Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Applications of Neural Networks in Biology and Agriculture Jianming Yu Department of Agronomy and Plant Genetics Introduction to Neural Networks Applications of Neural Networks in Biology and Agriculture Girl Boy How Can We Recognize a Given Schematic Face? It is a Boy? Or a Girl? That Is What A Neural Network Is All About! INFORMATION INFORMATION INFORMATION UNDERSTANDING INFORMATION INFORMATION INFORMATION UNDERSTANDING INFORMATION INFORMATION INFORMATION UNDERSTANDING Girls +1,+1,+1,-1,-1 +1,-1,+1,+1,+1 -1,+1,-1,+1,+1 -1,-1,+1,-1,-1 -1,+1,-1,+1,-1 +1,-1,+1,-1,-1 Boys Introduction of Neural Network • • • • • • Structure of a Neuron/Node Analogy of Neural Networks Definition Architecture Learning Process Constructing a Neural Network Biological vs. Artificial Human Brain Neural Network Neurons Nodes Dendrites Inputs/Sensors Axons Outputs Synapses Weights Information procession Learning by examples Generalize beyond examples What is a Neural Networks? Hidden Layer weights Input Layer Output Layer Architecture of Neural Networks Perceptron Feed-forward Feedback Learning Process • Supervised learning – Back-propagation algorithm • Least Mean Square Convergence If output too small, + / - unit weights If output too large, - / + unit weights -1.00 W1 = 0.3 -0.25 W2 = 0.2 Network Output -0.50 0.50 -1.00 W4 = - 0.5 Knowledge/ Weight Matrix W1 = 0.2 -0.25 W2 = 0.2 0.2 0.2 -0.45 -1.00 -0.45 W3 = 0.5 -1.00 0.50 Known Output W3 = 0.4 W4 = - 0.5 -0.45 0.4 -0.5 Learning Process • Supervised learning • Unsupervised learning Constructing a Supervised Neural Network • Determine architecture • Set learning parameters & initialize weights. • Code the data • Train the network • Evaluate performance Applications of Neural Networks • General Information 1. Search for a gene 2. Gene expression network 3. Kernel number prediction Applications of Neural Network • Pattern classification • Clustering • Forecasting and prediction • Nonlinear system modeling • Speech synthesis and recognition / Function approximation / Image compression / Combinational optimization • Business – Forecast the maximum return configuration of a stock portfolio – Credit risk analysis – Forecasting airline passenger booking • Medicine – Diagnosing the cardiovascular system – Electronic noses – Instant Physician Dr. Computer: You have diabetes. Please … Example 1 Coding Region Recognition and Gene Identification ATGCATATCGCACTATAGCCGCCCCGACATAGCCGCAAAT Example 1 • Sensors – Codon usage, base composition, periodicity, splice site, coding 6-tuples, etc. • Training Data – Known genes • Validating Data – Known genes • Objective – Find genes in unannotated sequence Example 1 Uberbacher, E. C. et al., 1991. Locating protein-coding regions in human DNA sequences by a mulitple sensor-neural network approach. PNAS. 88, 1126111265. Sensors Discrete exon score Example 1 • Human, Mouse, Arabidopsis, Drosophilae, E.coli • GRAIL / GRAIL EXP • http://compbio.ornl.gov/ Example 1 “With modest effort, an investigator can greatly enrich the value of the sequence under study by including descriptions of the genes, proteins, and regulatory regions that are present. Such analysis will provide a starting point to this most exciting phase of genome research” --Uberbacher, 1996 Example 2 Gene Expression Networks Off On On Example 2 • Sensors – Temperature, Day length • Training Data – Experiment • Validating Data – Molecular Maker, Microarray, Experiment • Objectives – Simulate the gene expression network – Test the developmental gene hierarchy Example 2 Welch, S. M., et al. 2000. Modeling the Genetic Control of Flowering in Arabidopsis thalina. J. of Agro. Arabidopsis thalina wildtype Temp Flower Day length Example 2 PHYB CRY2 GI FPA Temp Day length FVE CO Integration FCA Flower Example 2 light/dark 16 oC 20 oC 24 oC 8/16 hr Run 4 Run 6 Run 3 16/ 8 hr Run 2 Run 5 Run 1 Fraction Transition Fit at 24oC 1 0.8 0.6 Ler Wildtype 0.4 CO FVE 0.2 0 0 5 10 15 20 25 30 35 40 Days Fraction Transition Fit at 16oC 1 0.8 0.6 Ler Wildtype FVE CO 40 50 0.4 0.2 0 0 10 20 30 Days 60 70 Example 2 • Neural networks can be employed to model the genetic control of plant process • Nodes can be linked in one-one correspondence with networks constructed by genomic techniques • Complex phenotypic behavior can be related to internal network characteristics • GxE less readily mimicked by existing models Example 3 Example 3 Kernel Number Prediction Example 3 • Sensors Biomass: Total biomass produced during the critical period of ear elongation Population: Plant Population • Training Data – Experiment • Validating Data – Experiment • Objective – Predict the Kernel Number Example 3 Dong, Zhanshan, et al. 2000. A Neural Network Model for Kernel Number of Corn -- Training and Representing in STELLA. Corn Field Biomass Population Kernel Number Example 3 Example 3 • Corn Cultivar : Medium maturity • Automatic irrigation • Data for training • 10 years in Manhattan, KS (1990-1999) • 5 years in Parsons, KS (1995-1999) • Data for validation • 2 years in Manhattan, KS (1985-1986) Validation Data Example 3 * Actual KN Predicted KN Kernel number 800 600 400 120 200 100 0 12 10 80 8 Biomass 6 Plant Population 4 60 700 650 Example 3 Predicted KN vs. Actual KN KNPred=30.651+0.9321*KNActual 600 Predicted KN 550 500 450 400 350 * Validation data o Training data 300 250 200 200 300 400 500 Actual KN 600 700 Example 3 • Training a neural network that can effectively simulate kernel number of corn needs a wild range of data set • Neural network can simulate kernel number of corn by using total biomass produced during the critical period of ear elongation and plant population • STELLA can represent the neural network easily and efficiently Strengths • Knowledge not needed (?) • Can handle complex problems • Fairly fast run time looks at all the information at once • Can deal with noisy and incomplete data (?) • Adaptability over time, continuous learning. Weaknesses • Cannot separate correlation and causality • No explanation or justification facilities • Weights don’t have obvious interpretations (?) • No confidence intervals (?) • Requires lots of data and training time If you want to know more about Neural Network, • http://www.doc.ic.ac.uk/~nd/surprise_96/jo urnal/vol4/cs11/report.html • Neural Networks, by Herve Abdi, et al., 1999. • Neural Networks and Genome Informatics, by C. H. Wu, and McLarty, J. W., 2000 Acknowledgement • Dr. Rex Bernardo • Dr. Nevin Young • Dr. JoAnna Lamb, Jimmy Byun, Bill Peters, Marcelo Pacheco, Bill Wingbermuehle, Luis Moreno-Alvarado, Ebandro Uscanga-Mortera • APS and Agronomy Dept. • Dr. S. M. Welch, Zhanshan Dong, and Yuwen Zhang. (K-State) Research & Interest of Neural Network ? “Neural networks do not perform miracles. But if used sensibly they can produce some amazing results.” -- C. Stergiou and D. Siganos Time 1940 1960 19691970 1980 1990 2000