Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR, Meadwestvaco, Evadale Texas Stormwater and stormwater outfalls Common sources of Industrial Stormwater Pollution Holding ponds that have overflow to the environment E.coli The mill was exceeding the water quality maximum of 328 (MPN)/100 mL E.coli lives in the gut and is an indicator organism for fecal matter. There are pathogenic strains such as Escherichia coli O157:H7, which can cause illness. The company contacted Lamar’s Biology department and Dr. Kucknoor to determine if the E.coli had a Human origin or Animal origin. Objectives To determine bacterial counts on stormwater drainage samples To determine if the bacteria is E.coli To determine the possible source of E.coli (human or non-human origin) Step 1: Colilert MPN test Results from Colilert MPN test. Samples #s I batch II batch III Batch 24h 48h 24h 48h 24h 48h #7 4/5 4/5 1/5 1/5 1/5 1/5 #10 5/5 5/5 2/5 5/5 3/5 3/5 # 17 3/5 4/5 5/5 5/5 3/5 3/5 #27 5/5 5/5 5/5 5/5 0/5 0/5 #29 3/5 4/5 2/5 5/5 4/5 4/5 #35 0/5 5/5 3/5 4/5 4/5 4/5 # 37 - - 5/5 5/5 2/5 2/5 Red colored numbers indicate that the tubes showed fluorescent cultures. Step 2: Durham’s fermentation test Presence of E.coli The test looks for acid and gas production at 42◦C to conclude the presence of E. coli in samples. The color change in samples #27, and #35 is positive for E.coli. #10 shows growth but not from E.coli Step 3: Streaking on EMB agar plate EMB agar plate is selective for E.coli Two samples that were positive: #27 & #35 were streaked One sample that was negative: #35 was also streaked for comparison. Problems of detecting the source of E.coli Cannot determine origin of E.coli (i.e, whether it is of human origin or non-human origin) Instead Use “Bacteroides” species that are associated with E.coli to determine the source. Isolated total DNA from water samples and amplified the uidA gene specific to E.coli, and also primers specific to Cattle Bacteroides and Human Bacteroides (as done by others in literature) Primers used to detect E.coli and Bacteroides from humans and cattle Bac32F 5 5’AACGCTAGCTACAGGCTT 3’ Bac708R 5’CAATCGGAGTTCTTCGTG 3’ HF183F 5’ATCATGAGTTCACATGTCCG 3’ CF128F 5’CAAACYTTCCCGWTAACT 3’ uidA1318F 5’CCGATCACCTGTGTCAATGT 3’ uidA1698R 5’GTTACCGCCAACGCGCAATA 3’ (Microbial source tracking : http://www.microbe.com/index.php/Overview/m st-mbts-overview.html) Step 4: Gel electrophoresis of PCR products PCR products were obtained from the 3 samples gel electrophoresis shows the thick bands in lanes 2 and 4, corresponding to the primers amplifying uidA gene in E.coli The bottom half of the gel shows bands corresponding to genes specific to cattle Bacteroides Conclusive results Based on the results, it can be concluded that sample #27 and #35 had E. coli contamination, which may have a probable cattle or non-human origin. All PCRs from DNA samples showed NO presence of E. coli pathogenic strain O157:H7 Thank You for your time! Questions?