Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Gene cloning Isolate a specific gene of interest Insert into a plasmid Transfer to bacteria Grow bacteria to get many copies Express the protein product Why? Sequence the gene Study the enzyme Understand regulation Genetic screening Gene therapy …etc. human RPE65 enzyme human RPE65 gene plasmid recombinant DNA E. coli Steps in gene cloning human RPE65 gene 1) Isolate DNA including YFG 2) Join to plasmid vector (ligation) 3) Introduce into host (transformation) 4) Find correct clone 5) Express the protein product ligation plasmid recombinant DNA transformation human RPE65 enzyme E. coli 1. Isolate DNA including YFG Extract from cells Cut into manageable fragments RPE65 gene human DNA RPE65 gene Restriction digest GAATTC CTTAAG GAATTC CTTAAG cloning vector (plasmid) GAATTC CTTAAG human DNA 2. Join to plasmid vector (ligation) AATTC G G CTTAA restriction fragment “sticky” ends cloning vector (plasmid) 2. Join to plasmid vector (ligation) DNA ligase recombinant plasmid what’s missing? what enzyme should we use? 2. Join to plasmid vector (ligation) plasmid vector + human DNA fragments plasmid library 3. Introduce into host (transformation) recombinant DNA + E. coli CaCl2 or electric shock recombinant E. coli 3. Introduce into host (transformation) 3. Introduce into host (transformation) Select cells that have plasmid by antibiotic resistance agar plate with ampicillin 4. Find the correct clone How do we know which of all these colonies came from a cell that took up a plasmid carrying RPE65? 4. Find the correct clone Enzyme assay for RPE65 transretinal HPLC proteins from lysed bacteria RPE65 gene has introns; bacteria can’t splice Expression signals: Transcription: bacteria need -10 and -35 human gene has TATA, enhancers, etc. Translation: bacteria need Shine-Dalgarno human gene won’t have it ATG enhancers TATA TAG Why my clones can’t make RPE65 protein: cDNA cloning: DNA copy of RNA Spliced mRNA → coding sequence with no introns DNA nucleus mRNA cytoplasm AAAAAAAAAAAAAAA mature RNA reverse transcriptase DNA Why does it have to be DNA? cDNA cloning Purify mRNA: from what kind of cells? from where in the cell? AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA mRNA AAAAAAAAAA AAAAAAAAAA cDNA cloning Add reverse transcriptase to make cDNA AAAAAAAAAA TTTTTTT AAAAAAAAAA TTTTTTT AAAAAAAAAA TTTTTTT AAAAAAAAAA TTTTTTT AAAAAAAAAA TTTTTTT cDNA cloning Add reverse transcriptase to make cDNA cDNA cloning Ligate to a plasmid vector + cDNA cloning Transform into E. coli Find correct clone cDNA library Now could we express the protein product?? Expression vector Plasmid with transcription and translation signals -35 -10 -35 S-D EcoRI -10 S-D EcoRI RPE65 cDNA expression vector EcoRI 4. Find the correct clone Enzyme assay for RPE65 transretinal HPLC proteins from lysed bacteria Cloned gene is ready for use! purify plasmid DNA sequencing express protein etc. Cloning by PCR Polymerase chain reaction If DNA sequence is known, amplify specific gene directly RPE65 gene human DNA Cloning by PCR • Human DNA • RPE65-specific 20-nt primers • Taq DNA polymerase • dNTPs part of RPE65 5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG 3′ TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCTCC heat 5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCT 5′ heat primer 5′ CCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGA TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCT 5′ primer Cloning by PCR Cloning by PCR Once amplified, ligate and transform as before + amplified copies of RPE65 gene plasmid vector Genetic engineering Modified microorganisms: Insulin, growth hormone, clotting factors, EPO… HPV vaccine Ethanol from cellulose Oil-eating bacteria Modified plants and animals BT corn Roundup-ready soybeans Golden rice Modified humans Gene therapy