Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download No Slide Title
Document related concepts
no text concepts found
Transcript
Trumpet leaves and microRNA Catherine Kidner CSHL Patterning events happen very early in leaf development Processes in leaf development Down regulation of meristem-specific genes Establishment of axis Growth and cell differentiation Stages of leaf development Arabidopsis thaliana flower silque (fruit) lateral shoot cauline leaf rosette leaf 5 Chromosomes 125 Mega bases of DNA First plant genome sequenced (2001) Patterning events happen very early in leaf development Trichome (hair) Interlocking epidermis Leaf blade expanding Petiole Genes involved in leaf development STM AS1 YABBY (FIL) KANADI PHB Mutations in ARGONAUTE1 Cause Developmental Defects Relative size Stem cell defects Organ identity defects Organ polarity defects Mapping Mutations in Arabidopsis Populations of Arabidopsis Two lab strains Landsberg Most ‘classical’ mutants Easiest to transform originally Compact, so easy to work with Columbia Most new insertion lines Easiest to transform now Full genome sequence CAPs markers exploit the variation between the two strains Ler Dde1 catcgtcggggacttagatgtatatatatcgctgt cttag Col-0 catcgtcggggagttagatgtatatatatcgctgt CAPS mapping Self F1 F2 Plants ago-12/ago1-12 +/+ Wild type siblings ago-12 phenotype L/L L/L L/L C/L C/L C/C The Role of ARGONAUTE The ARGONAUTE family RG-rich RG-rich PAZ PAZ PIWI PIWI Piwi family AGO family An Allelic Series of ARGONAUTE1 Mutants Strong ago1-9 ago1-10 RG-rich RG-rich Medium ago1-12 PAZ PAZ Weak ago1-11 PIWI PIWI RNA interference Centromere function dsRNA siRNA Science 2002 Development RISC AGO aaaa PTGS Viral defense miRNA and the Role of AGO1 AGO1 CAF RISC 22nt miRNA miRNA precursor AGO1 AGO1 aaaaaaa mRNA aaaaaaa mRNA degradation AGO1 and Development Genes regulated by AGO1 Total RNA ago1-10 0.1ng WT ago1-10 1ng WT ago1-10 10ng WT ago1-10 One Step RT-PCR WT 100ng ER No Change AS1 No Change AG Down in ago AP1 Down in ago CLF Up in ago FIL KAN1 Down in ago No Change AGO1 is required for stem cell function Strong alleles of AGO1 lack shoot apical meristems Weak alleles of STM enhance weak alleles of AGO1 ago1-11 ago1-11/ stm-2 ago1-11/ stm-2 ago1-10 AGO1 is required for organ identity via UFO and LFY ago1-12 ago1 has Adaxialised Organs ET2689 ET3964 WT ago WT ago WT ago WT ago ER FIL 100ng 10ng 1ng 0.1ng miRNA Regulation is Required for Stem Cells and Polarity Strong caf alleles are embryo lethal caf-1 (weak) ago1-11 (weak) caf/caf, ago1-11/ago1-11 The HD-ZIP III gene PHABULOSA is Associated with Adaxial Cell Fate WT Phab1-D/+ McConnell et al., 1999, 2001 HD-ZIP III Genes are Targets of miRNA homeo- leucine domain zipper * START lipid-sterol binding domain 1kb At REVOLUTA At PHABULOSA At PHAVOLUTA 3’ 3’ 3’ GGCCTGGTCCGAAGTAGG GGCCTGGTCCGAAGTAGG GGCCTGGTCCGAAGTAGG 5’ 5’ 5’ At miRNA165 At miRNA166 5’ 5’ CCGGACCAGGCTTCATCC CCGGACCAGGCTTCATCC 3’ 3’ Reinhard et al., Llave et al., Parks et al., 2002 HD-ZIP III transcripts accumulate in PAZ mutants PHABULOSA PHAVOLUTA REVOLUTA TUBULIN RUBISCO 60ng wt wt wt 30ng pnh caf ago1-11 ago1-10 10ng miR165 is Expressed Abaxially in Leaf Primordia miR165 PHB/PHV miR165 is Over and Ectopically Expressed in ago1 miR165 PHB/PHV AGO1 CAF 22nt miRNA miRNA precursor AGO1 AGO1 aaaaaaa mRNA aaaaaaa miR165 PHB/PHV Adaxialised A Model for Leaf Development CSHL Plant Group
Related documents