Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download BC basic - from big bang
Document related concepts
no text concepts found
Transcript
Hybridization of Nucleic Acids DNA1 DNA2 RNA Probe Northern hybridization Southern hybridization Juang RH (2004) BCbasics Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-SER-VAL-LEU----GGG-GAC-GAG-TCC-TCC-GTT-CTC--- * * * * Nucleic acid sequence The nucleic acid sequence is Deduced from amino acid sequence Chemical synthesis * * * * Codon degeneracy Synthesizing oligonucleotide PROBE: GGGGACGAGTCCTCCGTTCT Juang RH (2004) BCbasics Probe is labeled with radioactive 32P 32 P GG G GAC G AG Hybridization TC GG T C TC CG A T T G T C T C C C C T CAG G G TCC A A G G AGGCAA C C T A DNA denaturation Target gene Single colony Lysed Juang RH (2004) BCbasics Colony Is Screened by Hybridization with Probe Colony hybridization Transferring … Collect filter paper Dissolve cell Autoradiography DNA denatured Add probe Juang RH (2004) BCbasics Cover with filter paper Biochip Based on Hybridization Sample DNA Complementary DNA hybridize Biochip Each spot contains known DNA Signal appears Schena (2000) Microarray Biochip Technology, p. A31 Juang RH (2004) BCbasics
Related documents