Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Lecture 6 • Experiment 3: Basic subcloning • Flowchart • Experiment 4: Light regulated genes • Principles and process of RNA isolation • Assignment 1 due next week • Discussion of Article 3 Experiment 3 • Goal: To introduce basic procedures used to manipulate DNA. • General procedures are DNA fragment isolation, ligation of DNA, transformation of bacteria, small scale DNA isolation. Lab 6 A Vector preparation B Fragment isolation DNA fragment isolation kit Lab 7 Ligation of vector and DNA fragment T4 DNA ligase How do we ligate a XhoI and Sal I site together? GTCGAC CTGCTG SalI CTCGAG GAGCTC XhoI Lab 8 A. Run ligation reactions on an agarose gel B. Transform bacteria Lab 9 Blue white selection (screen) Lab 10 and 11 • Small scale DNA isolation (Lab 2) • Restriction enzyme digestion (Lab 3) Experiment 4 • Goal: to characterize the response of light regulated genes. • Method: RT-PCR. • General take home messages: Use of RT-PCR to measure levels of transcript accumulation; use of mutants to characterize a biological process; environmental regulation of gene expression. Etiolation and det1 Experimental set up 1. wild-type grown in the light 2. wild-type grown in the dark 3. det1 grown in the light 4. det1 grown in the dark -Extract RNA -RT mRNA -PCR cDNA Picture of Plants (WT and mutant) What are the expression levels of light regulated genes (chlorophyll a/b binding proteins CHAB and CLAB) using tubulin as loading control. CHAB CLAB CHAB or CLAB TUB Isolation of RNA using Commercial Trizol Reagent Trizol:-mono-phasic solution of phenol and guanidine isothiocyanate -lyses cells and dissolves cell components while maintaining integrity of RNA Liquid N2 Trizol Homogenize Phenol Aq Isopropyl alcohol Chloroform Org Ppt RNA 75% EtOH DEPC H2O RNA Chloroform: separate aqueous and organic phases (RNA is in the top aqueous phase) Isopropanol: Precipitates RNA 75% Ethanol: Wash RNA pellet DEPC (Diethylpyrocarbonate) water: Resuspend RNA pellet in RNAse-free water DEPC interacts with the active site histidine residue of RNAse and irreversibly inactivates RNAses. Assignment 1 Group 1-1 1-2 1-3 2-1 2-2 2-3 Gel result no no YES YES no no Group 2-4 2-5 2-6 3-1 3-2 3-3 Gel result YES no no YES no no Example sequence GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGA AGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACA GAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTC CGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAA CCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGAT AAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGC CAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGG AAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATC AACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCG TGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATC CTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG Step into liquid Assignment 1 I will be available for a large-scale public consultation on Friday from 4:00PM until we are done. Bring your laptops. You can make appointments for consultation as well. Time is running out. Assignment 1 due next Monday Oct. 27, 2008 Discussion of Article 3 Taken from Hall J. C. Science Taken from Hall Science