Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
The Course of Development The Course of Development Time Events The Course of Development Time Events The Course of Development Time Events in time The Course of Development Time Events in time The Course of Development Time Events in time and space . . . The Course of Development Time Events in time and space . . . The Course of Development Time Events in time and space . . . The Course of Development Events in time and space . . . . . . driven by patterned gene expression The Course of Development Understanding Human Development Events in time and space . . . . . . driven by patterned gene expression The Course of Development Understanding Human Development The Course of Development Understanding Human Development The Course of Development Understanding Human Development The fate of cells patterned in time and space Intrinsic control? Extrinsic control? Understanding Human Development Why so difficult? Process 9 mo – 20 yrs Generation 20 yrs Genetic recombination Uncontrolled Genetic manipulation Difficult / Impossible Genome size ~3 billion nucleotides Development Complex How to attack a problem that’s too complex? How to Attack a Complex Problem Probability of getting a full house? How to Attack a Complex Problem Probability of getting a pair? How to Attack a Complex Problem 1 · 3/51 Probability of getting a pair in 2 cards? Simplification can help in understanding complexity Understanding Human Development Why so difficult? Process 9 mo – 20 yrs Generation 20 yrs Genetic recombination Uncontrolled Genetic manipulation Difficult / Impossible Genome size ~3 billion nucleotides Development Complex Understanding Fly Development Still difficult Process ~8 9 mo days– 20 yrs Generation 20 yrs ~14 days Genetic recombination Uncontrolled Controlled Genetic manipulation Difficult / Impossible Genome size ~3 billion nucleotides ~170 million nucleotides Development Complex How to simplify further? Understanding Any Development What do we want in a model organism? Process ~8Hours days Generation ~14 Hours days Genetic recombination Controlled Genetic manipulation Difficult Easy Genome size ~170 Fewmillion millionnucleotides nucleotides Development Complex Single phenomenon Does such an organism exist? Bacteria . . . but no development Bacillus subtilis subtilis Sporulation by Bacillus Temporally regulated differentiation Bacillus subtilis subtilis Sporulation by Bacillus Temporally regulated differentiation Bacillus subtilis subtilis Sporulation by Bacillus Temporally regulated differentiation Bacillus subtilis subtilis Sporulation by Bacillus Temporally regulated differentiation Bacillus subtilis subtilis Sporulation by Bacillus Temporally regulated differentiation Development in time and space Heterocyst differentiation by Anabaena Free-living Nostoc heterocysts N2 O2 Matveyev and Elhai (unpublished) CO2 Heterocyst differentiation by Anabaena Free-living Nostoc NH3 heterocysts N2 O2 NH3 Matveyev and Elhai (unpublished) CO2 Anabaena by Anabaena Heterocyst differentiation Spatially regulated differentiation Time after nitrogen removal 0h 3h 6h 9h 12 h 18 h N2 fixation Anabaena by Anabaena Heterocyst differentiation Spatially regulated differentiation Time after nitrogen removal 0h 3h 6h 9h 12 h 18 h N2 fixation Anabaena by Anabaena Heterocyst differentiation Spatially regulated differentiation Development of pattern Time after nitrogen removal 0h 3h 6h 9h 12 h 18 h N2 fixation Mark Hill, University of New South Wales http://anatomy.med.unsw.edu.au/cbl/embryo/Notes/skmus7.htm Fruiting body formation by Myxococcus Herd motility Fruiting body formation by Myxococcus Herd development Fruiting body formation by Myxococcus Extrinsic control over development Caulobacter crescentus Cell cycle of Caulobacter Cell cycle-regulated differentiation swarmer cell Caulobacter crescentus Cell cycle of Caulobacter Cell cycle-regulated differentiation swarmer cell stalk cell Caulobacter crescentus Cell cycle of Caulobacter Cell cycle-regulated differentiation swarmer cell stalk cell Caulobacter crescentus Cell cycle of Caulobacter Cell cycle-regulated differentiation Intrinsic control over development Bacterial Development End result... much simpler Bacillus sporulation Anabaena heterocysts Myxobacteria fruiting Caulobacter cell cycle Bacillus subtilis subtilis Sporulation by Bacillus Temporally regulated differentiation Control of initiation selective gene expression How to make the decision? ? Bacterial regulation of gene expression Transcriptional factors RNA Pol DNA P RNA protein Bacterial regulation of gene expression Transcriptional factors signal DNA binding protein No Stimulus stimulus DNA Binding P site No RNA Bacterial regulation of gene expression Transcriptional factors signal DNA binding protein No Stimulus stimulus DNA Binding P site No RNA Bacterial regulation of gene expression Transcriptional factors signal No Stimulus stimulus RNA Spo0A Pol DNA Binding P site RNA protein Sporulation by Bacillus subtilis Control of initiation selective gene expression Why??? P K F P B P A ATP Spores P Spo genes KP F B P A ADP Spo genes kinA spo0F spo0B spo0A Sporulation by Bacillus subtilis Phosphorelay as an integration processing device Cell density P K P F P ? B Control by phosphatases P P A ATP Spores P Spo genes KP F B P A ADP Spo genes kinA spo0F spo0B spo0A - Cell cycle - DNA damage - Nutrient status Sporulation by Bacillus subtilis Control of initiation of development • Integration of signals through signal transduction • Centers on phosphorylation of master protein • DNA binding protein regulates transcription Bacillus subtilis subtilis Sporulation by Bacillus Temporally regulated differentiation Control of timing by selective gene expression Set 0 Set II Set V Set IV Set III Fore-spore Mother cell Promoter recognition by sigma factors Sigma factor RNA polymerase core enzyme ' Figure from Griffiths et al (1996) Introduction to Genetic Analysis, 6th ed., WH Freeman and Co. Promoter recognition by sigma factors Figure from Griffiths et al (1996) Introduction to Genetic Analysis, 6th ed., WH Freeman and Co. Promoter recognition by sigma factors Figure from Griffiths et al (1996) Introduction to Genetic Analysis, 6th ed., WH Freeman and Co. Promoter recognition by sigma factors uvrB recA rrnAB str rpoA Repair DNA damage DNArecombination RibosomalRNA Ribosomal protein RNA polymerase A TTGTTGGCATAATTAAGTACGACGAGTAAAATTAC ATACCT CACTTGATACTGTA.TGAGCATACAGTATAATTGC TTCAACA CTCTTGTCAGGCCG.GAATAACTCCCTATAATGCGCCACCACTG TTCTTGACACCTT.TCGGCATCGCCCTAAAATTCG GCGTCG TTCTTGCAAAGTTGGGTTGAGCTGGCTAGATTAGC CAGCCA TTGaca TAtAaT R Promoter recognition by sigma factors TTGaca uvrB recA rrnAB str rpoA Kp nifE Kp nifU Kp nifB Kp nifH Kp nifM Kp nifF Kp nifL glnA P2 Repair DNA damage DNArecombination RibosomalRNA Ribosomal protein RNA polymerase nitrogenase accessory nitrogenase accessory nitrogenase accessory nitrogenase nitrogenase accessory nitrogenase accessory nitrogenase regulat’n glutamine synthetase TAtAaT R TTGTTGGCATAATTAAGTACGACGAGTAAAATTAC ATACCT CACTTGATACTGTA.TGAGCATACAGTATAATTGC TTCAACA CTCTTGTCAGGCCG.GAATAACTCCCTATAATGCGCCACCACTG TTCTTGACACCTT.TCGGCATCGCCCTAAAATTCG GCGTCG TTCTTGCAAAGTTGGGTTGAGCTGGCTAGATTAGC CAGCCA N CTTCTGGAGCGCGAATTGCA TCTTCCCCCT TCTCTGGTATCGCAATTGCT AGTTCGTTAT CCTCTGGTACAGCATTTGCA GCAGGAAGGT CGGCTGGTATGTTCCCTGCACTTCTCTGCTG TGGCTGGCCGGAAATTTGCA ATACAGGGAT AACCTGGCACAGCCTTCGCA ATACCCCTGC ATAAGGGCGCACGGTTTGCATGGTTATCACC AAGTTGGCACAGATTTCGCTTTATCTTTTTT CTGG-A TTGCA Sigma factors in sporulation Housekeeping Sigma-A A H A A A H Starvation (and other signals) Stage 0 Starvationspecific Sigma-H Sigma factors in sporulation Mother-specific Mother cell Sigma-E E Forespore A H F A E A A Stage II/III H F Foresporespecific Sigma-F Sigma factors in sporulation Uniform presence of inactive sigma precursors E A A H E A F A F E H F Starvation (and other signals) Stage 0 Sigma factors in sporulation Selective activation of sigma precursors Active motherspecific Sigma-E E A H E A F F A A Stage II/III E H F Active foresporespecific Sigma-F Sigma factors in sporulation Cascade of sigma factors Late motherspecific Sigma-K K G E F A K E G F A Starvation Stage (and other IV signals) Stage III Late foresporespecific Sigma-G Sporulation by Bacillus subtilis Control of timing by selective gene expression • Determined by specific, active sigma factors • Presence and activation important • Activation linked to morphological events Anabaena by Anabaena Heterocyst differentiation Spatially regulated differentiation How to find regulation of pattern? Time after nitrogen removal 0h 3h 6h 9h 12 h 18 h N2 fixation Genetic approach to Cell Biology Genetic approach to Cell Biology Genetic approach to Cell Biology Genetic approach to Cell Biology Genetic approach to Cell Biology Genetic approach to Cell Biology Genetic approach to Cell Biology Genetic approach to Cell Biology Genetic approach to Cell Biology Isolation of Defective Gene Anabaena by Anabaena Heterocyst differentiation Spatially regulated differentiation How to find regulation of pattern? Time after nitrogen removal 0h Rare mutants 3h hetR 6h 9h 12 h 18 h N2 fixation Many mutants Anabaena by Anabaena Heterocyst differentiation Spatially regulated differentiation How to find regulation of pattern? hetR (wild-type) hetR- +N -N +N -N hetR +N -N Gene expression? Gene fusions to monitor expression hetR Regulation hetR gene 5’-GTA 3’-CAT ..(8).. ..(8).. TACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN ATGNNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN RNA Polymerase Reporter gene 5’-GTGAGTTAGCTCACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN 3’-CACTCAATCGAGTGNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN GTA ..(8).. TAC Gene fusions to monitor expression hetR Regulation Reporter gene 5’-GTA 3’-CAT ..(8).. ..(8).. TACNNNNNNNNNNTANNNTNNNNNNNNNN NNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN ATGNNNNNNNNNNATNNNANNNNNNNNNN NNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN RNA Polymerase GTA ..(8).. TAC Detection of hetR gene expression through Green Fluorescent Protein The hydromedusa Aequoria victoria Source of Green Fluorescent Protein Expression of hetR during differentiation Weak and patchy Expression of hetR after differentiation Strong and focused Expression of hetR after differentiation hetR+ hetR expression hetR hetR- (wild-type) hetR0 HetR hetR (wild-type) Hrs after -N 18 HetR is required for its own induction! Feedback Induction Other examples: spo0A eve Feedback Regulation Temperature Feedback Inhibition Stability Temperature Feedback Induction All-or-none Feedback Regulation Alan Turing’s Reaction-Diffusion Model color + R D Marcelo Walter, U Br Columbia Feedback Regulation Alan Turing’s Reaction-Diffusion Model color + R D Initiation Giraffe Marcelo Walter, U Br Columbia Model Feedback Regulation Alan Turing’s Reaction-Diffusion Model Pattern emerging from random initiation Feedback Regulation Alan Turing’s Reaction-Diffusion Model Pattern emerging from random initiation Feedback Regulation Alan Turing’s Reaction-Diffusion Model color + R hetR D What is the diffusible inhibitor? Heterocyst differentiation by Anabaena How to find the hypothetical diffusible inhibitor? genome (chopped) plasmid ? Encodes diffusible inhibitor? Heterocyst differentiation by Anabaena The nature of the hypothetical inhibitor (typical size of gene) PatS Active part of sequence MLVNFCDERGSGR Is PatS the predicted diffusible inhibitor? Heterocyst differentiation by Anabaena The nature of the hypothetical inhibitor color + RGSGR + hetR R D + RGSGR + patS- HetR HetR hetR Heterocyst differentiation by Anabaena The nature of the hypothetical inhibitor +N -N +N -N patS+ (wild-type) patS - Multiple heterocysts But not ALL heterocysts Heterocyst differentiation by Anabaena Frequency of occurrence The nature of the hypothetical inhibitor 30 wild type 25 20 15 random 10 5 0 0 5 10 15 Intervening vegetative cells 20 Nonrandom spacing Heterocyst differentiation by Anabaena Frequency of occurrence The nature of the hypothetical inhibitor 30 wild type 25 20 patS 15 random 10 Heterocyst distribution is affected 5 0 0 5 10 15 Intervening vegetative cells 20 But it’s not RANDOM Heterocyst differentiation by Anabaena A natural example of the Turing model? • Differentiation regulated by R-like protein, HetR • Differentiation regulated by D-like protein, PatS • Pattern is not completely determined by HetR and PatS Bacterial Development End result... much simpler Bacillus sporulation Anabaena heterocysts vs Myxobacteria fruiting Caulobacter cell cycle How to understand complexity? How to understand complexity?