Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop John Fossella, PhD Sackler Institute Tool #1: Genome Sequence Databases The Human Genome Project TIGR: 1 microbe per day: Sargasso Sea Tool #2: Human Genome Variation Databases Patient Group ….AGTGTTCGATAGCTGTTGAC ATGATCGCTGTCGCTAATCTCG CTACACACACCACAGAATGACA ATGATCGCTGTCGCTAATCTCT TTTCATAGACCACAGATTGACC ATGATCGCAGTCGCAGATCTCT CTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCT TTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCT CGGCTTAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCT CTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT……. Control Group ….AGTGTTCGATAGCTGTTGAC ATGATCGCTGTCGCTAATCTCG CTTCATAGATCACAGAATGACA ATGATCGCTGTCGCTAATCTCT TTTCATAGACCACAGATTGACC ATGATCGCAGTCGCTAATCTCT CTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCT TTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCT CGGCATAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCT CTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT……. Tool #3: Genetic Origins of Psychopathology Neuregulin RGS4 Neuroligin 5HTT Calcineurin DYX1C1 DRD4 FMRP MAOA GPR56 –Schizophrenia -Schizophrenia -Autism -Anxiety, Depression -Schizophrenia –Reading disorder –ADHD -Fragile X –Aggression -Frontal cortex structure Tool #4: Brain Gene Expression Databases Tool #5: Mouse Models of Brain Development and Behavior QuickTime™ and a Photo - JPEG decompressor are needed to see this picture. “The LIMhomeobox gene Lhx8 is required for the development of many cholinergic neurons in the mouse forebrain” Zhao et al. (2003) PNAS 100 (15) pp. 9005-9010 Tool #6: High Throughput Genotyping The Scientist Volume 17, June 2003 Whole-Genome SNP Genotyping Four highly parallel approaches make the technically intractable a reality QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Hariri et al., (2002) Science QuickTi me™ and a TIFF ( Uncompressed) decompressor are needed to see thi s pi ctur e. There are many issues to consider When designing a behavioral or imaging-genetics study: What phenotype(s) ? a chance to integrate multiple levels of analysis Population Structure & Study design ? families, volunteers & patients What genetic markers or candidate genes ? biological pathways Genotyping technology cost & convenience Statistical analysis and reporting of data statistical nightmare, biology can light the way A few grant writing and IRB issues Goal of the Genetics Workshop: Impart an understanding of: 1. 2. 3. 4. 5. The molecular nature of DNA Of the structure of a gene & genome Of variation in the genome Of the historical origins of variation How 1-5 are used in the design of studies The molecular structure of DNA How many bases ? How many genes ? How many variable sites ? Goal of the Genetics Workshop: Impart an understanding of: 1. 2. 3. 4. 5. The molecular nature of DNA Of the structure of a gene & genome Of variation in the genome Of the historical origins of variation How 1-5 are used in the design of studies What is a gene ? The Central Dogma Goal of the Genetics Workshop: Impart an understanding of: 1. 2. 3. 4. 5. The molecular nature of DNA Of the structure of a gene & genome Of variation in the genome Of the historical origins of variation How 1-5 are used in the design of studies 3 million polymorphic sites Single Nucleotide Polymorphisms (SNPs) …AGTTCGATTGCTCGATAGCACGAT… …AGTTCAATTGCTTGATAGCACGAT… …AGTTCGATTGCTTGATAGCTCGAT… Repeats …AGTTCAATTGCTTGATAGCGCGAT… …AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT… Deletions …AGTTCAATTGATAGCGCGAT… Protein Structure Polymorphisms Polymorphisms in the DRD4 gene Glu CB1, BDNF D2short DRD4 mGlu MAOA DA MAOA COMT DA facilitates NMDA and Ca++ influx (permits weight change) DA Receptor G-protein Beta-arrestin Protein Structure Valine / Methionine Polymorphisms in the COMT gene QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. Gene Regulation Polymorphisms 5HTT “long” allele lower 5HT 5HTT “short” allele higher 5HT Why are carriers of the 5HTT “short” allele more susceptible to affective disorders ? Goal of the Genetics Workshop: Impart an understanding of: 1. 2. 3. 4. 5. The molecular nature of DNA Of the structure of a gene & genome Of variation in the genome Of the historical origins of variation How 1-5 are used in the design of studies 3 million polymorphic sites Single Nucleotide Polymorphisms (SNPs) …AGTTCGATTGCTCGATAGCACGAT… …AGTTCAATTGCTTGATAGCACGAT… …AGTTCGATTGCTTGATAGCTCGAT… Repeats …AGTTCAATTGCTTGATAGCGCGAT… …AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT… Deletions …AGTTCAATTGATAGCGCGAT… DNA Replication “Mistakes” The collection of “mistakes” is an history book of evolution Human Bonobo Chimpanzee GTGATGAC GTGCTGAC GTGCTGAC C to A change T to C change A to G change Gorilla GTGCTGAT Orangutan ATGCTGAT “Mitochondrial Eve” & Y-chromosomal Adam Goal of the Genetics Workshop: Impart an understanding of: 1. 2. 3. 4. 5. The molecular nature of DNA Of the structure of a gene & genome Of variation in the genome Of the historical origins of variation How 1-5 are used in the design of studies Efficient Executive Attention Group ….AGTGTTCGATAGCTGTTGAC ATGATCGCTGTCGCTAATCTCG CTACACACACCACAGAATGACA ATGATCGCTGTCGCTAATCTCT TTTCATAGACCACAGATTGACC ATGATCGCAGTCGCAGATCTCT CTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCT TTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCT CGGCTTAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCT CTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT……. Poor Executive Attention Group ….AGTGTTCGATAGCTGTTGAC ATGATCGCTGTCGCTAATCTCG CTTCATAGATCACAGAATGACA ATGATCGCTGTCGCTAATCTCT TTTCATAGACCACAGATTGACC ATGATCGCAGTCGCTAATCTCT CTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCT TTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCT CGGCATAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCT CTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT……. How do we know that the yellow T influences variation in executive attention ? Pedigree, family-based design “T” Case-control design: Qualitative trait 5% “T” 60% “T” Efficient Executive Attention Group Poor Executive Attention Group Case-control design: Qualitative trait 5% “T” 60% “T” Efficient Executive Attention Group Poor Executive Attention Group Case-control design: Qualitative trait 5% “T” 60% “T” Efficient Chopstick Dexterity Group Poor Chopstick Dexterity Group Allele “T” Case-control design: Quantitative trait Allele 1 Asian Non-asian Attentional Efficiency Allele “T” Case-control design: Quantitative trait Allele 1 Asian Non-asian Dexterity with chopsticks (rare) between group vs. (abundant) within group variation There are many issues to consider When designing a behavioral or imaging-genetics study: What phenotype(s) ? a chance to integrate multiple levels of analysis Population Structure & Study design ? twins, families, volunteers & patients What genetic markers or candidate genes ? biological pathways Genotyping technology cost & convenience Statistical analysis and reporting of data statistical nightmare, biology can light the way A few grant writing and IRB issues Roche Genetics Education Online Course http://www.roche.com/home/science/sci_gengen/sci_gengen_cdrom/sci_gengen_cdrom_online.htm National Genographic’s Genographic Project https://www5.nationalgeographic.com/genographic/atlas.html