Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Genetics and Biometrics Definitions Locus The position of a coding or non coding genetic element Gene All the nucleotide elements required for the expression of a transcript Promoter, ORF, introns, exons, etc. Genetic Definitions (Cont’d) Allele Version of a genetic element at a given locus Everyone locus necessarily has two alleles for each genomic – The two alleles may be the same Homozygotes – The two alleles may be different Heterozygote A population of individuals may have multiple alleles of a genomic locus Genetic Definitions (Cont’d) Genotype: Nucleic acid sequence responsable for the phenotype Physical detection by molecular techniques Phenotype: Trait that can be distinguished resulting from a genotype Several different genotypes may have the same phenotype The Differences Between individuals of the same sex <0.5% Between <2% humans and chimpanzes Molecular Markers Characteristics of the nucleotide sequence The phenotype often corressponds to a specific genotype Restriction polymorphisms (RFLP) Length polymorphisms (VNTR) Variable Single number of tandem repeats nucleotide polymorphisms (SNP) 6 Length Polymorphisms - RFLP Based on the presence or absence of a restriction site at a given poistion Ex. The enzyme EcoR1 recognizes and cleaves the sequence: GAATTC A single base mutation abolishes the site GAGTTC 7 Detection of Genomic RFLP Polymorphism E A E B E E 1 Genome 1 * A+B E 2 Genome 2 2 possible phenotypes – 2 alleles can be distinguished – Several possible genotypes 8 Detection of RFLP by PCR Length Polymorphisms Minisatellites and Microsatellites: Sequences repeated in tandem Highly variable number of repetitions between individuals; thus several alleles Length polymorphisms Molecular phenotype=Genotype Minisatellites Low distribution throughout the genome Mostly found within telomeres Microsatellites: High distribution throughout the genome VNTR 10 VNTRs The = = = = number of repetitions different lengths different alleles different genotypes different molecular phénotypes 11 Length Polymorphisms - VNTR DNA Region where tandem copies of di-, tri- or tetra repeated units are located Examples: Dinucleotide repeat GTGTGTGTGTGT…… Trinucléotide repeat ACGACGACGACG…… Tetranucléotide repeat TATCTATCTATC…… 12 VNTR (Cont’d) Highly variable number of repetitions individuals Thus several alleles within a population Allele 1 CA CA CA CA CA CA Allele 2 CA CA CA CA CA CA CA Allele 3 CA CA CA CA CA CA CA CA CA CA CA CA Different fragment lengths would be generated by a digestion at the indicated positions 13 Detection of VNTR by PCR Individual 1 AGCTGCTTAATGCTGCTGCTGCTGCTGCTGCATAACATTGC Individual 2 AGCGGCTTAATGCTGCTGCATAACATTGC 1 2 Amplification & gel separation 14 Biometrics 15 VNTR Profile of Nuclear Genome From whom does the blood come from? 16 VNTR Profile of Nuclear Genome Bob Marc Luc Paul Tom Who is Bob’s father? 17