Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Chapter 17.7 Point mutations can affect protein structure and function What we are learning today! Mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in an encoded protein In other words, MUTATIONS are BAD for us & GOOD for us Pink dolphins in the Amazon Mutant Fruit Flies Mutant Frog Human Phalangial Polydactyly Trisomy 21 POP QUIZ What is a chromosomal mutation? 2. When does chromosomal mutation occur? (hint mitosis/meiosis) 3. Definition of Aneuploidy & Polyploidy? 4. Definition of Monosomic & Trisomic? 5. Definition of Deletion & Duplication? 6. Define inversion & translocation? 1. Chromosomal mutation Occur during meiosis causing either a change in the chromosome number or an alteration of a chromosome. Nondisjunction • pair of homologous chromosomes don’t move apart •Aneuploidy: Xtra copy or one less copy •Trisomic: Chromosome in triplicate (nonlethal) •Monosomic: Chromosome missing (always lethal) •Polyploidy: more than 2 complete chromosome sets in a cell Alteration of Chromosome Cri-du-Chat <kree doo shah> Gene Mutation: pg: 328-330 Mutation: Change in the genetic material of a cell Occur on DNA/RNA levels that causes changes in proteins 2 main types: Point mutations: Chemical changes in just one base pair of a gene Frameshift mutations: Number of nucleotides added or deleted not a multiple of 3; cause improper grouping of codons Point Mutations Substitution: replacement of one nucleotide pair Silent mutation: doesn’t affect encoding of protein Missense mutation: still encodes of an amino acid but it may not be the right one. Nonsense mutation: creates a stop codon Sickle Cell Anemia The genetic disorder is due to the mutation of a single nucleotide, from a GAG to GTG codon mutation. Frameshift Mutations Insertions: addition of one or more nucleotides Deletion: removal of one or more nucleotides Mutagens Physical and chemical agents that interact with DNA in ways that cause mutations Take Home Message Mutations can be: GOOD: ○ Genetic Variations & phenotype differences BAD: ○ Cause disease, sickness, or death Activity Number 1 5’TGGAGCCTTCTGATGCCTAACGTACGT3’ Number 2 5’TGCTCGCTCCTAATACCAGAGGTGCGG3’