Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
15th Annual Invasive Species Workshop Control and Eradication of Invasive Northern Pike in Southcentral Alaska Kristine Dunker, Alaska Department of Fish and Game, Division of Sport Fish Northern pike are an invasive species in Southcentral Alaska. Illegal introductions of northern pike began in the Upper Susitna drainage in the late 1950s. Subsequent expansion coupled with continued illegal introductions have resulted in the widespread distribution of northern pike from the Matanuska-Susitna Valley to the Kenai Peninsula. Northern pike are highly piscivorous and reduce ecologically and economically valuable salmonid populations throughout Southcentral Alaska. The Alaska Department of Fish and Game has taken an adaptive management approach with northern pike. Protocols chosen for control activities in a water body are dependent on its unique conditions. Northern pike control efforts have included liberalized harvest, increased outreach, fish passage barriers, gillnetting operations and piscicide applications. Piscicide applications are conducted to eradicate northern pike populations, restore fisheries and prevent northern pike from spreading. Recently, ADF&G began an annual large-scale gillnetting project to control northern pike in Alexander Creek, a tributary of the Susitna River, where some of the worst fishery losses have occurred. ADF&G also conducts research on northern pike movement patterns, diet and bioenergetics, effective control methods and detection methods such as eDNA. All control, eradication and research projects are directed by the Management Plan for Invasive Northern Pike and prioritized through a strategic planning process. Northern Pike Control in Southcentral Alaska Photo by Jim Lavakras, Compliments of ADN Kristine J. Dunker Northern Pike Control Committee Alaska Department of Fish and Game Division of Sport Fish 1 Northern Pike Esox lucius 2 Range of Northern Pike in Alaska Native Range Introduced Areas 3 Pleistocene Glaciers in Alaska 85,000 – 11,000 years ago Image Credit: Kaufman and Manley, 2004 Northern Pike Dispersal in Southcentral Alaska Bulchitna Lake 1950s – 1960s 5 Northern Pike Dispersal in Southcentral Alaska 1970s 6 Northern Pike Dispersal in Southcentral Alaska 1980s 7 Northern Pike Dispersal in Southcentral Alaska 1990s 8 Northern Pike Dispersal in Southcentral Alaska 2000s 9 Current Northern Pike Distribution in Southcentral Alaska > 120 water bodies with invasive pike 10 Northern Pike Habitat Alexander Lake 11 Ecological Concerns • Apex predators • Sit-and-Wait Ambush predation •Opportunistic Feeders •Primarily piscivorous •Habitat overlap with rearing salmonids •Fishery declines 12 Economic Concerns Pike predation • Reduce productivity of wild stocks •Discontinue hatchery stockings Commercial •Threatens an industry valued at ~ $1 Billion Recreational Subsistence 13 ADF&G Has Aggressively Worked to Control Invasive Northern Pike • • • • Educating the public Identifying distribution Liberalizing harvest Implementing control and eradication actions Control Netting Rotenone Treatments for Eradication Outreach Public Outreach Education Brochures Web sites PSAs Fishing DVD Message: Northern pike are invasive in Soutchentral. Illegal stocking has negative consequences. 15 Legal Ramifications Penalty • Class A misdemeanor • Restitution for damages AS 16.35.210 (c) 16 Increase Sport Harvest Sport Fish Regulations • No possession limit • Multiple harvest methods • Spear, bow, 5 lines (ice) • Illegal to release pike alive in NCI waters 17 Research • Distribution • Habitat utilization • Diet analysis • Movement patterns • Control methods • Detection methods •eDNA 18 Northern Pike Control Gill Netting Purposes: •Detect presence •Monitor populations •Targeted control 19 Northern Pike Eradication Rotenone Rotenone treatment of Union Lake, Kenai Peninsula, 2014 20 Invasive Northern Pike Management Plan ADF&G Mission: Protect the fish and game resources of the state, and manage their use in the best interest of Alaskans Plan Objectives: Increase public awareness Prevent future introductions Public processes to gain support Pike control / eradication Improve fish populations Restore fisheries The current plan is under revision and will be out for review in 201521 Strategic Planning Developed Scoring Matrix in 2010 •Criteria based on: •Threats to fisheries •Habitat significance •Watershed characterization •Cultural significance •Economic impacts •Feasibility Pike committee meets every two years to update the priority list 22 Strategic Planning (2010-2014) ADF&G Sport Fish Division Priority Projects: 1. Alexander Creek Pike Control 2. Cottonwood Creek Drainage Pike Suppression 3. Soldotna Creek Northern Pike Eradication – Phase 1 4. Soldotna Creek Northern Pike Eradication – Phase 2 5. Stormy Lake Northern Pike Eradication 6. Otter Lake Northern Pike Eradication 7. Cabin and Nancy Lake Pike Suppression 8. Kenai eDNA Research 9. Lower Fire Lake Pike Eradication 10. Alexander Creek Northern Pike Movement Study 11. Knik, Prator, Memory, North Rolly, and Taniana Lakes Pike Eradication 12. Susitna Pike Movement and Diet Study 13. Tote Road Lake Pike Eradication Estimated Total Program Cost: $5,325,000 14. Anchorage Lake Pike Assessment Funds Received To Date: $3,295,000 23 Alexander Creek Pike Control Top northern pike priority •Susitna River tributary •Very productive King fishery prior to 2000 •Pike in the lake for decades •Discovered in lower river in late 1990s •9 lodges and float plane charters operated there •King numbers crashed •Other systems were thriving •All fisheries now closed •All lodges and businesses closed Alexander Creek Chinook Escapement 24 Alexander Creek Pike Control Side-Channel Sloughs Goal: Drive down pike abundance to allow increased survival of rearing salmonids Side-Channel Slough • Reduce pike in side-channel sloughs with gillnets • Began in 2011 • During pike spawning • 3 Field crews target ~60 sloughs • Annual effort (15,500 pike removed since 2011) • Surveys to evaluate juvenile salmonid abundance • Minnow trap surveys throughout open water period • Pike stomach content analysis • USGS bioenergetics research Gillnetting Sloughs 25 Alexander Creek Pike Control Document Increase/ Decrease in CPUE of Salmonids Between Years and Study Sections 3 2 1 Alexander Creek Pike Control 7,000 Adult Chinook Salmon Returns 6,000 5,000 4,000 Escapement Goal Range 3,000 2,000 1,000 1979 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001 2003 2005 2007 2009 2011 2013 0 27 Alexander Creek Pike Control • Radio telemetry to study pike movements between Alexander Lake and Alexander Creek High priority pike control project Aerial Tracking 150 pike tagged -125 in the lake -25 in the creek Creek pike overwinter in the lake 9 lake pike moved into the creek • Alexander Lake pike control would be complex • Can we accomplish our goal focusing on sloughs? - All were caught in gillnets Location of Radio Tagged Pike Creek Pike Lake Pike • Yes, all pike that left the lake were Stationary caught in gillnets Receivers 28 Rotenone One of only two proven methods for eradicating fish Comes from tropical plant roots Used in the U.S. since 1930s Inhibits cellular respiration Absorbed through gills Used in small concentrations Not harmful to mammals or birds Commonly used for fisheries management throughout the world 29 Permitting Process State Process: Obtain Alaska Board Of Fish approval Receive certification to apply pesticides Obtain a NPDES permit Obtain Alaska Pesticide Use Permit Conduct a public process Federal Process: NEPA Review Preparation of environmental assessments Finding of No Significant Impact 30 Project Preparation • Bathymetric Surveys • Water Quality Monitoring • Biological Inventory • Fish Removal, Donation, and/ or Rescue • Bioassays 31 Rotenone Application 32 Rotenone Projects Cheney Lake - 2008 Arc Lake - 2008 • Small, closed lakes, formerly stocked with rainbow trout Sand Lake - 2009 Goals: Restore fisheries Learn application techniques Increase public awareness Scout Lake - 2009 • Treatments were successful • Fisheries restored Stormy Lake Northern Pike Eradication Stormy Lake - 2012 High priority pike eradication project 34 Stormy Lake Rotenone Treatment •Drainage = 240 square miles of ideal northern pike habitat •Coho productivity at risk •Outlet stream blocked with fyke nets for 10 years •Native fish restoration Stormy Lake -Largest treatment to date (400 acres/ 50’ deep) -Goal is to prevent pike from spreading to the Swanson 35 Current Rotenone Projects Otter Lake Soldotna Creek Both are high priority pike eradication projects 36 Soldotna Creek Northern Pike Eradication Treat Area One: Union, West and East Mackey and Derks Lakes and interconnecting streams Then treat Area Two: Sevena Lake, Tree Lake and Soldotna Creek (creek treated 2X) Temporary fish barriers • First treatment in large, open system •4 years to complete Goal: Prevent pike from spreading to the Moose River (where >40% of Kenai’s coho productivity occurs) 37 38 Environmental DNA (eDNA) Water samples can be used to detect aquatic species in low abundance using DNA Pike Study: •eDNA marker development for pike •Quantity of water for positive detection •Detection at different distances •Detection post-mortem •Detection pre and post-rotenone •Detection in open systems with and without pike Final high priority project that is currently underway Environmental DNA (eDNA) Northern Pike 16 non-target species* Baseline fluorescence Ct = 45 Cytochrome oxidase 1 (EluCOI) ‘F-5’CCTTCCCCCGCATAAATAATATAA3’ 40 Preliminary Results Pike Stocking Sampling Locations Near Shore 40m 10m 1m pike Submerged Cage • Pike eDNA can be detected 40 m from source • Detection probability increases closer to source • Pike eDNA does not persist longer than 1 week • More to come…. Post-mortem Where Do We Go From Here? • Update Management Plan • Continue Prioritization • Continue Education and Outreach • Continue Eradication Efforts • Continue Control Efforts • Prevent Spread • Protect Fisheries Projects Funded By: 42