Download Chapter 13: Genetic Engineering How could you get a desired trait

Chapter 13:
Genetic Engineering
How could you get a desired trait without
directly manipulating the organisms’ DNA?
• Selective Breeding
- choosing organisms with desired
traits to produce the next generation
• Breeding the winners of a horse race
(Smarty Jones)
• Selecting a person with a certain eye
color or features
• Taking the seeds from the
Great Pumpkin
Hybridization
• Crossing organisms of different traits to
produce a hardier product
Ex. A mule is a cross of a horse and a donkey
– Sturdy and surefooted
Hybrid corn – tastes good and is more
resistant to disease.
Inbreeding
• Maintaining the present genes by
breeding only within the population
• Ex. Pedigree animals
• Risk with dipping into the same gene
pool and recessive traits showing
up that may be lethal or harmful.
Inducing mutations
By using known mutagens, attempt to
force mutations to occur
• Radiation & Chemicals
• Not a sure bet nor do you know what
you are going to get
• Polyploidy (3N or 4N) plants have
resulted from this – larger & hardier
Glofish: the first genetically modified
animal to be sold as a pet
Now let’s manipulate the genes
by altering the organism’s DNA
• DNA Technology – science involved in the
ability to manipulate genes/DNA
• Purpose:
– Treat disease (Cystic Fibrosis)
– Treat genetic disorders (Hemophilia, diabetes)
– Improve food crops (better tasting, longer
shelf life, fungus resistance…)
– Improve human life in general
– Forensic purposes
The Tools:
• DNA Extraction – Chemical procedure (we did
this) to isolate DNA
• Restriction enzymes – molecular scissors that
cut DNA at specific nucleotide sequences
• Gel Electrophoresis – method to analyze
fragments of DNA cut by restriction enzymes
through a gel made of agarose (molecular
sieve)
• DNA Ligase – molecular glue that puts pieces of
DNA together
• Polymerase Chain Reaction (PCR)- molecular
copy machine. Makes millions of copies of
DNA/hr
Let’s suppose that you are a diabetic and
can not make your own insulin. What are
you to do?
• Inject insulin of course but from what
source?
• Old method was to use sheep insulin.
Costly and labor intensive also tough
on the sheep
• New method: Let bacteria with a
human insulin producing gene make it
for you
The New Method:
• Transformation of a bacterium to
produce human insulin
1. Extract the insulin producing
gene from a healthy human
2. Using a restriction enzyme, cut
the insulin producing gene out of
a the DNA
What are restriction enzymes?
• Bacterial enzymes – used to cut bacteriophage
DNA (viruses that invade bacteria).
• Different bacterial strains express different
restriction enzymes
• Restriction enzymes recognize a specific short
nucleotide sequence – Recognition site
• For example, Eco RI recognizes the sequence:
• 5’ - G A A T T C - 3’
• 3’ - C T T A A G - 5’
• Palindrones same base pairing forward and
backwards
Let’s try some cutting:
•
Using this piece of DNA, cut it with Eco RI
G/AATTC
5` GACCGAATTCAGTTAATTCGAATTC
3` CTGGCTTAAGTCAATTAAGCTTAAG
5` GACCG/AATTCAGTTAATTCG/AATTC
3` CTGGCTTAA/GTCAATTAAGCTTAA/G
What results is:
• GACCG AATTCAGTTAATTCG AATTC
• CTGGCTTAA GTCAATTAAGCTTAA G
Sticky end
Sticky end - tails of
DNA – easily bind
to other DNA
strands
Blunt & Sticky ends
• Sticky ends – Creates an overhang. Bam HI
• Blunts- Enzymes that cut at precisely
opposite sites without overhangs. SmaI is
an example of an enzyme that generates
blunt ends
3. Cut cloning vector:
Carry the desired gene
• Use bacterial plasmids
– Plasmids will be cut with the same
restriction enzyme used to cut the
desired gene
• 4. Ligation - Donor gene (desired gene) is then
spliced or annealed into the plasmid
using DNA ligase as the glue.
Recombinant DNA - DNA with new piece
of genetic information on it
• 5. Plasmid is then returned to bacterium and
reproduces with donor gene in it.
Transgenic organism – organism with
foreign DNA incorporated in its
genome (genes)
• 6. Bacterium reproduces and starts producing
human insulin gene which we harvest from them.
Recombinant DNA
Donor
Gene
Practical Use of DNA technology
1. Pharmaceutical products – insulin,
HBCF (human blood clotting factor),
Human Growth Hormone
2. Genetically engineered vaccines – to
combat viral infections (pathogenic –
disease causing) – your body
recognizes foreign proteins, produces
antibodies. Introduced viral proteins
will trigger an immune response and
the production of antibodies
3. Increasing agricultural yields –
– New strains of plants – GMO – Genetically
modified organism
– Insect resistant plants – Insert gene that digests
larvae when larvae try to eat the plant – Not
always specific to harmful species!! – Monarch
problem
– Disease resistance – Fungal resistance in
tomatoes, corn, soybean
– Herbicide resistance - *Round Up won’t harm the
good plants, only the bad plants (weeds) –
cheaper and less labor extensive than weeding
– Getting genes from Nitrogen fixing bacteria
inserted into plants – fix their own nitrogen (a
must for plants) in N poor soils
– Salt tolerant plants – can grow plants where high
concentrations of salt in the air or soil
• Improve quality of produce
- Slow down the ripening process –
ship when un-ripened, to market
when ripe – Flava Sava gene
- Enhance color of produce
- Reduce hairs or fuzz on produce
- Increase flavor
- Frost resistance
Drought resistance
The negatives
• Problem with transgenic foods is that an
introduced gene may produce a protein that
someone may be sensitive to.
• FDA does not require that on a label (here in
the US)
• If a label starts with a “(8), then it’s a GMO
product – 84011 = GMO banana
• Also, may create “superweeds” that cross
pollinate with others & may take over
environment
Cloning
•
•
Growing a population of genetically
identical cells from a single cell.
1997 - Ian Wilmut with Dolly, the cloned
sheep
1. Remove nucleus from egg cell
2. Fuse de-nucleated cell with a body cell from
another adult
3. Cells fuse to become 2N and then divides
4. Implant embryo in reproductive system of
foster mother
Hello Dolly!
DNA Fingerprinting
• Using cut DNA at specific sites to
determine the source of the DNA.
• Analyzes sections of DNA that have
little to no function but vary greatly
from one person to the next (called
repeats)
• RFLP analysis – We’ll do this in lab
Restriction Fragment Length
Polymorphism
How is it done?
•
1.
2.
3.
4.
5.
6.
7.
RFLP analysis – Restriction fragment length
polymorphism. We each have non-coding segments on
our DNA. (Old genes)
Extract DNA sample from blood or tissues
Cut DNA using restriction enzymes. Fragment lengths
varies with each person
Separate fragments by gel electrophoresis – separates
DNA fragments by the # of base pairs (length of the
fragment) and charge
Place DNA sample into wells in the agarose gel –
molecular sieve
Run a current through the gel. The DNA (negatively
charged) will migrate from (-) to (+)
The larger fragments will not migrate that far. The small
fragments will go the furthest.
Stain gel and bands in a dye or use a radioactive probe
to analyze the banding
• Electrophoresis “electro” = electricity “phoros” = to carry
across
• Makes it possible to determine the genetic differences and
the evolutionary relationship among species of organisms
• Method that separates macromolecules (Nucleic acids or
proteins) on the basis of size, electric charge and other
physical properties
Who did it? Suspect #1 or #2
• #1’s fingerprint matches the
evidence left.
• Neither Suspect #2 nor the
Victim matches #1.
• Therefore, #1 did it!!
• Your repeats are inherited from your parents
Shown below are the repeat patterns for the Mom [blue], &
the Dad [yellow]
• Their four children:
– D1 (the Mom and Dad’s biological daughter)
– D2 (the Dad’s step-daughter, child of the Mom and her
former husband [red])
– S1 (their biological son)
– S2 (their' adopted son, not biologically related [his
parents are light and dark green]).
Gene Therapy
• Treatment of a genetic disorder (like
cystic fibrous) by correcting a defective
gene that causes a deficiency of an
enzyme.
• Nasal spray that carries normal enzyme
gene. Body makes enzyme and patient
breathes normally. Regular treatments
necessary
• Has not been proven to be successful
in the long term
1.
2.
3.
4.
The healthy gene is inserted into a virus (retrovirus).
The (retro)virus is inserted into the patient (by injection or inhalation).
The (retro)virus enters the unhealthy cells and transfers the healthy
gene into the unhealthy cells' DNA.
Now when the cells divide, the new cells will contain the healthy gene.