observed changes in gene expression of the analyzed
sucrose-cleaving enzymes with the carbohydrate status
of the roots. Four weeks after inoculation, root sucrose
concentration was lower in mycorrhizal plants (colonized either with G. mosseae or G. intraradices) than
that in control plants. However, no statistically significant differences in sucrose levels were found between
G. mosseae-colonized and non-mycorrhizal plants 2
weeks later (Fig. 3). At the two time points analyzed, the
concentrations of glucose and fructose were significantly
lower in both G. mosseae- and G. intraradices-colonized
roots than in those of non-mycorrhizal plants.
Possible regulatory elements in the promoter
sequences of Lin6, TIV1 and TOMSSF
To get some insights into the causes of the transcriptional
activation of Lin6, TIV1 and TOMSSF in mycorrhizal
plants, their promoter sequences were screened for the
741
Regulation of tomato invertase and sucrose
synthase genes by sugars and hormones
3
mg g–1 fresh weight
C
Gi
Gm
2
1
4 weeks 6 weeks 4 weeks 6 weeks
Sucrose
Glucose
4 weeks
6 weeks
Fructose
Fig. 3. Sucrose, glucose and fructose content of non-mycorrhizal and
mycorrhizal roots. Carbohydrates were extracted from roots of nonmycorrhizal tomato plants fed with 500 mM P (C), G. intraradices (Gi) and
G. mosseae (Gm) mycorrhizal plants harvested 4 and 6 weeks after
inoculation with the AM fungi. Data represent the average of three
independent biological replicates. Error bars represent SD.
To validate the in silico analysis of Lin6, TIV1 and
TOMSSF promoters, expression of these genes was
analyzed in roots of tomato plantlets exposed for 12
and 24 h to glucose, sucrose, ABA or SA, substances that
have been shown to be involved in signal transduction
pathways in plants and in mycorrhiza formation. Application of 100 mM ABA resulted in an elevated level of
mRNA for the sucrose synthase TOMSSF and for the
vacuolar invertase TIV1. In contrast, the mRNA levels for
the cell wall invertase Lin6 were not changed in response
to ABA (Fig. 4). External application of SA and glucose
increased the expression level of the three analyzed
sucrose-cleaving enzymes, while the application of
sucrose only increased the expression level of Lin6 and
TOMSSF. These data are in agreement with the in silico
analysis of the 5#-flanking regions of these genes.
Discussion
presence of regulatory elements with similarity to known
cis-acting elements via sequence alignments. For this
purpose, the promoter sequences of Lin6 (accession
number AF506004) and TIV1 (Z12027) were retrieved
from Genebank, and the putative TOMSSF promoter
(AM408346) was isolated by PCR amplification from an
adapter-ligated genomic tomato library. Comparison of
this genomic sequence (3395 bp upstream of the translation initiator ATG) with TOMSSF cDNA showed the
presence of a long (1573 bp) leader intron in the 5#
untranslated region, which is a typical feature of sucrose
synthase genes (Fu and Park 1995). The 5#-flanking
regions of Lin6, TIV1 and TOMSSF contained several core
elements identical to the root-specific element ATATT
(Elmayan and Tepfer 1995), the consensus sequence
motifs of the organ-specific elements OSE1 (AAAGAT)
and OSE2 (CTCTT) characteristic of promoters activated
in infected cells of root nodules (Stougaard et al. 1987)
and several motifs with similarity to hormone-specific
elements. The Wbox (TTGAC) found in the promoters of
SA-responsive genes (Yu et al. 2001) was identified in the
5#-flanking regions of the three genes. ABA-response
elements were also found in the promoter sequences of
TIV1 and TOMSSF (Abe et al. 2003, Hattori et al. 1995).
While the ABA cis-acting element MYCR (CACATG) was
found in both promoters, the ABRE motif (ACGTG) was
only identified in TOMSSF. Lin6 and TOMSSF promoters
also contained the sucrose-responsive element SURE1
(AATAGAAAA), recognized as a conserved motif among
a number of sucrose-responsive genes (Grierson et al.
1994).
742
In this article, we report that development of the AM
symbiosis induces upregulation of genes encoding the
cell wall invertase Lin6, the vacuolar invertase TIV1 and
the sucrose synthase TOMSSF in tomato roots.
Plants have evolved a small family of acid invertase
genes, the members of which are expressed independently at specific times and in specific tissues during plant
development. The finding that of the four genes encoding
tomato cell wall invertases, only Lin6, the isoform
constitutively expressed in tomato roots, was detected
in mycorrhizal roots indicates that development of the
symbiosis does not induce the synthesis de novo of
a previously reported cell wall invertase isoform (Godt
and Roitsch 1997). Upregulation of Lin6 mRNA levels in
mycorrhizal roots is consistent with the results of Wright
et al. (1998), who reported higher cell wall invertase
activity in mycorrhizal clover plants compared with
non-mycorrhizal plants. In a previous study, Blee and
Anderson (2002) failed to detect increased transcript
levels of a cell wall invertase in mycorrhizal carrot roots.
However, it is necessary to keep in mind that cell wall
invertases are encoded by multigene families, the members of which present an organ-, developmental- and
environmental-specific regulation.
Cell wall invertases have been implicated in the
regulation of the sink strength of plant tissues (Goetz
et al. 2000). Therefore, activation of Lin6 gene expression in mycorrhizal roots could represent a mechanism
contributing to the sink strength arising from mycorrhizal
colonization (Graham 2000). As the intraradical structures of AM fungi cannot take up sucrose (Shachar-Hill
Physiol. Plant. 129, 2007
A
Fold change in Lin6 expression
5
4
3
2
1
0
C ABA SA Glu Suc
C ABA SA Glu Suc
12 h
24 h
C ABA SA Glu Suc
C ABA SA Glu Suc
12 h
24 h
C ABA SA Glu Suc
C ABA SA Glu Suc
12 h
24 h
B
Fold change in TIV1 expression
8
6
4
2
0
Fold change in TIOMSSF expression
C
8
6
4
2
0
Fig. 4. Effect of glucose, sucrose, SA and ABA on (A) Lin6, (B) TIV1 and
(C) TOMSSF gene expressions. RNAs were extracted from roots of tomato
plantlets exposed for 12 and 24 h to H2O (control), 100 mM ABA, 100 mM
SA, 40 mM glucose or 20 mM sucrose. RNAs were reverse transcribed,
and the expression levels were assayed by quantitative real-time RT–PCR
using gene-specific primers for Lin6, TIV1, TOMSSF and 18S rRNA. The
relative levels of transcription were calculated by the 22DDCt method.
Data represent the means of three independent biological replicates. Error
bars represent SD.
Physiol. Plant. 129, 2007
et al. 1995; Solaiman and Saito 1997), upregulation of
Lin6 mRNA in mycorrhizal roots also suggests that the
protein encoded by this gene could be responsible for
the hydrolysis of the sucrose delivered to the apoplast of
the symbiotic interface to release the hexoses that will
be then taken up by the fungal partner for growth and
metabolism. Alternatively, hexoses released from sucrose
hydrolysis at the apoplast could be taken up by the host
root cells to support their increased metabolic activity.
This hypothesis is supported by the observation by
Harrison (1996) that the formation of the AM symbiosis
is accompanied by upregulation of a hexose transporter
that potentially functions to supply sugars to root cells
critically involved in the symbiotic association.
In this study, we show for the first time induction of
a cell wall invertase in an AM association, which supports
the general assumption that carbon transfer across the
symbiotic interface requires host sucrose hydrolysis by
a cell wall invertase (Ferrol et al. 2002). The importance of
host cell wall invertases for supplying the fungal partner
with hexoses has been shown in ectomycorrhizas.
Heterologous expression of highly active yeast invertase
in poplar hybrids had a profound effect on the availability of hexoses and, in consequence, on fungal metabolism and development after mycorrhiza formation
(Guttenberger 1998).
Vacuolar invertases determine the level of sucrose
stored in the vacuole and play an important role in the remobilization of sucrose for metabolic processes (Roitsch
and González 2004). Upregulation of the mRNA levels
for the vacuolar invertase isozyme TIV1 in tomato
mycorrhizal roots agrees with previous observations of
Blee and Anderson (2002) who found an accumulation of
transcripts for a vacuolar invertase in cortical cells
containing arbuscules in Phaseolus vulgaris. These data
suggest that TIV1 could provide hexoses to support the
elevated metabolic activity and respiration rates of the
colonized tissues in a mycorrhizal root (GianinazziPearson 1996). Differential regulation of TIV1 in roots
colonized either by G. mosseae or G. intraradices
suggests that carbon utilization in tomato roots probably
depends on the species of the AM fungus involved in the
symbiosis.
Activation of a sucrose synthase gene during AM
symbiosis in tomato roots is in agreement with previous
observations in other plant species, such as P. vulgaris
(Blee and Anderson 2002), Medicago truncatula (Hohnjec et al. 2003) and Zea mays (Ravnskov et al. 2003), and
with the increased sucrose synthase activity found in
mycorrhizal clover and soybean roots (Schubert et al.
2003, Wright et al. 1998). In situ hybridization experiments in P. vulgaris showed that transcripts for sucrose
synthase were located in phloem tissues and in cortical
743
cells bearing fluorescent arbuscules (Blee and Anderson
2002). In M. truncatula of the five sucrose synthase genes
analyzed, only MtSucS1 was upregulated in mycorrhizal
roots, and strong GusA expression driven by the MtSucS1
promoter was detected in the root central cylinder as well
as in cortical cells harboring arbuscules and in the
surrounding cortical cells, irrespective of a direct contact
with the fungal structures (Hohnjec et al. 2003). These
data indicate that sucrose synthase also contributes to the
sink strength arising from colonization by the fungal
symbiont. As sucrose synthase is localized in the cytosol,
it is more likely that this enzyme participates in supporting the increased metabolic activity of the root cells
than in providing carbon compounds to the fungus.
Transcriptional upregulation of sucrose-splitting enzymes in roots of the 4-week mycorrhizal plants agrees
with the decreased levels of sucrose detected in these
roots. At the second harvest, sucrose content increased in
mycorrhizal roots, suggesting that more sucrose was
being translocated to the roots of the mycorrhizal plants
probably to compensate for the extra cost as a result of the
presence of the fungus. The decrease in the glucose and
fructose contents in mycorrhizal roots can be interpreted
as a result of their conversion into fungal-specific
compounds such as trehalose and lipids.
Regulation of Lin6, TOMSSF and TIV1 genes by sugars
supports previous observations for a central role of
hexoses or sucrose in the control of metabolic enzymes
in higher plants (Rolland et al. 2002). Upregulation of
these genes in roots of tomato plantlets exposed to
glucose suggests that the higher hexose concentration
resulting from sucrose hydrolysis induces their expression
by a positive feedback regulation, as it has been previously reported in other plant species (Roitsch et al. 1995,
Trouverie et al. 2004). However, the lower concentrations
of glucose and fructose found in mycorrhizal roots
suggest an alternative mechanism for the regulation of
these genes in the symbiotic roots. An accumulation of
the signaling compound SA (Blilou et al. 1999) and of the
phytohormone ABA has been reported in mycorrhizal
roots (Danneberg et al. 1992, Meixner et al. 2005).
Therefore, upregulation of Lin6, TOMSSF and TIV1 by SA
and of TOMSSF and TIV1 by ABA suggest that these
compounds might mediate regulation of these genes in
mycorrhizal roots.
In conclusion, all these data indicate that development
of the AM symbiosis upregulates sucrose metabolism
genes, reflecting increased catabolism and utilization of
sucrose in mycorrhizal tomato roots. Future detailed
promoter analyses using GUS fusions and analysis of
plants with knock outs for Lin6, TIV1 and TOMSSF by
RNA interference will shed light on their specific functions in the symbiosis and on the regulatory elements
744
that are required for their transcriptional activation in
mycorrhizal roots.
Acknowledgements – We thank Dr José Miguel Barea for
helpful discussions and Ms Custodia Cano and Ascensión
Valderas for excellent technical assistance. S. G-R. was
supported by an I3P fellowship from the Spanish Council for
Scientific Research. This research was supported by CICyT
(AGL2003-01551), Spain.
References
Abe H, Urao T, Ito T, Seki M, Shinozaki K,
Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2
(bHLH) and AtMYB2 (MYB) function as transcriptional
activators in abscisic acid signaling. Plant Cell 15: 63–78
Avigad G (1982) Sucrose and disaccharides. In: Lowus FA,
Tanner W (eds) Encyclopedia of Plant Physiology, New
Series, Vol. 13A. Springer-Verlag, Berlin, pp 217–347
Azcón-Aguilar C, Bago B, Barea JM (1998) Saprophytic
growth of arbuscular mycorrhizal fungi. In: Varma A,
Hock B (eds) Mycorrhiza: Structure, Function and
Molecular Biology and Biotechnology. Springer-Verlag,
Berlin, pp 391–407
Benabdellah K, Azcón-Aguilar C, Ferrol N (1999) Plasma
membrane ATPase and H1 transport activities in
microsomal membranes from mycorrhizal tomato roots.
J Exp Bot 337: 1343–1349
Blee KA, Anderson AJ (2002) Transcripts for genes encoding
soluble acid invertase and sucrose synthase accumulate in
root tip and cortical cells containing mycorrhizal
arbuscules. Plant Mol Biol 50: 197–211
Bligh EG, Dyer WJ (1959) A rapid method of total lipid
extraction and purification. Can J Biochem Physiol 37:
911–917
Blilou I, Ocampo JA, Garcı́a-Garrido JM (1999) Resistance of
pea roots to endomycorrhizal fungus or Rhizobium
correlates with enhanced levels of endogenous salicylic
acid. J Exp Bot 50: 1663–1668
Danneberg G, Latus C, Zimmer W, Hundeshagen B,
Schenenider-Poetsch HJ, Bothe H (1992) Influence of
vesicular arbuscular mycorrhiza on phytohormone balances
in maize (Zea mays L.). J Plant Physiol 141: 33–39
Elmayan T, Tepfer M (1995) Evaluation in tobacco of the
organ specificity and strength of the rolD promoter,
domain A of the 35S promoter and the 35S2 promoter.
Transgen Res 4: 288–396
Ferrol N, Barea JM, Azcón-Aguilar C (2002) Mechanisms of
nutrient transport across interfaces in arbuscular
mycorrhizas. Plant Soil 244: 231–237
Fu HY, Park WB (1995) Sink-associated and
vascular-associated sucrose synthase functions are
encoded by different gene classes in potato. Plant Cell 7:
1369–1385
Physiol. Plant. 129, 2007
Gianinazzi-Pearson V (1996) Plant cell responses to
arbuscular mycorrhizal fungi: getting to the roots of the
symbiosis. Plant Cell 8: 1871–1883
Giovannetti M, Mosse B (1980) An evaluation of techniques
for measuring vesicular-arbuscular infection in roots. New
Phytol 84: 489–500
Godt DE, Roitsch T (1997) Regulation and tissue-specific
distribution of mRNAs for three extracellular invertase
isoenzymes of tomato suggest an important function in
establishing and maintaining sink metabolism. Plant
Physiol 115: 273–282
Goetz M, Godt DE, Roitsch T (2000) Tissue-specific
induction of the mRNA for an extracellular invertase
isoenzyme of tomato by brassinosteroids suggests a role for
steroid hormones in assimilate partitioning. Plant J 22:
515–522
Graham JH (2000) Assessing costs of arbuscular mycorrhizal
symbiosis agroecosystems. In: Podila GK, Douds DD
(eds) Current Advances in Mycorrhizae Research. APS
Press, St. Paul, pp 127–140
Grierson C, Du J-S, de Torres Zabala M, Beggs K, Smith C,
Holdsworth M, Bevan MW (1994) Separate cis sequences
and trans factors direct metabolic and developmental
regulation of a potato tuber storage protein gene. Plant J
5: 815–826
Guttenberger M, Ecke M, Hamp R (1998) Transgenic poplar
trees expressing an acid invertase in the root apoplast
show altered pools of soluble carbohydrates in root
mycorrhizas. Proceedings of the Botanikertagung,
Germany. University of Bremen, Bremen
Harley JL, Smith SE (1983) Mycorrhizal Symbiosis. Academic
Press, New York
Harrison MJ (1996) A sugar transporter from Medicago
truncatula: altered expression pattern in roots during
vesicular-arbuscular (VA) mycorrhizal associations. Plant J
9: 491–503
Hattori T, Terada T, Hamasura S (1995) Regulation of the
Osem gene by abscisic acid and the transcriptional
activator VP1: analysis of cis-acting promoter elements
required for regulation by abscisic acid and VP1. Plant J
7: 913–914
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant
cis-acting regulatory DNA elements (PLACE) database.
Nucleic Acids Res 27: 297–300
Hoagland DR, Arnon DI (1938) Synthetic media for
hydroponic culture. Calif Agr Ext Publi 347: 35–37
Hohnjec N, Perlick AM, Pühler A, Küster H (2003) The
Medicago truncatula sucrose synthase gene MtSucS1 is
activated both in the infected region of root nodules and in
the cortex of roots colonized by arbuscular mycorrhizal
fungi. Mol Plant-Microbe Interact 16: 903–915
Jakobsen I, Rosendahl L (1990) Carbon flow into soil and
external hyphae from roots of mycorrhizal Cucumber
plants. New Phytol 115: 77–83
Physiol. Plant. 129, 2007
Kay R, Chan A, Daly M (1987) Duplication of CaMV 35S
promoter sequences creates a strong enhancer for plant
genes. Science 236: 1299–1302
Klann E, Yelle S, Bennett AB (1992) Tomato fruit acid
invertase complementary DNA. Plant Physiol 99:
351–353
Koch K (2004) Sucrose metabolism: regulatory mechanisms
and pivotal roles in sugar sensing and plant development.
Current Opin Plant Biol 7: 235–246
Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, van de
Peer Y, Rouzé P, Rombauts S (2002) PlantCARE, a database
of plant cis-acting regulatory elements and a portal to tools
for in silico analysis of promoter sequences. Nucleic Acids
Res 30: 325–327
Livak KJ, Schmittgen TD (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the
2-DDCT method. Methods 25: 402–408
Meixner C, Ludwig-Müller J, Miersch O, Gresshoff P,
Stachelin C, Vierheilig H (2005) Lack of mycorrhizal
autoregulation and phytohormonal changes in the
supernodulating soybean mutant nts1007. Planta 222:
709–715
Murray MG, Thompson WF (1980) Rapid isolation of high
molecular weight plant DNA. Nucleic Acids Res 8:
4321–4325
Pearson JN, Jakobsen I (1993) Symbiotic exchange of carbon
and phosphorus between cucumber and three arbuscular
mycorrhizal fungi. New Phytol 124: 481–488
Phillips J, Hayman D (1970) Improved procedure for clearing
roots and staining parasitic and vesicular-arbuscular
mycorrhizal fungi for rapid assessment of infection.
Transac British Mycol Soc 55: 158–160
Rausch T, Greiner S (2004) Plant protein inhibitors of
invertases. Biochim Biophys Acta 1696: 253–261
Ravnskov S, Wu Y, Graham JH (2003) Arbuscular
mycorrhizal fungi differentially affect expression of genes
coding for sucrose synthases in maize roots. New Phytol
157: 539–545
Roitsch T, Bitter M, Godt DE (1995) Induction of apoplastic
invertase of Chenopodium rubrum by D-glucose and
a glucose analog and tissue-specific expression suggest
a role in sink-source regulation. Plant Physiol 108:
285–294
Roitsch T, González MC (2004) Function and regulation of
plant invertases: sweet sensations. Trends Plant Sci 9:
606–613
Rolland F, Moore B, Sheen J (2002) Sugar sensing and
signalling in plants. Plant Cell 14: S185–S205
Schubert A, Allara P, Morte A (2003) Cleavage of sucrose in
roots of soybean (Glycine max) colonized by an arbuscular
mycorrhizal fungus. New Phytol 161: 495–501
Schüßler A, Schwarzott HD, Walker C (2001) A new fungal
phylum, the Glomeromycota: phylogeny and evolution.
Mycol Res 105: 1413–1421
745
Shachar-Hill Y, Pfeffer PE, Douds D, Osman SF, Doner LW,
Ratcliffe RG (1995) Partitioning of intermediary carbon
metabolism in vesicular-arbuscular mycorrhizal leek. Plant
Physiol 108: 7–15
Sinha AK, Hofmann MG, Romer U, Kockenberger W, Elling L,
Roitsch T (2002) Metabolizable and non-metabolizable
sugars activate different signal transduction pathways in
tomato. Plant Physiol 128: 1480–1489
Solaiman MD, Saito M (1997) Use of sugars by
intraradical hyphae of arbuscular mycorrhizal fungi
revealed by radiorespirometry. New Phytol 136:
533–538
Stougaard J, Sandal N, Gron A, Kuhle A, Marcker K (1987)
5# analysis of the soybean leghaemoglobin lbc3 gene:
regulatory elements required for promoter activity and
organ specificity. EMBO J 6: 3565–3569
Sturm A (1999) Invertases. Primary structures, functions,
and roles in plant development and sucrose partitioning.
Plant Physiol 121: 1–7
Sturm A, Lienhard S, Schatt S, Hardegger M (1999)
Tissue-specific expression of two genes for sucrose
synthase in carrot (Daucus carota L.). Plant Mol Biol 39:
349–360
Trouverie J, Chateau-Joubert S, Thévenot C, Jacquemot M-P,
Prioul J-L (2004) Regulation of vacuolar invertase by
abscisic acid or glucose in leaves and roots from maize
plantlets. Planta 219: 894–905
Wang F, Smith AG, Brenner ML (1993) Isolation and
sequencing of tomato fruit sucrose synthase cDNA. Plant
Physiol 103: 1463–1464
Weber H, Buchner P, Borisjuk L, Wobus U (1996) Sucrose
metabolism during cotyledon development of Vicia faba L
is controlled by the concerted action of both sucrosephosphate synthase and sucrose synthase: Expression
patterns, metabolic regulation and implications for seed
development. Plant J 9: 841–850
Wright DP, Read DJ, Sholes JD (1998) Mycorrhizal sink
strength influences whole plant carbon balance of
Trifolium repens L. Plant Cell Environ 21: 881–891
Yu D, Chen C, Chen Z (2001) Evidence for an important
role of WRKY DNA binding proteins in the regulation of
NPR1 gene expression. Plant Cell 13: 1527–1540
Edited by H. Usuda
746
Physiol. Plant. 129, 2007