Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Document
Document related concepts
no text concepts found
Transcript
Genetics …in the news. Mutations …are heritable changes in base sequences that modify the information content of DNA. Wild-type Alleles two definitions • General: any allele existing at a frequency greater than 1% in a natural population, • Experimental Geneticist: the one allele that dictates the most commonly found phenotype in a population. • Forward mutation: any change that changes a wildtype allele to a different allele… A+ --> a recessive mutation • Reverse mutations: novel mutant alleles can revert back to wild-type… b+ --> B dominant mutation a --> A+ , B --> b+ reversions Mutant Classifications …by their effect on DNA Substitutions Mutagenic Agents Base Analogs Intercalating Agents Deaminating Agents Alkylating Agents To Know Mutant Classifications …by their effect on DNA i d deletions and insertions 1 base? 2 base? 3 base? etc. Frameshifts Mutant Classifications …by their effect on DNA inversions translocations Trinucleotide Repeat Expansions FMR1 Fragile X Mental Retardation 1 ...GCGCGGCGGTGACGGAGGCGCCGC TGCCAGGGGGCGTGCGGCAGCG... cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg …CTGGGCCTCGAAGCGCCCGCAGCCA cgg cgg cgg cgg ... cgg cgg cgg cgg > 230 Ames Test testing for mutagenicity More mutagenic? Barbecue beef Iceberg Lettuce Cold Beer enhancer, silencer, core promoter? ? ? ? ? ? AAUAAA 5’ 3’ 5’ 3’ 5’ 5’ 5’ N- 3’ -C Transposable Elements …a segment of DNA that can move to, or move a copy of itself to another locus on the same or a different chromosome (hopping DNA), …may be a single insertion sequence, or a more complex structure (transposon) consisting of two insertion sequences and one or more intervening genes. Transposable Elements Inverted repeats. Transcribed genes. Transposition normal gene, normal RNA, normal protein, transposon inserted in gene, abnormal RNA, abnormal protein, loss of function. Transposons Other genes. Two transposable elements flanking other DNA, the whole complex ‘hops’. ? ? ? ? ? ? AAUAAA 5’ 3’ 5’ 3’ 5’ 5’ 5’ N- 3’ -C Assignments • Chapter 7: Problems 7.1 - 7.12, • Monday: Prokaryotic Genetics, 8.1 - 8.3s
Related documents