Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Technology and the Human Genome
Document related concepts
Transcript
Genetic Engineering Biotechnology 2006-2007 We have been manipulating DNA for generations! • Artificial breeding – creating new breeds of animals & new crop plants to improve our food DNA Technology and the Human Genome • DNA technology has many useful applications – The Human Genome Project – The production of vaccines, cancer drugs, and pesticides – Engineered bacteria that can clean up toxic wastes A Brave New World Can we mix genes from one creature to another? YES! The code is universal • Since all living organisms… – use the same DNA – use the same code book – read their genes the same way recombinant DNA technology – a set of techniques for combining genes from different sources • recombinant DNA, in which genes from two different sources - often different species - are combined in vitro into the same molecule • These methods form part of genetic engineering, the direct manipulation of genes for practical purposes • DNA technology has launched a revolution in biotechnology, the manipulation of organisms or their components to make useful products How do we do mix genes? • Genetic engineering – find gene – cut DNA in both organisms – paste gene from one creature into other creature’s DNA – insert new chromosome into organism – organism copies new gene as if it were its own – organism reads gene as if it were its own – organism produces NEW protein: Remember: we all use the same genetic code! BACTERIA AS TOOLS FOR MANIPULATING DNA • Bacterial plasmids can serve as carriers (vectors) for gene transfer ~ a small circular DNA molecule separate from the bacterial chromosome carry extra genes that bacteria can use can be swapped between bacteria bacterial sex!! rapid evolution = antibiotic resistance can be picked up from environment Plasmids Plasmids are used to customize bacteria: An overview • Plasmids are key tools for DNA technology – Researchers use plasmids to insert genes into bacteria – makes it possible to clone genes for basic research and commercial applications • How can plasmids help us in gene cloning? • A way to get genes into bacteria easily – insert new gene into plasmid – insert plasmid into bacteria = vector – bacteria now expresses new gene • bacteria make new protein gene from recombinant other organism cut DNA plasmid + plasmid vector glue DNA transformed bacteria One basic cloning technique begins with the insertion of a foreign gene into a bacterial plasmid Enzymes are used to “cut and paste” DNA • Restriction enzymes cut DNA at specific points (the scissors) forms “sticky ends” • DNA ligase “pastes” the DNA fragments together (the glue) • The result is recombinant DNA Restriction enzymes Cut DNA at specific sites leave “sticky ends” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA Regents Biology Sticky ends Cut other DNA with same enzymes leave “sticky ends” on both can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA Regents Biology gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA sticky ends cut sites isolated gene chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA DNA ligase joins the strands sticky ends stick together Recombinant DNA molecule chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC Regents Biology CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC How can bacteria read human DNA? Why mix genes together? Gene produces protein in different organism or different individual human insulin gene in bacteria TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC “new” protein from organism ex: human insulin from bacteria aa aa aa aa aa aa aa aa aa aa bacteria Regents Biology human insulin Genes can be cloned in recombinant plasmids: A closer look • Bacteria take the recombinant plasmids and reproduce • This clones the plasmids and the genes they carry 1.Isolate DNA from two sources E. coli Plasmid – Products of the gene can then be harvested • The process of cloning a human gene in a bacterial plasmid can be divided into six steps. Bacterial clone carrying many copies of the human gene Human cell 2.Cut both DNAs with the same restriction 3. Mix the DNAs; they join enzyme by base-pairing 4.Add DNA ligase to bond the DNA covalently Recombinant DNA plasmid 5. Put plasmid into bacterium 6.Clone the bacterium 12.4 Reverse transcriptase can help make genes for cloning – Complementary DNA (cDNA) is used to clone eukaryotic genes – mRNA from a specific cell type is the template – Reverse transcriptase produces a DNA strand from mRNA – DNA polymerase produces the second DNA strand – Advantages of cloning with cDNA – Study genes responsible for specialized characteristics of a particular cell type – Obtain gene sequences without introns – Smaller size is easier to handle – Allows expression in bacterial hosts Copyright © 2009 Pearson Education, Inc. Nucleic acid probes identify clones carrying specific genes • A nucleic acid probe can tag a desired gene • binds to a gene of interest by base pairing Radioactive probe (DNA) Single-stranded DNA Mix with singlestranded DNA from various bacterial (or phage) clones Base pairing indicates the gene of interest Recombinant cells and organisms can mass-produce gene products DNA technology is changing the pharmaceutical industry and medicine • Hormones, cancerfighting drugs, and new vaccines are being produced using DNA technology – This lab equipment is used to produce a vaccine against hepatitis B Uses of genetic engineering • Genetically modified organisms (GMO) • FDA requires evidence of safety before approval – enabling plants to produce new proteins • Protect crops from insects: BT corn – corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) • Extend growing season: fishberries – strawberries with an anti-freezing gene from flounder • Improve quality of food: golden rice – rice producing vitamin A improves nutritional value RISKS AND ETHICAL QUESTIONS Could GM organisms harm human health or the environment? • Genetic engineering involves some risks – Possible ecological damage from pollen transfer between GM and wild crops – Can introduce allergens into the food supply – May spread genes to closely related organisms Pollen from a transgenic variety of corn that contains a pesticide may stunt or kill monarch caterpillars Gene therapy may someday help treat a variety of diseases • Techniques for manipulating DNA have potential for treating disease by altering an afflicted individual’s genes – Progress is slow, however – There are also ethical questions related to gene therapy The PCR method is used to amplify DNA sequences • The polymerase chain reaction (PCR) can quickly clone a small sample of DNA in a test tube • Advantages of PCR Can amplify DNA from a small sample Results are obtained rapidly Reaction is highly sensitive, copying only the target sequence • Repeated cycle of steps for PCR Sample is heated to separate DNA strands Sample is cooled and primer binds to specific target sequence Target sequence is copied with heat-stable DNA polymerase Cycle 1 yields 2 molecules Genomic DNA 3 1 3 5 5 3 Target sequence 5 5 3 Cycle 2 yields 4 molecules 5 2 Cool to allow Heat to primers to form separate hydrogen bonds DNA strands with ends of target sequences 5 3 3 5 5 3 Primer 3 5 DNA polymerase adds nucleotides to the 3 end of each primer 5 3 New DNA Cycle 3 yields 8 molecules 12.11 The analysis of genetic markers can produce a DNA profile – DNA profiling is the analysis of DNA fragments to determine whether they come from a particular individual – Compares genetic markers from noncoding regions that show variation between individuals – Involves amplification (copying) of markers for analysis – Sizes of amplified fragments are compared Copyright © 2009 Pearson Education, Inc. Biotechnology Gel Electrophoresis Many uses of restriction enzymes… • Now that we can cut DNA with restriction enzymes… – we can cut up DNA from different people… or different organisms… and compare it – why? • • • • • forensics medical diagnostics paternity evolutionary relationships and more… Comparing cut up DNA • How do we compare DNA fragments? – separate fragments by size • How do we separate DNA fragments? – run it through a gelatin – gel electrophoresis • How does a gel work? Gel electrophoresis • A method of separating DNA in a gelatin-like material using an electrical field – DNA is negatively charged – when it’s in an electrical field it moves toward the positive side DNA – “swimming through Jello” + Gel electrophoresis • DNA moves in an electrical field… – so how does that help you compare DNA fragments? • size of DNA fragment affects how far it travels – small pieces travel farther – large pieces travel slower & lag behind DNA – “swimming through Jello” + Gel Electrophoresis DNA & restriction enzyme longer fragments wells power source gel + shorter fragments completed gel fragments of DNA separate out based on size Running a gel cut DNA with restriction enzymes 1 2 Stain DNA – ethidium bromide binds to DNA – fluoresces under UV light 3 Gel electrophoresis sorts DNA molecules by size • • Separation technique: separates DNA by size and charge 1. Restriction enzymes – cut DNA I into fragments • 2. The gel – Wells made at one end. Small amounts of DNA are placed in the wells 3. The electrical field gel placed in solution and an electrical filed is set up with one neg. (-) & one pos. (+) end 4. The fragments move negatively charged DNA fragments travel toward positive end. The smaller fragments move faster. Mixture of DNA molecules of different sizes Power source Longer molecules Gel Shorter molecules Completed gel Restriction fragment analysis is a powerful method that detects differences in DNA sequences • Scientists can compare DNA sequences of different individuals based on the size of the fragments Restriction fragment analysis detects DNA differences that affect restriction sites • Radioactive probes are also used to make comparisons Uses: Forensics • Comparing DNA sample from crime scene with suspects & victim suspects S1 S2 S3 V crime scene sample – DNA + DNA technology is used in courts of law • DNA fingerprinting can help solve crimes: analyzes sections of DNA that have little or known function but vary widely from one individual to another also used for paternity tests, identifying bodies, etc.) Electrophoresis use in forensics Evidence from murder trial Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman Regents Biology “standard” DNA Fingerprinting • STEPS: use non-coding DNA 1. Sample DNA cut with restriction enzymes 2. Fragments separated by size using gel electrophoresis 3. Fragments with highly variable regions are detected with DNA probe, revealing DNA bands of various sizes 4. The pattern of bands produced is the DNA fingerprint, which is distinguished statistically form other individuals DNA fingerprint Why is each person’s DNA pattern different? sections of “junk” DNA doesn’t code for proteins made up of repeated patterns CAT, GCC, and others each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT Regents CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA Biology DNA patterns for DNA fingerprints Allele 1 cut sites repeats cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Cut the DNA GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 – DNA allele 1 Regents Biology 3 + Differences between people Person 1 cut sites cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Person 2: more repeats GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA 1 2 DNA fingerprint – DNA person 1 person 2 Regents Biology 3 + Uses: Paternity Who’s the father? Mom F1 – DNA Regents Biology + F2 child Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel – DNA + Regents Biology 1 2 3 4 5 1 2 3 4 fruitfly 5 Uses: Medical diagnostic Comparing normal allele to disease allele chromosome with normal allele 1 chromosome with disease-causing allele 2 – DNA Example: test for Huntington’s disease Regents Biology + The Human Genome Project • The Human Genome Project goals: • To determine the nucleotide sequence all DNA in the human genome • To identify the location and sequence of every human gene The Human Genome Project revealed that most of the human genome does not consist of genes • Results of the Human Genome Project • Humans have 21,000 genes in 3.2 billion nucleotide pairs • Only 1.5% of the DNA codes for proteins, tRNAs, or rRNAs • The remaining 88.5% of the DNA contains Control regions such as promoters and enhancers Unique noncoding DNA Repetitive DNA 12.20 Proteomics is the scientific study of the full set of proteins encoded by a genome – Proteomics – Studies the proteome, the complete set of proteins specified by a genome – Investigates protein functions and interactions – The human proteome may contain 100,000 proteins Copyright © 2009 Pearson Education, Inc.
