Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Appendix 44 Mapping of neutralising sites on FMD virus type Asia 1 and relationships with sites described in other serotypes Santina Grazioli, Francesca Fallacara and Emiliana Brocchi* Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna, Brescia, Italy Abstract Knowledge on the antigenic structure of foot-and-mouth disease virus (FMDV) has, besides a scientific value, several practical applications: it may have relevance in the development of diagnostic assays, as well as the evaluation of the antigenic variability and the selection of appropriate vaccine strains. Antigenic sites have been studied only in FMDV type O, A and C, while it would be worthwhile to extend studies also to other serotypes. This paper reports on the identification of neutralising sites in FMDV type Asia 1 using a new panel of monoclonal antibodies (MAbs) and discuss their relation with sites described in other types. MAbs specific for FMDV type Asia 1 were produced and characterised using different immunoassays. FMDV mutants resistant to MAbs neutralisation were selected and sequenced. Out of 24 MAbs produced, 10 neutralise viral infectivity and 14 do not. The 10 neutralising MAbs, all typespecific, identify 4 independent antigenic sites on the basis of the reactivity profile with MAR-mutants. By comparing the amino acids sequence of the parental virus and of virus mutants, the amino acids crucial for the 4 sites were mapped at the following positions: VP1 142, VP2 67-79, VP3 58/59, VP3 218. MAbs confirmed their powerful for making light insight the antigenic structure of FMDV. Three of the 4 neutralising sites identified and mapped on FMDV type Asia 1 correspond structurally and functionally to analogous sites described in FMDV type O, A and C, enforcing the evidence that these are dominant antigen sites in FMDV structure. One site, located at C-terminus of VP3, is a new independent site, described for the first time in FMDV. Further sites, not involved in neutralisation, were detected by 14 more MAbs. Introduction Foot-and-mouth disease (FMD) viruses constitute one genus in the family Picornaviridae, but are classified in seven serotypes, each of which shows considerable intra-typic variation. This antigenic variation leads to continuing difficulties in controlling the disease. Studies on the antigenicity of FMD virus, complemented with crystallographic analysis of the threedimensional structure of the virus and of virus-antibody complexes, have improved understanding of the interaction between virus and the host immune system, including the mechanism of virus escape from neutralisation, which is also responsible for the high antigenic diversification of FMD viruses. Such studies may contribute to a better control of the disease. The identification of antigenic sites in FMDV has mainly relied on the use of monoclonal antibodies (MAbs), and partly also on the evaluation of immunogenicity and antigenicity of viral peptides. However, synthetic peptides only allow the study and characterisation of sequential epitopes, while the use of MAbs, combined with detection of amino acids substitutions in virus mutants resistant to MAb-induced neutralisation, allows the identification of any kind of antigenic sites, either linear or dependent on conformation, provided their involvement in virus neutralisation processes. Using this approach, antigenic sites have been identified and mapped on FMD viruses type O (Xie et al. 1987; Pfaff et al., 1988; Barnett et al., 1989; Kitson et al.,1990), type A (Thomas et al., 1988; Baxt et al., 1989; Bolwell et al., 1989) and type C (Mateu et al., 1990; Lea et al., 1994). Results of these studies agree in the evidence that, besides the continuous epitope termed site A or site 1, located within the large and flexible G-H loop of VP1 and for a long time considered the main if not the single immunodominant site, other epitopes, not found in continuous sequences but dependent on capsid conformation, also exist in all the three serotypes studied (reviewed in Mateu, 1995). Amino acid residues in the three structural proteins VP1-3 exposing loops on the virus surface have been indicated as crucial elements for the site antigenicity. These studies were conducted on isolates of FMDV types O, A, C which are extinct from the field. Furthermore, it would be worthwhile to extend investigations also to other serotypes of FMDV, either to improve basic knowledge on the virus structure and antigenicity, and for the benefits that this knowledge may reflect on the selection of appropriate strategies for the disease control. Further knowledge on the antigenic structure and the availability of well characterised MAbs have useful applications also in the design of functional diagnostic assays and in studies on the antigenic evolution of FMD viruses. In this report we describe the identification and characterisation of neutralising sites on FMDV type Asia 1 by a new panel of MAbs. Four independent sites have been demonstrated, three of which, located on VP1, VP2 and VP3 respectively, correspond to sites previously determined in FMDV serotypes O, A and C, while the fourth seems to be a new site described for the first time in FMDV. 277 Materials and Methods Viruses FMDV isolates used were received from the World Reference Laboratory, Pirbright, UK; they are listed in table 1. Viruses were propagated in IBRS-2 cells monolayers and harvested when cytopathic effect was maximum. The strain used for mice immunisation and SDS-polyacrilamide gel electrophoresis was preliminarily inactivated with binary ethylenimine and purified by ultracentrifugation through a 25% (w/w) sucrose cushion. Monoclonal antibodies (MAbs) The production of MAbs against FMDV Asia 1, strain Nepal 29/97 was described in Grazioli et al., 2002. Trapping ELISA The assay used for MAbs titration and for the evaluation of their intra- and inter-types reactivity was a trapping ELISA (Samuel et al., 1991). Essentially, each MAb was reacted with pre-titrated concentrations of viruses (supernatant of infected cells) which had been trapped using a polyclonal rabbit Asia 1 antiserum. Titres of MAbs were expressed as the reciprocal of the saturating dilution, while the reactivity of mutants and field isolates with each MAb was expressed as a percentage of the corresponding reaction with the parental strain, assumed to be 100%. Virus Neutralization test (VNT) VNT was carried out in microplates against 100 TCID50 of the homologous FMDV Asia 1 or MAR-mutants and IBRS-2 as substrate. The final dilution required to neutralise 50% of the inoculated cultures was calculated. MAb neutralization-resistant (MAR) mutants The selection of mutants resistant to neutralization by MAbs was carried out as described previously (Borrego et al. 2002). Immunoblotting analysis Hybridoma supernatants were assayed against the purified homologous FMDV, resolved by SDSpolyacrilamide gel electrophoresis 10% or 12% and transferred to nitrocellulose filters, following standard procedures (Harlow & Lane, 1988; Towbin et al., 1979). Sequencing RNA extracted from the supernatant of infected cultures, using a commercial kit (Qiagen RNeasy Mini kit, Qiagen, Inc.), was used as the template for RT-PCR. Reverse transcription was carried out using AMV reverse transcriptase with a hexanucleotide mixture of all possible sequences (“Random” primer) (Roche). The cDNA produced was used as the template for PCR amplification of the region encoding the structural proteins using the primers described in Table 1. The polyprotein P1 was amplified in five fragments which included also some flanking nucleotides from both the 5’ non-translated region (NTR) and protein 2A. Sequencing of PCR fragments and sequence analysis were carried out using an ABI 310 Automatic Sequencer and LaserGene software (DNASTAR Inc., Madison, WI, USA). Results Preliminary characterisation of MAbs A preliminary characterisation of 24 MAbs raised against FMDV type Asia1, strain Nepal 29/97, was achieved by analysing the immunoglobulin class, the capability to neutralise viral infectivity, the reactivity with separated, denatured viral proteins and the level of cross-reactivity with the other six heterologous FMDV types. Results of these preliminary analyses had been reported at the open session of the EUFMD Research Group held in Turkey, 2002 (Grazioli et al., 2002); these results have now been updated with missing information and summarised in table 2. According results of VNT, MAbs were divided in two main categories: one including 10 MAbs that neutralise virus infectivity, another composed by 14 MAbs that do not. Although the major objective was focussed on mapping of neutralising MAbs, basic information were also collected for non-neutralising antibodies. Among them, 4 MAbs (4G6, 3D8, 4B1, 4B2) recognised only the homologous type Asia 1, while the other 10 MAbs showed different patterns of cross-reactivity with heterologous serotypes: the most common profile, shown by four MAbs (3G3, 2A4, 3B6, 5H5), was crossreactivity with 4 serotypes, namely the homologous Asia 1 and the heterologous O, A, C types, but also 2 MAbs reacting with all the seven serotypes (4G2, 3H12) and another one recognising all serotypes but SAT 1 (5F10) were detected. Non-neutralizing MAbs displayed a broad reactivity also with 11 isolates of type Asia 1, representative of a thirty-year period, being the oldest virus of this panel originated in 1973 (Asia 1 Turkey 15/73) and the most recent one in the year 2000 (Asia 1 Greece 1/2000); the antigenic stability of the relevant epitopes was expected, particularly for those conserved among different serotypes. Results of imunoblotting proved that one MAb (5F10) identifies a linear epitope in VP2 (figure 1), subjected to cleavage by trypsin treatment (not shown). In contrast, all other 13 non-neutralising MAbs were negative in immunoblotting, thus recognise conformation-dependent epitopes. The 10 neutralising MAbs scored virus neutralising titres from 200 to more than 20000 (in ascitic fluids). Three of them reacted with denatured VP1 in immunoblotting (table 2, figure 1); trypsin treatment of the virus prevented this reactivity (not shown), suggesting that their target site should correspond to the linear amino acid sequence containing a trypsin-sensitive site and designing the flexible G-H loop of VP1, 278 well described in the FMDV structure. Interestingly, these three MAbs showed a high degree of crossreactivity with the SAT 3 serotype, indicating a strong similarity of the target neutralising site between the Asia 1 and SAT 3 serotypes. However, the other 7 neutralising MAbs were all type-specific and all negative in imunoblotting with separated viral proteins: this implies they are likely directed against conformational sites, but does not allow to differentiate them. MAb-resistant mutants (MAR-mutants) The selection, characterisation and sequencing of viral mutants resistant to neutralisation by each of the neutralising MAbs was the system adopted to identify and then map the relevant target sites. From 1 to 9 MAR-mutants were independently selected for each MAb by serial passages of the parental virus in the presence of high concentration of MAb. After stabilisation, mutants were analysed by both ELISA and VNT against the 10 MAbs, in order to detect reciprocal relationships on the basis of similar patterns of reactivity. The antigenic profile of MAR-mutants, determined by ELISA (figure 2) lead to the definition of 4 distinct neutralizing sites; sites were denominated I, II, IV, V to maintain a common denomination in relation with analogous sites previously described in other FMDV types; substantially the 4 sites are independent each other, as mutations in one site did not alter the reactivity of the other sites. In particular, site I is defined by the 3 MAbs (5C12, 4E10, 4F10) reacting with a linear sequence of VP1: mutations induced in any of the corresponding escape mutants annulled the reaction of the three MAbs, without affecting the binding of the other seven MAbs. Another site, called site V, is defined by the unique MAb 5G4: it is clearly distinct in that the five mutants selected with this antibody were still recognised by all the other MAbs. Site IV includes three additional MAbs, 5E10, 3C6, 1F10: in fact, the 13 mutants selected with any of the three MAbs lost reactivity with all of them. Similarly, the remaining three MAbs, 2C3, 2G1, 4D8, correspond to a distinct site called site II. A structural relation could occur between site II and IV, since variations in one site may partially alter the reactivity of the other. In order to evaluate the correlation between ELISA binding and neutralisation pattern, one or two representative mutants for each MAb were also tested for the susceptibility to neutralisation by MAbs; the neutralisation titres of the MAbs towards 100 TCID50 of the parent virus and the mutant viruses were compared; it was arbitrarily assumed that differences in titres > 2 log10 units indicate resistance, differences between 1 and 2 log10 units indicate partial resistance and < 1 log10 are indicative of sensitivity to MAb-induced neutralisation. Results of these cross-neutralisation assays, shown in figure 3 fully confirmed the findings obtained by ELISA, providing further evidence of the four distinct sites, with a partial relation between sites II and IV. Mapping of neutralising sites The sequence of the capsid coding region of some mutants was also determined and compared to the parental sequence, in order to identify amino acid substitutions responsible for the antigenic variation (Figure 2 and Table 3). The amino acids crucial for antigenic sites organization were determined, enabling us to map the 4 antigenic sites on the capsid proteins and identify the secondary structural element involved. Sites I, IV and V could be related to a single amino acid change, while site II was associated to multiple simultaneous changes. According to results of mutants sequencing, Mutants selected with MAbs to site I repeatedly showed substitutions at residue 142 of VP1 (corresponding to residue 144 in type O), flanking the conserved RGD motif and included within the flexible G-H loop of VP1; site II is located in VP2 and involves multiple amino acid positions in the B-C loop: namely residues 67, 72, 74, 77, 79. Mutants in this site showed each three simultaneous changes; one of them presented also two further changes at amino acids 49 and 207 of VP1; site IV maps at the amino acid positions 58 or 59 of VP3, located within the secondary structural element B-B knob. However, a further mutation at amino acid 67 of VP2 was detected in two sequenced mutants: this second change is typical of site II and can justify the partially altered reactivity of some MAbs of site II, confirming the structural relationship between site II and IV; Site V maps on VP3, involving the amino acid 218, that corresponds to the VP3-carboxyl end. Consistently with ELISA and neutralisation profiles, mutants selected with different MAbs defining the same site showed amino acid changes at the same or contiguous residues; however, residues involved in site IV may be substituted by different amino acids causing similar effects. The profile of reactivity with MAbs of 11 FMDV isolates of type Asia 1, chronologically distant, proved evidence that site I and IV are stable in the majority of isolates, whilst sites II and V are subject to frequent antigenic variation: in fact MAbs to site I and IV broadly reacted with all but 1 isolate (Cambodia 3/93), while MAbs to site II and V reacted almost exclusively with the homologous strain (table 2). 279 Discussion Mapping of antigenic sites by a new panel of MAbs, with focus on the sites involved in virus neutralisation processes, has provided a better understanding of the antigenic structure of FMDV type Asia 1, allowing to study the relationships with antigenic sites previously described in other FMDV types, more extensively studied. Recently, the use of two panels of MAbs lead to the identification of independent antigenic sites also in the type Asia 1 of FMDV (Sanyal et al., 1997, Marquardt et al., 2000). The MAbs provided evidence of antigen variability among field isolates (Sanyal et al., 1997; Sanyal et al., 2003; Marquardt et al., 2000), but mapping of the relevant sites was only attempted on the basis of the correspondence observed between MAbs-profiling and variations in the amino acid sequence of few isolates (Marquardt et al., 2000). The characterisation of our new panel of MAbs, combined with sequencing of MAR-mutants, enabled us to identify and map four independent neutralising sites. Interestingly, three of the sites detected on type Asia 1 correspond structurally and functionally to analogous antigenic sites described in types O, A and C (as shown in figure 3). In particular, site I, defined by three MAbs of our panel, was previously called site 1 or A in the other three serotypes; in all serotypes this site is located within the surface exposed G-H loop of VP1, that contains one trypsin cleavage site and the highly conserved RGD (Arg-Gly-Asp) amino acid triplet, corresponding to the presumed site of cell attachment (Fox et al., 1989; Mason et al., 1994). Several amino acid residues in the sequential segment 138-154 of the capsid protein are involved in determining site antigenicity. Substitutions detected either in MAR-mutants, or in field variants occur in residues flanking both sides of the RGD motif (Stave et al., 1988; Bolwell et al., 1989; Mateu et al., 1990; Marquard and Freiberg, 2000; Marquardt et al., 2000). Consistently, also in the FMDV type Asia 1 the position 142, which was found repeatedly substituted in MAR-mutants, precedes the RGD motif. The G-H loop is easily accessible on the virus surface and is characterised by high variability (reviewed in Palmenberg, 1989 and Domingo et al., 1990). The antigenic diversity in this region relays on its flexibility, as indicated by the disorder at G-H loop observed in crystal structures of both types O (Acharya et al., 1989) and C (Lea et al., 1994). In fact a flexible loop can accept different amino acid sequences while preserving a functional capsid structure. In spite of this concept, and in contrast with the sequence variability observed in some field isolates of Asia 1 type in the corresponding region (Marquard et al. 2000), our three MAbs to site I show a high level of conservation among the field isolates tested. Furthermore, unexpectedly, all of them recognise also the FMDV serotype SAT 3; the molecular bases that may explain cross-reactivity at this level should be further investigated. It has been reported that VP1 C-terminus contributes to the formation of a discontinuous site together with site 1/A in the FMDV type O (Xie et al 1987, Parry et al., 1989), but represents a topologically independent site in type C (site C, Mateu et al., 1990). In type A both situations have been observed in different strains (Baxt et al., 1989, Thomas et al., 1988). The epitope included in VP1 C-terminus in the sequence 200-213 of the serotypes O, A; C (figure 3). VP1 C-terminus was described as a trypsinsensitive, linear epitope of minor importance, given the weak neutralising capability of MAbs towards it (Mateu et al. 1990, Thomas et al.,1988), their failure to compete with sera from convalescent animals (Thomas et al., 1988) and the poor capacity of VP1 C-terminus to generate protecting antibodies (Meloen and Barteling, 1986). Our MAb panel does not provide evidence of antigenicity of VP1 C-terminus in FMDV type Asia 1; however a substitution at residue 207 was detected in one MAR-mutant of site II; apparently it is not structurally related to site II itself, but rather indicates the occurrence of variability in this region. Site II involves multiple amino acid positions in the structural protein VP2, ranging from 67 to 79; the same or contiguous residues were found crucial for the conformation of the analogous site in FMDV type O (site 2, Kitson et al., 1990), A (Ag-site III, Thomas et al.,1988) and C (site D2, Lea et al., 1994). All concerned residues lie in the exposed B-C loop of VP2. Frequent amino acids substitutions were demonstrated in this region in field isolates of type Asia 1 (Marquardt et al., 2000), indicating its susceptibility to variation. Consistently, our three MAbs to site II do not recognise most of the isolates examined. Site IV maps in the type Asia 1 at positions 58/59 of VP3, located within the B-B knob structural element; in contrast to site II, this is a conserved region, as proved by the broad intra-typic reactivity of the three target MAbs and in agreement with the absence of substitutions observed in the amino acid sequence of field isolates (Marquardt et al., 2000). The same epitope was found also in types O (site 4), A (described as part of Ag-site III) and C (site D3). While the same and unique residue 58 was found crucial for this site in the serotypes O and C (Kitson et al., 1990; Lea et al., 1994), in the serotype A several contiguous or close residues, namely 58 to 61, 69/70 and in addition two more distant positions 139 and 195, seem to be part of this site (Thomas et al., 1988). Evidence of structural relationship between site II and IV in the type Asia 1, based on the profile of reactivity and also on amino acids replacements of the relevant MAR-mutants, confirmed previous 280 findings. In fact, in type A, like in type Asia 1, mutants induced with MAbs against the two sites showed a certain level of reciprocal cross-neutralisation (Thomas et al., 1988), in type C they are considered parts of a unique complex antigenic site (Lea et al., 1994). Furthermore, in the three dimensional structure of the capsid, residues involved in formation of the two sites lie close each other on the surface of the virion, around the three-fold axes of symmetry (Kitson et al., 1990; Lea et al., 1994). The detection of equivalent sites in four different serotypes, detected through independent studies, enforces the evidence that these are dominant antigenic sites in the FMDV structure. However, there are further conformational sites, implicated in neutralisation processes, each described only in one FMDV serotype. In type A a site of minor importance was found at position 169 (Baxt et al., 1988) and 163 (Thomas et al., 1998) of VP1; in type O the so called site 3 was mapped at the amino acid residues 43 to 45 and 48 of VP1 (Barnett et al., 1989; Kitson et al., 1990). It was supposed that these two sites could be related each other, as residues involved are located within two different loops (H-I and B-C loops respectively) of VP1 lying adjacent on the virus surface. We did not find these positions as part of any antigenic site in type Asia 1, however one mutant obtained with site II MAbs presented, beside changes related to site II, a substitution in position 43, overlapping to site 3 of type O. This could suggest that the corresponding region is subjected to variability also in type Asia 1. A further position in VP1, mapping at residues 193 was recognised as another neutralising site, named D1, only in type C (Lea et al., 1994). Finally the site called V, described here in type Asia 1, maps at position 218 of VP3 (VP3 C- terminus) and is reported for the first time in FMDV antigenic structure. The profile of reactivity of several isolates of type Asia 1 indicates variability in correspondence of this site, in accordance with the frequent substitution rate detected in position VP3-218 by sequencing field isolates (Marquardt et al., 2000). Further sites not involved in neutralisation were detected by another group of 14 MAbs, reacting with all Asia 1 field isolates and presenting different degrees of even inter-types cross reactivity. One of these MAbs (5F10) recognises a linear epitope in VP2, as proven by its profile of reactivity in imunoblotting; the epitope is susceptible to trypsin cleavage and is common to at least six serotypes. MAbs with analogous reactivity were independently selected by other authors from mice immunised with either FMDV type O, SAT 1 or Asia 1. The epitope target of these antibodies resides at the intertypically conserved N-terminus of VP2, as demonstrated by the reactivity profile with synthetic peptides. (Freiberg et al., 2001). The remaining 13 not neutralising MAbs recognise conformational epitopes, indistinguishable each other, except for different patterns of inter-types cross reactivity. Also non neutralising MAbs may have a potential value for the development of diagnostic assays, but they are more difficult to characterise than neutralising MAbs. Therefore, there is a requirement to investigate alternative methods and strategies for their characterisation. In conclusion, our results have improved understanding of the antigenic structure of FMDV, through the description of a new neutralising site and providing more evidence of the immunodominant character of three antigenic sites detected in 4 different serotypes. These data may have useful application in diagnostic and epidemiological investigations, as MAbs directed against conserved epitopes provide universal reagents for FMDV detection systems, while MAbs against known variable sites readily allow the identification of antigenic variants. The development of diagnostic immunoassays using these MAbs is providing satisfactory perspectives. Conclusions: 1) Three of the 4 neutralising sites identified and mapped on FMDV type Asia 1 correspond structurally and functionally to analogous sites described in FMDV type O, A and C, enforcing the evidence that these are dominant antigen sites in FMDV structure. 2) One site, located at C-terminus of VP3, is a new independent site, described for the first time in FMDV. Further antigenic sites, not involved in neutralisation, were detected by 14 more MAbs. 3) MAbs confirmed their powerful for a better understanding of the antigenic structure of FMDV. Recommendations: 1) A detailed characterization of MAbs should be achieved in order to select appropriate panels for different applications, such as diagnostic tests or antigen profiling, and to guide to a correct interpretation of results based on MAbs use (it is important to predict which antigenic sites are being analyzed and their relevance for purpose). 2) In the antigenic structure of FMDV, sites not involved in neutralization are usually under evaluated, despite they could be useful target for diagnostic purposes. Few tools and systems that allow their study are known; more research should be encouraged also in these aspects. 3) Criteria and funding to create a bank of available MAbs should be defined. Only well characterized MAbs should be maintained within the MAbs bank. 281 Acknowledgments: we thank D. Gamba for hybridoma cultures, M. Bugnetti for virus cultures, F. De Simone for the critical reading of the manuscript. Work was supported by Italian Ministry of Health (grant IZSLER PRC 98/004) and by EU (grant CT98 4032). References Acharya, R. Fry, E. Stuart, D. Fox, G. Rowlands, D. & Brown, F. 1989. The three-dimensional structure of foot-and-mouth disease virus at 2.9 A resolution. Nature 337:709-716. Barnett, P.V. Ouldridge, E.J. Rowlands, D.J. Brown, F. & Parry, N.R. 1989. Neutralizing epitopes on type O foot-and-mouth disease virus. I. Identification and characterization of three functionally independent, conformational sites. Journal of General Virology 70:1483-1491. Baxt, B. Vakharia, V. Moore, D. M. Franke, A. J. & Morgan, D. O. 1989. Analysis of neutralizing antigenic sites on the surface of type A12 foot-and-mouth disease virus. Journal of Virology, 63(5): 21432151. Bolwell, C. Clarke, B.E. Parry, N.R. Ouldridge, E.J. Brown, F. & Rowlands, D.J. 1989. Epitope mapping of foot-and-mouth disease virus with neutralizing monoclonal antibodies. Journal of General Virology, 70:59-68. Borrego, B. Carra, E. Garcìa-Ranea, J. A. & Brocchi, E. 2002. Characterization of neutralization sites on the circulating variant of swine vesicular disease virus (SVDV): a new site is shared by SVDV and the related coxsackie B5 virus. Journal of General Virology, 83: 35-44. Domingo, E. Mateu, M.G. Martìnez, M.A. Dopazo, J. Moja, A. & Sobrino, F. 1990. Genetic variability and antigenic diversity in foot-and-mouth disease virus. In Applied Virology Research, Volume 2, pp 233266, Plemum Publishing, New York. Fox , G. Parry, N. Barnett, P.V. McGinn, B. Rowlands, D.J. & Brown, F. 1989. The cell attachment site on foot-and-mouth disease virus includes the amino acid sequence RGD (arginine-glycine-aspartic acid). Journal of General Virology 70:625-637. Freiberg, B. Hohlich, B. Haas, B. Saalmuller, A. Pfaff. E. & Marquardt, O. 2001. Type-independent detection of foot-and-mouth disease virus by monoclonal antibodies that bind to amino-terminal residues of capsid protein VP2. Journal of Virological Methods, 92: 199-205. Harlow, E. & Lane, D. 1988. Immunoblottibg protocols. In Antibodies: a Laboratoryy manual, p 479510. Cold Spring Harbor, NY: Cold Sring Harbor laboratory. Kitson, J.D.A. McCahon, D. & Belsham, G. J. 1990. Sequence analysis of monoclonal antibody resistant mutants of type O foot and mouth disease virus: evidence for the involvement of the three surface exposed capsid proteins in four antigenic sites. Virology, 179: 26-34 Grazioli, S. Fallacara, F. & Brocchi, E. Monoclonal Antibodies against FMDV type Asia 1: preliminary characterization and potential use in diagnostic assays. Report of the Sess. Res. Gr. St. Tech. Committee of the Europ. Comm. Control FMD, Izmir, Turkey 17-20 September 2002, p.194-202 Lea, S. Hernàndez, J. Blakemore, W. Brocchi, E. Curry, S. Domingo, E. Fry, E. Abu-Ghazaleh, R. King, A. Newman, J. Stuart, D. & Mateu, M. G. 1994. The structure and antigenicity of a type C footand-mouth disease virus. Structure 2: 123-139. Marquardt, O. & Freiberg, B. 2000a. Antigenic variation among foot-and-mouth disease virus type A field isolates of 1997-1999 from Iran. Veterinary Microbiology, 74: 377-386 Marquardt, O. Rahman, M.M. & Freiberg, B. 2000b. Genetic and antigenic variance of foot-and-mouth disease virus type Asia 1. Archives of Virology, 145: 149-157. Mason, P.W. Rieder, E. & Baxt, B. 1994. RGD sequence of foot-and-mouth disease virus is essential for infecting cells via the natural receptor but can be bypassed by an antibody-dependent enhancement pathway. Proc. Natl. Acad. Sci. USA 91:1932-1936. Mateu, M. G. Martìnez, M. A. Capucci, L. Andreu, D. Giralt, E. Sobrino, F. Brocchi, E. & Domingo, E. 1990. A single amino acid substitution affects multiple overlapping epitopes in the major antigenic site of foot-and-mouth disease virus of serotype C. Journal of General Virology, 71: 629-637. Mateu, M. G. 1995. Antibody recognition of picornaviruses and escape from neutralization: a structural view. Virus Research, 38: 1-24. Meloen, R.H. & Barteling, S.J. 1986. An epitope located at the C-terminus of isolated VP1 of foot-andmouth disease virus type O induces neutralizing activity but poor protection. Journal of General Virology 67:289-294. Palmenberg, A.C. 1989. Molecular aspects of picornavirus infection and detection. American Society for Microbiology, Washington D.C. Parry, N.R. Barnett, P.V. Ouldridge, E.J. Rowlands, D.J. & Brown, F. 1989. Neutralizing epitopes of type O foot-and-mouth disease virus. II. Mapping three conformational sites with synthetic peptide reagents. Journal of General Virology, 70:1493-1503. Pfaff, E., Thiel, H.J., Beck, E., Strohmaier, K., & Schaller, H. 1988. Analysis of neutralizing epitopes on foot-and-mouth disease virus. Journal of Virology 62:2033-2040. Samuel, A.R. Knowles, N.J. Samuel, G.D. & Crowther, J.R. 1991. Evaluation of a trapping ELISA for the differentiation of FMDV using MAbs. Biologicals 19: 299-310. 282 Sanyal, A. Venkataramanan, R. & Pattnaik, B. 1997. Antigenic features of foot-and-mouth disease virus serotype Asia1 as releaved by monoclonal antibodies and neutralization-escape mutans. Virus Research 50:107-117. Sanyal, A. Gurumurthy, C. B. Venkataramanan. R, Hemadri, D. & Tosh, C. 2003. Antigenic characterization of foot-and-mouth disease virus serotype Asia1 field isolates using polyclonal and monoclonal antibodies. Veterinary Microbiology, 93: 1-11. Stave, J.W. Card, J.L. Morgan, D.O. & Vakharia, V.N. 1988. Neutralization sites of type O1 foot-andmouth disease virus defined by monoclonal antibodies and neutralization-escape virus variants. Virology, 162: 21-29. Stram, Y. Laor, O. Molad, T. Chai, D. Moore, D. Yadin, H. & Becker Y. 1994. Nucleotide sequence of the P1 region of serotype Asia1 foot-and-mouth disease virus. Virus Genes 8:275-278. Thomas, A.A.M. Woortmeijer, R. J. Puijk, W. & Barteling. S. J. 1988. Antigenic sites on foot-andmouth disease virus type A10. Journal of Virology, 62(8): 2782-2789. Tjissen P. 1985. Preparation of enzyme-antibody or other enzyme-macromolecule conjugates. In Laboratory techniques in biochemistry and molecular biology. Practice and theory of enzyme immunoassays (R.H. Burdon & P.H. van Knippenberg, eds). Elsevier, Amsterdam, 221-277. Table 1. Primers used for PCR amplification and sequencing of the capsid-coding region (polyprotein P1) Position Primers Nucleotide Gene 1D 50-70 5’ NTR 564D 564-587 VP2 Sequenze 5’ → 3’ GATCAGAGACCACTCAACGGA CACCGAACTTGGCATTTGGACACT 612D 665-685 VP2 GGGTGGGACATAGAGGTGACT 674R 674-696 VP2 TTTCCAACAGCAGTCACCTCTAT 1026D 1079-1098 VP3 CCAGTGTACGGGAAAGTGTT GCCCCGCAGCGAACGAGACA 1206R 1237-1256 VP3 1632D 1682-1702 VP1 TCAGCGGACCCGGTGACAACC 1716R 1748-1766 VP1 CAAAGGCAACGTCAGTGTG 2313R 2313-2333 2A ACTCAACGTCTCCTGCCAACT (D): direct primers, sequence identical to the viral genome; (R): reverse sequence complementary to the viral genome. Nucleotide numbering is according to Stram Y. et al (1994). All primer sequences correspond to FMDV Nepal 29/97 determined in this work, except for primers 564D and 2313R, which were designed according to the sequence of serotype Asia 1, isolate L83 (Stram Y. et al, 1994, Accession N° U01207). Table 3: Amino acid substitutions found in MAR-mutants Ag site MAR-mutant 4E10/A7+A3 I II IV V Substituted amino acid VP1 142 (R → Q) 4F10/A7 VP1 142 (R → Q) 5C12/A3 VP1 142 (R → Q); (VP1 121 A → G) 5E10/A11 VP3 58 (G → E); VP2 67 (F → L) 1F10/B2 VP3 59 (E → D); VP2 77 (H → D) 2C3/A7-A11 VP2 67 (F → L); VP2 77 (H → R); VP2 79 (Y → H) 2C3/A10 VP2 72 (D → N); VP2 74 (A → T); VP2 79 (Y → N) 2G1/A9 VP2 72 (D → G); VP2 77 (H → R); VP2 79 (Y → H) (VP1 48, VP1 207) 5G4/C9 VP3 218 (R → Q) 5G4/A2-A6 VP3 218 (R → Q) 283 Table 2: Reactivity of MAbs raised against FMDV type Asia 1, strain Nepal 29/97 Kuwait 2/81 Ag site Tur 15/73 Gre 1/2000 SAU 39/94 Iran 58/99 Pak 3/98 Pak 2/98 India 10/82 0 Cam 9/80 100 100 100 100 100 100 100 100 100 70 100 (homologous) + Nepal 29/97 Cam 3/93 - SAT 3 Zim 4/81 O1 Switz. 65 homologous A 5 Italy 62 C1 Italy 64 SAT 1 Bot 1/68 SAT 2 Zim 5/81 - percentage reactivity (ELISA) - - + 1 100 100 100 100 100 100 100 100 100 70 100 0 - - - - - + 100 75 100 100 100 100 100 100 100 25 20 0 IgG1 5E10 24 3840 - 125 - - - - - - 100 100 50 20 0 IgG1 3C6 3840 - 125 - - - - - - 100 100 100 100 100 100 100 100 75 100 40 0 IgG1 1F10 >32 20480 - 625 - - - - - - 100 100 100 100 100 100 100 100 100 100 100 0 IgG1 2C3 12 2560 - 375 - - - - - - 100 50 10 10 10 10 10 10 10 10 10 5 IgG1 2G1 24 2560 - 375 - - - - - - 100 50 0 0 0 0 0 0 0 0 0 0 100 0 0 0 0 0 0 0 0 0 0 0 100 0 50 50 35 20 0 0 0 0 0 0 3 25 4 2 based on MAR-Mutants - +/- - IgG1 5C12 >32 >20480 VP1 625 50 50 50 50 35 40 50 IgG2a 4D8 1 nd - 5 - - - - - - IgM 5G4 6 240 - 125 - - - - - - IgG1 4G6 - - - 125 - - - - - - 100 100 100 100 100 100 100 100 100 100 100 IgG1 3D8 - - - 3000 - - - - - - 100 100 100 100 100 100 100 100 100 100 100 100 IgG1 4B1 - nd - 375 -/+ - -/+ - - - IgG1 4B2 - nd - 625 -/+ - -/+ - - - IgG1 2F7 - nd - 625 (+) (+) - -/+ -/+ -/+ IgG1 2G8 - - - 625 (+) (+) - -/+ -/+ -/+ IgG1 2B11 - nd - 625 + + IgG1 3G3 - nd - 625 + + + - - - IgG1 2A4 - - - 125 + + + - - - IgG1 3B6 - nd - 625 + + + - - - IgG1 5H5 - nd - 5 + + + - - -/+ IgG1 4G2 - nd - 2 + + + + + + IgG1 3H12 - nd - 125 + + + + + + IgG1 5F10 - - VP2 75 + + + -/+ + + lin. site 100 100 100 100 100 100 100 100 100 100 100 100 - -/+ -/+ based on FMDV inter-types reactivity - 5 multiple epitopes NEUTRALIZING MAbS Asia 1 5120 VP1 125 a) - +/- - IgM 4F10 >32 20480 VP1 NON-NEUTRALISING MAbS ELISA Trapping Nepal 58/88 IgM 4E10 12 ascitic fluid hybrid. culture MAb Ig class VNT titre Immunoblotting MAbs reactivity against field isolates of type Asia 1 0 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 a) : highest saturating dilution of hybridoma supernatant; + : same reactivity as with the homologous virus type; (+): reduced signal with respect to the homologous virus type; -/+ : traces of reactivity; - : negative 284 Figure 2. ELISA reactivity profile of MAR-mutants with neutralizing anti-Asia 1 MAbs and location of amino acid substitutions Monoclonal Antibodies site 5G4 V 4D8 2G1 2C3 site II 1F10 3C6 5E10 site IV 5C12 4F10 MAR-Mutants 4E10 site I 4E10 A9+A10 4E10 A7+A3 4F10 A7 4F10 B3 5C12 A3 5C12 B10 5C12 A10 5C12 A11 5C12 A7 Amino acid Struct substitutions in the element corresp. mutant VP1 142 VP1 142 VP1 142 (VP1 121) 5E10 A11 3C6 pool B2-B6 3C6 pool A7-A11 3C6 A2+A6 1F10 B7-B11 1F10 A9-A10 1F10 D2-D4 1F10 D5 1F10 D3 1F10 B2 1F10 B9 1F10 A7 1F10 A3 VP1 G-H loop VP3 58 ; VP2 67 VP3 B-B knob VP3 59 ; VP2 77 2C3 C9-C11 2C3 pool A7-A11 2C3 pool B2-B6 2C3 pool B7-B11 2C3 pool A2-A6 2C3 D4 2C3 A10 2G1 A9 2G1 A8 2G1 A10 2G1 A11 VP2 67, 77, 79 VP2 B-C loop VP2 72, 74, 79 VP2 72, 74, 79 (VP1 48, 207) 5G4 pool B9-B11 5G4 C9 5G4 B7-B8-B10 5G4 A7-A11 5G4 A2-A6 VP3 218 (C-term) VP3 C-term VP3 218 (C-term) Percentage of reactivity related to the parental virus < 10% 10-30% 30-60% 60-80% 80-100% 285 Figure 1. Profile of reactivity of anti-FMDV type Asia 1 MAbs in immunoblotting Figure 3. Neutralisation resistance pattern of MAR-mutants with MAbs Monoclonal Antibodies Site IV Site I MAR-mutants Parental virus 4E10 A7-A3 4F10 A7 5C12 A3 5E10 A11 3C6 A2-A9 1F10 B2 1F10 A3 2C3 A7-A11 2C3 D4 2G1 A8 5G4 C9 Site II Site V 4E10 4F10 5C12 5E10 3C6 1F10 2C3 2G1 5G4 4,186 4,01 4,311 3,885 3,885 4,612 2,38 2,681 2,204 >3 >3 >3 nd 0,78 0,3 0 0 0,3 >3 >3 >3 0,61 0,47 0,11 0 0 0,42 >3 >3 >3 0,31 0,3 0,42 0,48 1,2 0,72 0 0,1 0 2,03 2,6 2,8 0 0 0 0,78 0,3 0,1 2 >3 3 0,18 0,6 0,6 0,1 0 nd 0,1 2,3 2,6 >3 0,48 0,6 0,48 nd 0,1 2,6 >3 >3 >2 >2 0 0,78 nd 0,6 1,5 1,1 0,7 >2 >2 0,1 0,78 0,7 0,1 2 0,78 0,9 >2 >2 0,1 0,6 nd 0,42 2 0,9 1,2 >2 >2 0,1 1 0,89 0,2 0,78 0,3 0,42 0 0 >2 Numbers in cells express differences in VNT titres (log10) to the parental and mutants viruses; white cells: differences > 2 log10 indicate resistance to neutralisation; grey cells: differences between 1 and 2 log10 indicate partial resistance; black cells: differences < 1 log10 indicate susceptibility to neutralisation. 286 Figure 4: Mapping of neutralising sites on FMDV structural proteins Correspondence between antigenic sites described in different FMD virus types 1 85 /1 VP4 218 /1 58, 59 Site IV 67, 72, 74, 77, 79 Site II 1 218 /1 VP2 85/1 VP4 58 Site 4 218 /1 VP2 72, 74, 79 Site D2 213 FMDV-A10/12 138 Æ 154 200 Æ 213 169, 173 220/1 VP3 70, 71, 72, 75, 77, 131 Site 2 1 (207) 142 Site I VP1 195 69 /1 VP4 FMDV-ASIA (48) 58 Æ 61, 69, 70 139 Ag-Site III 80 Ag-Site III 1 218 Site V VP3 VP2 211 VP 1 221 /1 218 /1 69 /1 VP4 219 /1 VP3 VP2 213 58 Site D3 200 Æ 213 43 Æ 45, 48 144 Æ 154 Site 3 Site 1 220/1 VP3 FMDV-O1 VP1 213 FMDV-C1 VP1 138 Æ 150 Site A 200 Æ 213 193 Site D1 287