Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott Background Intracellular parasites: viruses, bacteria (Chlamydias, Rickettsias), and protozoa (plasmodia) (CDC website) Tryptophan biosynthesis genes are found to varying degrees within the Chlamydiaceae family (“Kegg pathway” program) Immune response of humans to Chlamydia infection involves the release of interferon. This activates an enzyme that degrades tryptophan, thereby reducing Chlamydia reproduction inside the host cell (PubMed) Tryptophan is an essential amino acid in humans Taxonomy Lineage (full): root; cellular organisms; Bacteria; Chlamydiae/Verrucomicrobia group; Chlamydiae; Chlamydiae (class); Chlamydiales Chlamydiaceae – Candidatus Clavochlamydia • Candidatus Clavochlamydia salmonicola – Chlamydia • Chlamydia muridarum • Chlamydia suis • Chlamydia trachomatis – Chlamydophila • Chlamydophila abortus • Chlamydophila caviae • Chlamydophila felis • Chlamydophila pecorum • Chlamydophila pneumoniae • Chlamydophila psittaci TaxBrowser in NCBI Available Genomes • • • • • • • • • • • Completed Candidatus Protochlamydia amoebophila UWE25 proteins; Completed Chlamydia muridarum Nigg proteins; Completed Chlamydia trachomatis A/HAR-13 proteins; Completed Chlamydia trachomatis D/UW-3/CX proteins; Completed Chlamydophila abortus S26/3 proteins; Completed Chlamydophila caviae GPIC proteins; Completed Chlamydophila felis Fe/C-56 proteins; Completed Chlamydophila pneumoniae AR39 proteins; Completed Chlamydophila pneumoniae CWL029 proteins; Completed Chlamydophila pneumoniae J138 proteins; Completed Chlamydophila pneumoniae TW-183 proteins NCBI – Genomic Biology Enolase NCBI - Genome Blast Search and Tree Building Dendrogram Enolase Workbench, ClustalW Observation There are multiple serovars of Chlamydia tachomatis, distinguished by route of infection. Question Are there differences in their trp genes? Comparison of Ocular (A) and Genital (D) TrpA Genes trpA_D trpA_A CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTG CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTG trpA_D trpA_A TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCCATTTTTTGAAGAT TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCC---TTTTGAAGAT trpA_D trpA_A CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGG CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGG trpA_D trpA_A ATGTCTTTAATACAAGAATACGCAAGAGGCTTTCTGTATTATATCCCATGTCAAGCTACG ATGTCTTTAATACAAGAACACGCAAGAGGCCTTCTGTATTATATCCCATA-CAAGCTACG Ocular vs. Genital Tryptophan Synthase Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates J. Clin. Invest. Harlan D. Caldwell, et al. 111:1757 doi:10.1172/JCI17993 Question Has the Chlamydia L serovar that causes a systemic lymph node infection retained the tryptophan synthase (trpA) gene like the genital serovars, as opposed to acquiring nonsense mutations like the ocular serovars?