Download Atividade de amidinas aromáticas sobre Trypanosoma cruzi

MINISTÉRIO DA SAÚDE
FUNDAÇÃO OSWALDO CRUZ
INSTITUTO OSWALDO CRUZ
Curso de Pós-Graduação em Biologia Parasitária
Atividade de amidinas aromáticas sobre
Trypanosoma cruzi: Estudos in vitro e in vivo
Cristiane França da Silva
Tese apresentada ao Instituto Oswaldo Cruz como
parte dos requisitos para obtenção do título de
Doutor em Ciências
Orientação: Dra. Maria de Nazaré Correia Soeiro
RIO DE JANEIRO
2011
INSTITUTO OSWALDO CRUZ
Pós-Graduação em Biologia Parasitária
CRISTIANE FRANÇA DA SILVA
Atividade de amidinas aromáticas sobre
Trypanosoma cruzi: Estudos in vitro e in vivo
ORIENTADOR: Prof. Dra. Maria de Nazaré C. Soeiro
EXAMINADORES:
Prof. Dra. Leonor Laura Leon (IOC/FIOCRUZ) - Presidente
Prof. Dra. Thais Cristina Baeta Soares Souto Padron (UFRJ) - Membro
Prof. Dra. Tecia Maria Ulisses de Carvalho (UFRJ) - Membro e revisora
Prof. Dra. Maria Terezinha Bahia (UFOP) - Suplente
Prof. Dra. Helene Santos Barbosa (IOC/FIOCRUZ)- Suplente
Rio de Janeiro, 06 de julho de 2011
Á minha mãe
Geralda e ao meu
pai, Joaquim,
pelo amor, carinho,
atenção e total
apoio.
“Só existem dois dias no ano
que nada pode ser feito.
Um se chama ontem
e o outro se chama amanhã,
portanto hoje é o dia certo para amar,
acreditar, fazer e principalmente viver.”
Dalai Lama
“Não desista, vá em frente.
Sempre há uma chance de você
tropeçar em algo maravilhoso.
Nunca ouvi falar em ninguém
que tivesse tropeçado
em algo enquanto estava sentado.”
Caio Fernando Abreu
Agradecimentos
A Deus e a Nossa Senhora Aparecida, pelas oportunidades que me foram
dadas na
vida,
principalmente
por ter conhecido
pessoas que
me
proporcionaram este momento, mas também por ter vivido fases difíceis, que
foram matérias-primas de aprendizado.
Aos meus pais, Geralda e Joaquim, sem os quais não seria capaz de chegar
até aqui, e por me ajudar nesta caminhada com muita educação, força para
encarar a vida de frente, carinho, amor, broncas, atenção e apoio.
A Dra. Maria de Nazaré Soeiro, a melhor orientadora que eu poderia desejar,
que sempre me estimulou a seguir em frente e não desistir, principalmente por
sua grande capacidade como pesquisadora, orientadora e pessoa! Além disso,
ela mostrou o tempo todo muito mais paciência do que eu mereceria!!! Sou
inteiramente grata por essa pessoa maravilhosa, que Deus colocou no meu
caminho!!! Muito, muito obrigado!!! Mesmo!!!
A Dra. Solange Lisboa De Castro, que está sempre disposta a ouvir e ajudar
da maneira que pode!!! E também, por ser uma ótima chefe e orientadora não
oficial!!!!
Ao Renato e Letícia, pelo apoio, atenção, amor, passeios e principalmente por
me dar dois sobrinhos maravilhosos, Miguel e Gustavo.
A Kika, minha eterna companheira, transmitindo paz e calma nas horas difíceis
e por estar sempre ao meu lado em todos os momentos.
A Dra. Miriam Pereira, Dra. Kelly Salomão, Dra. Elen Mello e Dra. Anissa
Daliry, pela paciência e ensinamentos disponibilizados que de alguma forma
especial contribuiu para a conclusão desse trabalho e, consequentemente,
para minha formação profissional.
Ao Marcos Meuser, obrigada pelo apoio técnico fundamental e por deixar
marcas e lições para a minha vida, proporcionando-me alegrias, conhecimento
e crescimento pessoal.
A Dra. Denise, por toda paciência que ela tem comigo pois passamos muitas
horas juntas, por ser uma ótima profissional, companheira de experimentos e
uma colaboradora sempre presente auxiliando-me de muitas formas, em
diferentes momentos. Por ser uma amiga também fora do trabalho, sempre
com sorriso no rosto e alegria, carinho e cumplicidade, durante todos esses
anos, pois sem essa força seria muito mais difícil atravessar esse mesmo
caminho.
As minhas amigas, Ana Maria, Camila Coronel e Michele Longo, que em
alguns casos não sabiam muito sobre minha tese, mas que sempre me
ajudaram, a toda atenção dispensada comigo, as festas, passeios e viagens
que eram pra distrair a cabeça. Sempre que estou com elas parece que tenho
paz, calma, tranqüilidade, que são itens fundamentais para seguir em frente!!!
Obrigada de coração, vocês não são apenas parte de mim, mas da minha
vida!!!
Ao Laboratório de Biologia Celular, Aline Nefertiti, Aline Onofre, Erica,
Evelyn, Haynna, Julianna, Phelipe, Natalia, Michele Casal, pelo apoio a esta
tese. E principalmente, a Patrícia Bernadino, por ser uma ótima companheira
de trabalho e muito competente. Por me mostrar que é preciso muita força de
vontade e dedicação. Afinal, cada escolha uma renuncia!!!!
A Giani França e Sandra Maria, por toda a simpatia, ótima companhia e
amiga dentro e fora da FIOCRUZ.
Aos meus amigos do Setor de Experimentação Animal, Dr. Gabriel,
Wanderson, Monique e Diana, pelo apoio técnico, conversas, confidencias e
risadas do dia-a-dia.
A todos que fizeram parte da minha vida de alguma forma, a minha eterna
gratidão! Sem vocês essa trajetória não seria tão prazerosa!!!
Esta tese foi desenvolvida sob orientação da Dra. Maria de Nazaré Correia
Soeiro no Laboratório de Biologia Celular do Instituto Oswaldo Cruz, Fundação
Oswaldo Cruz, com o apoio financeiro da Fundação Carlos Chagas Filho de Amparo
a Pesquisa do Estado do Rio de Janeiro (APQ1- E26/170.627/07 and Pensa Rio - E26/110.401/2007), Conselho Nacional Desenvolvimento Científico e Tecnológico
(CNPq - 304119/2006-7), DECIT/SCTIE/MS e MCT pelo CNPq (410401/2006-4),
PAPES V/FIOCRUZ (403451/2008-6) e pelo Consortium for Parasitic Drug
Development (CPDD).
Esta tese é composta por 05 artigos:
1. da Silva, C. F., M. M. Batista, D. G. J. Batista, E. M. De Souza, P. B. da Silva, G.
M. de Oliveira, A. S. Meuser, A. R. Shareef, D. W. Boykin, and M. N. Soeiro. (2008).
In vitro and in vivo studies of the trypanocidal activity of a diarylthiophene diamidine
against Trypanosoma cruzi. Antimicrob. Agents Chemother. 52:3307-3314.
2. da Silva CF, da Silva PB, Batista MM, Daliry A, Tidwell RR, Soeiro M de N. The
biological in vitro effect and selectivity of aromatic dicationic compounds on
Trypanosoma cruzi. Mem Inst Oswaldo Cruz. 2010:105(3):239-45.
3. Da Silva CF, Junqueira A, Lima MM, Romanha AJ, Sales Junior PA, Stephens
CE, Som P, Boykin DW, Soeiro Mde N. 2011 a. In vitro trypanocidal activity of
DB745B and other novel arylimidamides against Trypanosoma cruzi. J Antimicrob
Chemother. 66(6):1295-7.
4. Da Silva CF, Daliry A, Silva PB; De Castro SL, Boykin DW, Soeiro MNC. 2011b.
The Efficacy of Novel Arylimidamides Against Trypanosoma cruzi in vitro. Submetido.
5. da Silva CF,Batista DGJ, de Oliveira GM, De Souza EM, Hammer ER, da Silva
PB, Daliry A, Araujo JS, Stephens CE, Som P, Britto CC, Rodrigues ACM, Boykin
DW, Soeiro MNC. 2011c. In vitro and In vivo investigation of amidine DB1965 and
DB1831 efficacy against Trypanosoma cruzi infection. Submetido.
Prêmio:
1. Simpósio Internacional Comemorativo do Centenário da Descoberta da Doença
de Chagas (Julho de 2009).
Durante a realização desta tese, participei das seguintes publicações:
1. Soeiro, M.N.C., de Castro, S.L., de Souza, E.M., Batista, D.G.J., Silva, C.F.,
Boykin, D.W. (2008). Diamidine Activity Against Trypanosomes: the State of the Art.
Current Molecular Pharmacology 1:151-161.
2. Soeiro Mde N, Dantas AP, Daliry A, Silva CF, Batista DG, de Souza EM, Oliveira
GM, Salomão K, Batista MM, Pacheco MG, Silva PB, Santa-Rita RM, Barreto RF,
Boykin DW, Castro SL. Experimental chemotherapy for Chagas disease: 15 years of
research contributions from in vivo and in vitro studies. Mem Inst Oswaldo Cruz.
2009;104 Suppl 1:301-10
3. Daliry A, Da Silva PB, Da Silva CF, Batista MM, De Castro SL, Tidwell RR, Soeiro
Mde N. In vitro analyses of the effect of aromatic diamidines upon Trypanosoma
cruzi. J Antimicrob Chemother. 2009: 64(4):747-50.
4. Pacheco MG, da Silva CF, de Souza EM, Batista MM, da Silva PB, Kumar A,
Stephens CE, Boykin DW, Soeiro Mde N. Trypanosoma cruzi: activity of heterocyclic
cationic molecules in vitro. Exp Parasitol. 2009 ;123(1):73-80
5. De Castro S, Batista DGJ, Batista MM, Batista W, Daliry A, De Souza EM, MennaBarreto RFS, Oliveira GM, Salomão K, Silva CF, Silva PB, Soeiro MNC.
Experimental chemotherapy for Chagas´ disease: a morphological, biochemical and
proteomic overview of Trypanosoma cruzi targets. 2011. Molecular Biology
International. In press.
Capitulo de Livro:
1. SOEIRO, M. N. C.; Daliry, A.; Silva CF; de Souza, E. M; OLIVEIRA, G. G.;
SALOMÃO, K; MENNABARRETO, R ; CASTRO, S. L. Electron microscopy
approaches for the investigation of the cellular targets of trypanocidal agents
in Trypanosoma cruzi. In: A. Méndez-Vilas A, Díaz J. (Org.). Microscopy:
Science, Technology, Applications and Education. Badajoz: Formatex
Research Center, 2010, v. 1, p. 191-203.
RESUMO
O atual tratamento da doença de Chagas (DC) se baseia em dois compostos
nitroderivados, o Nifurtimox (Nf) e benznidazol (Bz), ambos introduzidos na clínica
médica há cerca de 40 anos e que têm sido considerados insatisfatórios
principalmente devido à baixa atividade, sobretudo na fase crônica, além de alta
toxicidade e/ou ocorrência de isolados do parasito resistentes a ambos
nitroderivados. Assim como um dos principais desafios ainda a serem enfrentados
há mais de cem anos depois da descoberta da DC diz respeito a identificação de
novas terapias alternativas para o tratamento desta negligenciada parasitose, esta
temática representou o principal objetivo da presente tese. Assim, estudos in vitro e
in vivo foram conduzidos visando avaliar a eficácia de amidinas aromáticas, incluindo
diamidinas e arilimidamidas (AIAs) sobre o T.cruzi, analisando ainda a localização e
distribuição dos compostos aromáticos assim como seus alvos celulares. Nossos
dados revelaram a ação tripanocida de diamidinas e AIAs sobre formas sanguíneas
e amastigotas do parasito, em faixa micro e nanomolar, respectivamente. Alguns dos
compostos estudados, em especial as AIAs DB745 e DB1831 exibiram excelente
efeito sobre formas sanguíneas na presença de sangue a 4ºC, demonstrando seu
potencial uso também na profilaxia de bancos de sangue. De modo geral, as
amidinas testadas, incluindo as AIAs, apresentaram superior eficácia que as drogas
de referencia, incluindo o Bz e a violeta de genciana. AIAs como a DB745 foram
ativas sobre diferentes cepas do T.cruzi, incluindo YuYu e Colombiana, que
apresentam resistência natural a nitroderivados. Estudos ultra-estruturais e por
ensaios fluorescentes (microscopia e citometria de fluxo) revelaram que o núcleo e a
mitocôndria do parasito representam potenciais alvos dos compostos estudados. No
entanto, não foi observada correlação entre atividade e maior acúmulo destes
agentes na mitocôndria (kDNA) do T.cruzi. Os ensaios in vivo demonstraram que
estes compostos aromáticos são ativos sobre modelos experimentais de infecção
aguda pelo T.cruzi, reduzindo carga parasitária e a inflamação, oferecendo 100% de
proteção na mortalidade dos animais tratados. A AIA DB1965 revelou eficácia
semelhante ao Bz e a sua combinação com esta droga de referência resultou em
100% de sobrevida e níveis superiores a 99% de supressão de parasitemia, sem
alcançar cura parasitológica avaliada pelo hemocultivo e PCR. O excelente efeito de
amdinas, em especial de AIAs contra o T. cruzi, reforça o rastreamento por novos
análogos que possam ser usados sozinhos ou em combinações com outras drogas,
para o tratamento da doença de Chagas.
ABSTRACT
The current treatment of Chagas disease (CD) is based on two old drugs, the
Nifurtimox (Nf) and benznidazole (Bz), both introduced in clinical medicine for nearly
40 years ago. Both are not considered adequate mainly due to their low activity,
especially in the chronic phase, and high toxicity and/or occurrence of parasite
strains naturally resistant to both nitro-derivatives. Then, one of the main challenges
still to be faced after more than a century after the discovery of CD is respect to need
of identifying new alternative therapies for the treatment of this neglected illness, and
this issue represents the main objective of the present thesis. Thus, in vitro and in
vivo studies were conducted to evaluate the efficacy of aromatic amidines, including
diamidines and arylimidamides (AIAs), and to evaluate the localization and
distribution of these compounds as well as their potential cellular targets upon T.
cruzi. Our data revealed trypanocidal activity of diamidines and AIAs against
bloodstream and intracellular amastigotes under micro and nanomolar range,
respectively. Some of the studied compounds, especially AIAs, DB745 and DB1831,
exhibited an outstanding effect on bloodstream forms even in the presence of blood
at 4ºC, also demonstrating their potential prophylactic use in blood banks. In general,
amidines mainly AIAs, showed higher efficacy than the reference drugs, including Bz
and gentian violet. AIAs, as DB745, were active on different strains of T. cruzi,
including Colombian and YuYu, which have natural resistance to nitro-derivatives.
Ultrastructural studies and fluorescent tests (microscopy and flow cytometry)
revealed that the nucleus and mitochondria of the parasite are potential targets of the
compounds studied. However, there was no correlation between activity and greater
accumulation of these agents in the mitochondria (kDNA) of T. cruzi. In vivo testing
demonstrated that these aromatic compounds are active on experimental models of
acute infection of T. cruzi, by reducing cardiac parasite load and inflammation, and
offering 100% of protection upon the mortality of treated animals. The AIA, DB1965,
also showed similar efficacy of Bz and its combination with this reference drug
resulted in 100% survival and >99% of parasitemia suppression, without achieving,
parasitological cure assessed by blood culture and PCR. The excellent effect of
amidines (especially of AIAs) against T. cruzi, justify the screening of novel amidine
analogues that could be used alone or in combination with other drugs to treat
Chagas disease.
ÍNDICE
RESUMO
x
ABSTRACT
xi
INTRODUÇÃO
01
1.1 Doença de Chagas
02
1.2 A doença e suas fases
03
1.3 Transmissão
04
1.4 O parasita e seu ciclo de vida
06
1.5 Quimioterapia
08
1.6 Diamidinas e análogos
10
OBJETIVOS
16
RESULTADOS
19
DISCUSSÃO
95
CONCLUSÕES
106
REFERÊNCIAS BIBLIOGRÁFICAS
109
Introdução
Introdução
1
Introdução
1.1 Doença de Chagas
Doenças tropicais negligenciadas, como por exemplo, a Doença de Chagas
(DC), afetam aproximadamente um bilhão de indivíduos que vivem em áreas muito
pobres, sendo uma das principais causas de impedimento para o avanço
socioeconômico em muitos países em desenvolvimento, além de causar alta
morbidade e mortalidade (Richard & Werbovetz, 2010; Soeiro e De Castro, 2009).
Doença de Chagas, ou tripanosomíase americana é uma infecção causada
pelo protozoário flagelado Trypanosoma cruzi (WHO, 2002), sendo a prevalência
global da infecção humana de aproximadamente 8-12 milhões de pessoas, o que
representa uma redução de cerca de 50% nas taxas de infecção observadas em
1990. (WHO, 2007). Dados recentes sugerem que 90-100 milhões de pessoas
estejam em risco de contrair esta parasitose em áreas endêmicas (Pinto Dias, 2006;
Clayton, 2010). Um dos motivos da DC permanecer com alta incidência é a grande
quantidade de reservatórios, tendo sido relatada a infecção por T.cruzi de mais de
150 espécies domésticas, rurais e de animais selvagens (gatos, cachorros, porcos,
roedores, marsupiais, tatus) (Rassi e cols., 2010). Várias estimativas relatam cerca
de 20.000 mortes por ano em decorrência da DC, representando a segunda doença
mais importante entre as doenças tropicais nas Americas (Coura, 2009; Coura e
Dias, 2009)
Em 1909, Carlos Chagas descreveu a doença, o ciclo, a transmissão e o
parasita. Após 102 anos esta doença continua sendo um importante problema de
saúde pública em 22 países em desenvolvimento na América, compreendendo a
faixa que se estende a partir do sul dos Estados Unidos até a Argentina meridional
(Pinto Dias, 2006; Rocha e cols., 2007). Hoje, a DC também representa um novo
desafio mundial devido a sua expansão para países não-endêmicos, como os
Estados Unidos de América, Canadá, Japão, França e Espanha, como resultado de
migração de indivíduos infectados (Coura e Borges-Perreira, 2010). Relatos da
literatura descrevem características clínicas da DC, como o megacolon, em múmias
de diferentes áreas da América Latina datadas de aproximadamente ~7.000 AC a
~1,500 DC (Araújo e cols., 2009).
Apesar
de
esforços
agregados
a
partir
de
diferentes
iniciativas
governamentais (Iniciativas de países do Cone Sul) e não-governamentais (ex. DNDi
e Médicos Sem Fronteiras -MSF) que resultaram no declínio acentuado de novos
casos agudos, a doença de Chagas ainda apresenta muitos desafios, inclusive a
falta de terapias profiláticas e de esquemas efetivos de quimioterapia em especial
2
Introdução
para pacientes crônicos tardios (Rodrigues Coura e De Castro, 2002; Dias 2007).
Como todas as doenças negligenciadas, a DC não é de interesse para as indústrias
farmacêuticas, principalmente, devido a falta de potencial mercado nos países
afetados e consequentemente retorno financeiro compatível aos elevados custos de
investimento necessários para o desenvolvimento de novos fármacos (Buckner e
Navabi, 2010). Dados revelam que de 1975-2004, somente cerca de 1,3% da verba
total para desenvolvimento de novas drogas foi dedicado para tratamento de
doenças altamente negligenciadas, especialmente Leishamniose, Dengue, Doença
do Sono e DC (Chatelein e Loset, 2011). O custo relativo ao cuidado da saúde
somado a perda de produtividade que se atribui a DC alcança de 40 a 800 milhões
de dólares, por pais, por ano. Além disso, anualmente a América Latina tem perdas
econômicas na ordem de 18 bilhões de dólares como resultado da morbidez e
mortalidade de pacientes chagásicos em plena idade produtiva (Parker e Sethi,
2011).
1.2 A doença e suas fases
DC possui duas fases consecutivas: a fase aguda, que inicia-se logo após a
infecção, e a fase crônica, na qual 30-40% dos pacientes apresenta sintomatologia
clínica após um período silencioso de anos ou décadas, chamado de forma
indeterminada (Rodrigues Coura e De Castro, 2002; Clayton, 2010a; Coura e
Borges-Perreira, 2010). A fase aguda dura entre 4 a 8 semanas e é caracterizada
pela alta parasitemia. Na maioria dos indivíduos infectados é assintomática, podendo
ainda ser oligosintomática apresentando febre, dores musculares, sudorese,
aumento do tamanho do fígado e baço, parada cardíaca devido a inflamação do
miocardio, e, menos freqüentemente, meningoencefalite. O envolvimento cardíaco
está presente em 90% dos casos. Outros sintomas que também podem ocorrer
durante a fase aguda incluem anorexia, náusea, diarréia e edema. Uma
particularidade é o forte edema presente no local de inoculação conhecido como
chagoma de inoculação ou Sinal de Romanã, neste último caso, quando o indivíduo
que sofre a inoculação do parasito na mucosa da conjuntiva ocular (Coura e Dias,
2009).
O
chagoma
pode
persistir
durante
várias
semanas,
regredindo
espontaneamente. Na fase aguda o falecimento é visto em menos de 5% dos casos
sintomáticos e pode ser atribuível a complicações mais severas ou em recémnascidos com infecção congênita, crianças e indivíduos imunocomprometido (Rassi
e cols., 2010).
3
Introdução
Aproximadamente dois meses após a infecção, a doença evolui para a fase
crônica, na qual 60% a 70% dos indivíduos infetados permanecem na forma
indeterminada caracterizada pela ausência de sintomas clínicos, mas sorologia
positiva e leve dano cardíaco causado pela persistente inflamação (Marin Neto e
Rassi, 2009). Entretanto, após 10 a 30 anos, os demais portadores evoluem então
para a forma crônica sintomática na qual 5% a 10% desenvolvem manifestações
gastrointestinais (megacolon e megaesôfago) e a grande maioria, alterações
cardíacas, que progridem até a falência do órgão (Coura e Viñas, 2010, Rodrigues
Coura e De Castro, 2002). Na fase crônica, existe uma grande variedade regional
quanto as características de sua morbidade cardíaca e/ou digestiva (Coura e Borges
Perreira, 2010).
Embora seus mecanismos patológicos não estejam plenamente entendidos,
dados da literatura mostram a persistência do parasita nos órgãos que sustenta a
manutenção de uma resposta inflamatória relacionada a patogênese da DC (Higuchi
e cols., 2003, Marino e cols., 2005). Por outro lado, a discrepância entre a
severidade das lesões e a baixa carga parasitária observada na fase crônica sugere
que outros fatores além do parasita possam estar relacionados ao desenvolvimento
da patologia chagásica, incluindo dês-regulação da resposta imune do paciente.
Neste sentido, vários estudos têm implicado o fenômeno da auto-imunidade como
um dos fatores envolvidos no desenvolvimento da patologia da DC. No entanto,
dados apontam que embora a resposta imune contribua fortemente para as lesões
dos tecidos em especial quando exacerbada e descontrolada, o parasita é ainda
reconhecido como principal fator desencadeador da doença (Gutierrez e cols., 2009;
Bonney e cols., 2011).
O diagnostico da DC crônica é baseado em dados clínicos, eletrocardiográfico
e sorológico. Os testes sorológicos, comumente, são baseados na fixação do
complemento, imunofluorescência ou ensaios de ELISA. DC pode ser ainda
diagnosticada por testes moleculares de alta sensibilidade (específicas para o DNA
do T. cruzi) através de ensaios de reação em cadeia de polimerase (PCR) (Maya e
cols., 2010).
1.3 Transmissão
A DC é principalmente transmitida por seu vetor da ordem Hemíptera, família
Reduviidae. Dentro desta família o Triatoma infestans, Rhodnius prolixus, Triatoma
dimidiata são os três principais vetores da infecção humana. Os triatomíneos vivem
4
Introdução
nas rachaduras e fendas das casas de lama ou em casas de sapê (pau-a-pique) e
saem à noite para se alimentar. A maioria das picadas ocorre na face, parte
descoberta do corpo, resultando no nome vulgar do inseto – conhecido no Brasil por
barbeiro (Rassi e cols., 2010).
A transmissão vetorial do T. cruzi envolve três ciclos: (i) o ciclo doméstico
(responsável pela manutenção da doença em humanos) que ocorre principalmente
em áreas urbanas e peri-urbanas, sendo humanos, cães e gatos os principais
reservatórios do parasita; (ii) o ciclo silvestre, no qual triatomíneos silvestres
infectam roedores, marsupiais e outros mamíferos e, (iii), o ciclo peridomiciliar, que
representa um elo entre o ciclo doméstico e o silvestre. No ciclo peridomiciliar ocorre
o fluxo de mamíferos (roedores domésticos, marsupiais, gatos, cachorros, entre
outros) entre casas e áreas silvestres bem como a ocorrência de espécies de
triatomíneos silvestres infectados que acessam ás casas infectando diretamente
pessoas, animais e mesmo alimentos (Remme e cols., 2006).
Insetos triatomíneos são abundantes nos Estados Unidos, e um recente
estudo demonstrou que 41% dos insetos presentes na área peroidomiciliar de
Tucson, no Arizona estão infetados com T. cruzi, ilustrando o potencial risco de
transmissão vetorial na América do Norte (Reisenman e cols., 2010). Uma
preocupação também crescente tem sido os numerosos casos de cachorros
infectados do Texas, Tennessee, Louisiana, Oklahoma, Geórgia, Sul, Carolina, e
Virgínia, demonstrando que existe um ciclo de transmissão ativo em cães (Parker e
Sethi, 2011).
Nas últimas três décadas, a transmissão vetorial (em especial mediada pelo
T. infestans) da DC foi significativamente reduzida nas áreas endêmicas devido a
políticas do Cone Sul de controle epidemiológico (Coura e Dias, 2009; Dias 2009;
Moncayo e Silveira 2009). De fato, vários países latinos americanos, inclusive o
Brasil em 2006, receberam a certificação de OPAS/WHO referente a interrupção de
transmissão vetorial por T. infestans (Moncayo e Silveira 2009).
Migrações rurais para áreas urbanas bem como para países não endêmicos,
tem contribuído significativamente para a mudança do padrão epidemiológico da DC,
tornando a transfusão sanguínea o segundo principal modo de transmissão desta
parasitose (Coura, 2009) devido ao aumento da sua prevalência em bancos de
sangue de países não endêmicos, incluindo América do Norte e países da Europa
(Coura, 2009). Historicamente, a transfusão de sangue contaminado é uma fonte
reconhecida de transmissão na America Latina, porém casos de infecção por
5
Introdução
transfusão em pacientes imunocomprometidos têm sido documentados nas últimas
duas décadas nos Estados Unidos e Canadá (Schmunis, 2007). No entanto, o
Centro
para
Controle
e
Prevenção
de
Doenças
(CDC)
informou
que
aproximadamente 800 casos de DC foram confirmados em centros de coleta de
sangue nos Estados Unidos desde 2007. A maioria destes casos concentrou-se em
áreas ricas de imigrantes latinos americanos tais como: Califórnia, Texas, Flórida, e
Nova Iorque (Parker e Sethi, 2011). O CDC estimou que cerca de 18 milhões de
pessoas migraram do México e de países da America do Sul e Central para os
Estados Unidos e que pelo menos 300 mil infectados vivem atualmente nos Estados
Unidos (Parker e Sethi, 2011).
Outra maneira de transmissão da doença de Chagas é por via congênita,
sendo a terceira via de maior importância, podendo ocorrer desde o terceiro mês de
gestação, com um em vinte neonatos nascidos de mães soropositivas para DC
(Parker e Sethi, 2011). A transmissão pode ocorrer também através do transplante
de órgãos infectados, por acidentes em laboratório e como relatados em vários
surtos no Brasil, por via oral, devido ao consumo de alimentos contaminados (Dias,
2006; Rassi e cols., 2010).
A transmissão por alimentos contaminados (carne crua ou sucos de cana-deaçúcar, goiaba ou açaí) com fezes de insetos triatomíneos (Pereira e cols., 2010)
tem sido uma real ameaça. A partir de 2004, houve na região Amazônica, um
significativo aumento do número de casos agudos devido a ingestão de sucos (como
o de açaí), o que evidenciou a necessidade de maior controle e vigilância
epidemiológica da DC nesta região (Moncayo e Silveira, 2009)
1.4. O parasita e seu ciclo de vida
De acordo com a classificação taxonômica, o T.cruzi pertence à ordem
Kinetoplastida, família Trypanosomatidae e gênero Trypanosoma. O T. cruzi tem um
ciclo de vida que consiste em formas morfologicamente e bioquimicamente distintas,
sendo: duas proliferativas, epimastigota encontrada nos triatomíneos, e amastigota
que se multiplica no interior da célula do hospedeiro vertebrado, e uma não
proliferativa - tripomastigota - que circula no sangue periférico, sendo também
encontrado no intestino posterior do inseto vetor com a denominação de
tripomastigota metacíclico (De Souza, 2010; Brener,1973). Durante o repasto
sanguíneo de um hospedeiro mamífero infectado, o inseto vetor ingere
tripomastigotas sanguíneos, que se diferenciam ao longo do intestino do inseto vetor
6
Introdução
em formas epimastigotas. Após de 3–4 semanas, formas tripomastigotas
metacíclicas presentes na porção posterior do intestino do barbeiro são liberadas
junto as fezes e urina do vetor no momento do novo repasto sanguíneo. A
transmissão para o novo hospedeiro vertebrado ocorre quando as fezes contendo
parasitas contaminam mucosas, conjuntivas e/ou superfícies lesionadas. Assim,
após infectar células do hospedeiro vertebrado, o parasito se diferencia, em formas
amastigotas, que após vários ciclos de multiplicação intracelular, se transformam em
formas tripomastigotas, que são as principais formas liberadas após a ruptura das
células hospedeiras, ganhando acesso as correntes sanguínea e linfática e/ou sendo
ingeridas pelo inseto vetor, completando então seu ciclo de vida. O parasita é capaz
de invadir qualquer célula nucleada (Brener, 1973; De Souza, 1984; Stuart e cols.,
2008).
As diferentes formas do T. cruzi presentes em seus diferentes hospedeiros
podem ser reconhecidas a partir de suas características morfológicas e bioquímicas.
Com relação aos aspectos morfológicos, a posição do cinetoplasto em relação ao
núcleo, e a posição do flagelo são importantes pontos a serem avaliados na
diferenciação entre amastigotas, epimastigotas e tripomastigotas. O T. cruzi, bem
como todos os membros da família Tripanosomatidae, apresenta uma única
mitocôndria que se ramifica por todo o corpo deste parasito. Nela, grande parte do
seu DNA se organiza sob a estrutura de minicírculos e maxicirculos concentrados
numa determinada região localizada logo abaixo do corpúsculo basal, denominada
de cinetoplasto. (De Souza, 1999). Os tripomastigotas possuem o cinetoplasto em
forma arredondada localizado na região posterior ao núcleo, com o flagelo
emergindo a partir da bolsa flagelar localizada na região posterior do parasito. As
formas amastigotas apresentam cinetoplasto em forma de bastão, anterior ao
núcleo, com flagelo curto. O epimastigota também apresenta o cinetoplasto em
forma de bastão sendo anterior ao núcleo (De Souza e cols, 2000). O flagelo dos
tripanosomatídeos está envolvido em pelo menos dois importantes processos
biológicos: movimento celular e adesão à superfície de células do hospedeiro (De
Souza, 1999). Este parasita também apresenta outras organelas, que por sua
peculiaridade, têm sido consideradas alvos celulares para desenho de novas drogas
incluindo: glicossomos (estruturas ricas em catalases e outras enzimas envolvidas
na via glicolítica), e acidocalcisomas (organelas acídicas ricas em cálcio, fosfato
entre outros elementos) (De Souza, 1999).
7
Introdução
1.5 Quimioterapia
O atual tratamento da DC é baseado em dois fármacos: nifurtimox (Nf) e o
benznidazol (Bz). Ambos foram introduzidos na clínica nas décadas de 60-70 do
século passado, sendo que o primeiro teve sua produção descontinuada na década
de 80, tendo sido recentemente re-introduzido na clínica e distribuído pela
Organização Mundial de Saúde (Urbina e Docampo, 2003; Steverding e Tyler, 2005;
WHO, 2009). Estes compostos (Nf e Bz) são parcialmente efetivos e apresentam
severos efeitos colaterais (Rodrigues Coura e De Castro, 2002; Villa e cols., 2007),
assim como requerem longos períodos de tratamento, levando freqüentemente ao
abandono do tratamento (Jannin e Villa, 2007, Soeiro e cols., 2009). Há ainda
diferenças expressivas quanto ao perfil de suscetibilidade de diferentes cepas do
parasita a ambos nitroderivados (Filardi e Brener, 1987). O tratamento é
recomendado para a fase aguda, crônica recente e em casos de reativação.
Entretanto, ambos apresentam resultados variáveis principalmente relacionados à
área endêmica, fase da doença e idade dos pacientes (Rodrigues Coura e De
Castro, 2002; Romanha e cols., 2010). Os mecanismos de ação destes compostos
ainda são pouco conhecidos, tendo sido atribuídos, pelo menos em parte, ao
estresse oxidativo, pela geração de radicais livres e/ou metabólicos eletrofílicos que
se associam a lipídeos, proteínas e DNA do parasita (Maya e cols., 2007; Muñoz e
cols., 2011).
Em geral, a administração do nifurtimox (oralmente, três vezes ao dia) segue
os seguintes esquemas terapêuticos: (a) crianças de 0-10 anos: 15-20 mg/kg/dia por
60-90 dias; (b) jovens de 11-16 anos: 12,5-15 mg/kg/dia, por 90 dias; e (c) adultos:
8-10 mg/kg/dia, por 60-90 dias (Wegner e Rohwedder, 1972; Amato Neto, 1999). Os
efeitos colaterais mais freqüentes incluem anorexia, dor de cabeça, vômitos, perda
de peso, insônia, mialgia, manifestações cutâneas, cólicas intestinais, diarréia, entre
outros (Rodrigues Coura e De Castro, 2002; Castro e cols., 2006).
Beznidazol é administrado durante 60 dias na dose de 5-10 mg/kg/dia
podendo ser estendido por até cinco meses no caso de tratamento de pacientes
imunocomprometidos. Em casos de indivíduos que foram infectados acidentalmente
o tratamento pode ser abreviado, utilizando-se esquema profilático restrito a 10-15
dias (Amato Neto, 1999; Maya e cols., 2007). Os principais efeitos colaterais
relatados são: anorexia, dor de cabeça, vômitos, insônia, mialgia, manifestações
cutâneas incluindo dermatites, edemas generalizados, febre, depressão da medula
8
Introdução
óssea, trombocitopenia, e polineuropatias periféricas (Castro e cols., 2006; Maya e
cols., 2007, Viotti e cols., 2009).
Todos os casos congênitos devem ser tratados com Bz ou Nf. A precocidade
do tratamento está relacionado a uma melhor resposta terapêutica. Efeitos colaterais
em crianças são menos intensos que em adultos e 98% dos neonatos tratados
resultam em negativação de sorologia e parasitemia (Apt, 2010).
Além destes fármacos, outros poucos compostos também têm sido usados,
de modo restrito, na clínica da DC, incluindo derivados azólicos como o cetoconazol,
e o alopurinol, sendo este último utilizado para redução da reativação da parasitemia
em pacientes imunossuprimidos, havendo, contudo, controvérsias quanto a sua
aplicação por apresentar apenas efeito tripanostático transitório (Stoppani, 1999; de
Alemida e cols., 2009). Com relação ao alopurinol, este não apresentou eficácia na
fase crônica da doença de Chagas (Rassi e cols., 2007).
Outro desafio está relacionado à transfusão de sangue em áreas endêmicas,
pois o único agente tripanocida atualmente disponível é a violeta de genciana, que
além de apresentar hepatotoxicidade, resulta em mudança de cor do sangue (cor
purpúrea), podendo ainda manchar a pele e mucosa dos receptores, sendo motivo
de rejeição (Chiari e cols., 1996; Clayton, 2010b).
Como acima discutido, apesar das 500 mil mortes por ano e do atual
tratamento ainda considerado insatisfatório, apenas cerca de 1% de todas as drogas
desenvolvidas durante os últimos 30 anos são voltadas para o tratamento de
doenças tropicais como a DC (Soeiro e De Castro, 2009), o que justifica e demonstra
claramente a necessidade urgente por novas drogas tripanocidas.
Assim, baseado no conhecimento atual da biologia do parasita e do
hospedeiro, um candidato ideal para terapia da DC teria as seguintes características:
(i) alto nível de atividade contra as formas evolutivas presentes nos hospedeiros
mamíferos e contra diferentes cepas do parasita incluindo aquelas naturalmente
resistentes a nitroderivados com Bz e Nf; (ii) eficácia nas fases aguda e crônica
(recente e tardia); (iii) administração oral em poucos doses; (iv) baixa toxicidade e
segurança (incluindo formulações para crianças e mulheres em idade de
reprodutiva); (v) baixo custo e alta estabilidade para temperaturas tropicais e (vi)
altos níveis de acumulação em diferentes tecidos além de meia vida longa (Nwaka &
Hudson, 2006; Soeiro e cols., 2009; Soeiro e De Castro, 2009, Buckner e Navabi,
2010).
9
Introdução
1.6. Diamidinas e análogos
Compostos dicatiônicos aromáticos, como a pentamidina (Pt) e o berenil têm
sido utilizaoas por mais de 60 anos para o tratamento da tripanossomíase africana
(infecções humanas e de outros animais), sendo ainda a Pt usada para terapia de
leishmaniose cutânea e visceral em casos de resistência a agentes antimoniais
(Blum e cols., 1994, Werbovetz, 2006). Desde então, a ação destes compostos tem
sido investigada sobre diversos parasitos (Soeiro e cols., 2005). De fato, diamidinas
aromáticas (DA) exibem alta atividade contra diferentes classes de patógenos tais
como bactérias, fungos e protozoários (Werbovetz, 2006; Wilson e cols., 2008).
Diamidinas aromáticas representam uma classe de ligantes de DNA com forte
especificidade para fenda menor do DNA, em regiões ricas em bases A-T (Wilson e
cols., 2008). Embora o exato mecanismo de ação não seja completamente
elucidado, ensaios termodinâmicos sugerem que estes agentes sejam capazes de
induzir
alterações
na
organização
e
topologia
do
DNA,
resultando
na
desestruturação e mesmo fragmentação desta molécula (Tidwell e Boykin, 2003;
Wilson e cols., 2008). Estes compostos aromáticos heterocíclicos podem ainda se
associar a regiões ricas em sequências GC, porém essa ligação é menos freqüente
e de menor intensidade em decorrência da menor eletronegatividade destas regiões
ricas em sequências CG. Alternativamente, diamidinas e análogos podem interferir
(inibição
estérica)
no
reconhecimento
e
mesmo
interação
de
enzima/fatores/proteínas ao DNA e/ou podem ainda inibir diretamente na
transcrição, ativando vias de morte celular, incluindo morte celular programadas do
tipo I (apoptose) (De Souza e cols., 2006a; Soeiro e De Castro, 2009). Outros
mecanismos de ação que têm também sido propostos incluem: inibição de
proteases, polimerases, proteína cinase A, inibição de síntese de fosfolipídios e
distúrbios no metabolismo de poliaminas (Soeiro e cols., 2005; Werbovetz, 2006).
Apesar da atividade antimicrobiana, as diamidinas hoje disponíveis na clínica
médica e veterinária apresentam freqüentemente considerável toxicidade, como
cardiotoxicidade,
nefrotoxicidade
e
complicações
pancreáticas,
e
a
sua
biodisponibilidade oral é limitada, que se deve ao caráter cationico destes
compostos (Werbovetz, 2006).
Em tripanosomatideos, dados sugerem fortemente que o kDNA possa ser um
dos alvos primários de diamidinas e análogos. Estudos têm revelado que embora
alguns destes compostos aromáticos, com fluorescência intrínsica (ex. DB75 ou
furamidina), se acumulem no núcleo (DNA) e mitocondria (kDNA) de T.brucei
10
Introdução
(Mathis e cols., 2006, 2007) e T.cruzi (De Souza e cols., 2004, Batista e cols.,
2010), sendo predominantemente localizados e acumulados na última estrutura, não
há correlação entre eficácia de DA e preferencial localização e distribuição no kDNA
(Mathis e cols., 2007, Daliry e cols., 2009). Estudos ultra-estruturais e biofísicos tem
revelado danos seletivos ao complexo mitocondria-cinetoplasto atribuídos ao
potencial de associação destes agentes dicatiônicos ao kDNA, em especial, devido
a seu rico conteúdo de adenina e timina (Soeiro e cols., 2005; Werbovetz, 2006;
Soeiro e De Castro, 2009), representando um importante alvo na ação tripanocida, e,
assim, correlaçao com sua atividade biológica (Ismail e cols., 2006; Mathis e cols.,
2007).
Buscando superar e ultrapassar as limitações farmacológicas das DA
atualmente disponíveis na clínica médica, novos análogos tem sido sintetizados. A
DB75 (furamidina), um análogo da pentamidina, apresentou excelente atividade in
vitro contra modelos experimentais de infecções por T.brucei, Pneumocystis jiroveci
e Plasmodium sp. (Soeiro e cols., 2005). Contudo, a DB75 apresenta uma
considerável toxicidade. Assim, com o intuito de manter a sua atividade e diminuir a
toxicidade foi sintetizado uma prodroga, oralmente efetiva, a DB 289 (2,5-bis[4-(Nmetoxiamidino) que esteve em Fase III de ensaios clínicos para o tratamento da
tripanossomíase africana. Apesar de indícios iniciais de baixa toxicidade em
populações africanas, asiáticas, caucasianas e hispânicas (Soeiro e cols., 2008),
resultados posteriores revelaram sua hepatotoxicidade que resultou na retirada da
DB289 da triagem clínica.
Enquanto estes agentes dicatiônicos tem sido muito estudados principalmente
contra tripanosomas africanos, pouco foi analisado como candidatos contra o T.
cruzi (Wilson e cols., 2008). Nos últimos anos, nosso laboratório tem estudado a
atividade destes compostos sobre a infecção por este parasito em ensaios in vitro e
in vivo. Diamidinas como furamidina (DB75), e seu análogo que apresenta uma
substituição da amidina terminal por um grupo fenila (DB569), como também
arilimidamidas tem se revelado promissores agentes anti-T.cruzi (De Souza e cols,
2004, 2006a, 2007, 2010, Silva e cols., 2007a,b; Pacheco e cols., 2009; Batista e
cols., 2010). Alguns destes candidatos exibem consideráveis janelas terapêuticas
(índices de seletividade ≥50), com índices de seletividade superiores as drogas de
referencia para DC (De Souza e cols., 2004, 2006a, b, 2007, Silva e cols., 2007a, b).
Como resultado da colaboração com o Drs. D. Boykin (Universidade do Estado da
Geórgia, E.U.A.) e R. Tidwell (Universidade de Carolina do Norte, E.U.A.), nosso
11
Introdução
grupo tem investigado um grande numero de compostos aromáticos dicatiônicos
heterocíclicos visando uma possível descoberta de uma droga anti-parasitária.
Dados do nosso grupo, com o composto furamidina (DB75) e seu análogo
DB569 revelaram uma considerável atividade in vitro de ambas DA contra diferentes
cepas e fases evolutivas do parasita, exibindo valores inibitórios na faixa micromolar.
Parâmetros físico-químicos da DB569, como sua superior lipofilicidade em relação a
droga parental, permitem sua melhor difusão pelas membranas das células do
hospedeiro como também pelas membranas dos parasitas, facilitando o contato e
captação do composto pelos patogenos intracelulares, explicando assim, a superior
atividade anti-parasitária da DB569 comparada com a DB75, quando testadas contra
o T. cruzi e T. brucei (De Souza e cols., 2004; Mathis e cols., 2006). Como acima
relatado, devido à característica de fluorescência de ambos compostos, foi possível
localizá-los em organelas ricas em DNA como núcleo e mitocondria (KDNA) (De
Souza e cols., 2004, Soeiro e cols., 2005). Análises por citometria de fluxo e
microscopia eletrônica de transmissão (MET) também demonstraram que ambas as
drogas tem como alvo a mitocôndria e o núcleo do parasita e que conduzem a
mudanças morfológicas apresentando características de morte celular programada
do tipo I (De Souza e cols., 2004, 2006b). Estes dados estimularam a análise in vivo
com DB569 mostrando a redução da carga parasitária e também diminuição da
expressão de células T CD8+ nos tecidos cardíacos (De Souza e cols., 2006a,
2007).
DB569
também
reverteu
alterações
eletrocardiográficas
(ECG)
em
camundongos infectados e tratados, e conferiu um aumento na sobrevida deste
grupo quando comparados com os animais não tratados (De Souza e cols., 2007).
No curso da infecção crônica experimental, a DB569 também conferiu proteção
contra alterações elétricas induzidas pela infecção e evidenciadas por ECG,
sugerindo a manutenção de um perfil de ECG normal em parte, devido a redução do
número de infiltrados linfocitários, em especial de células T CD8+ assim como pela
diminuição do parasitismo cardíaco nos animais tratados com esta DA (De Souza e
cols., 2006a, 2007).
Em um recente estudo, foi avaliado o efeito ultraestrutural, biológico e a
localização subcelular de seis derivados da DB75 contra o T. cruzi in vitro (Batista e
cols., 2010b). Os dados demonstraram a baixa toxicidade destes compostos sobre
células de mamíferos (LC50> 96 µM). Com relação a atividade tripanocida,
observou-se que com a exceção das moléculas lineares e de tamanho menor que a
DB75 (ex. DB1627, DB1646 e DB1670), que não foram efetivas, os demais
12
Introdução
derivados (moléculas curvas e de tamanho semelhante, e/ou superior e/ou menores
que a DB75) mostraram uma alta atividade contra ambas as formas evolutivas
pertinentes ao hospedeiro (formas sanguíneas e intracelulares), com valores de IC50
de 0.15-13.3 µM (Batista e cols., 2010b).
Vários transportadores para diamidinas têm sido estudados no tripanosoma
africano, e em espécies de Leishmania e Plasmodium (Carter e cols., 1995, Barret e
cols., 2003, Bray e cols., 2003). No entanto, os mecanismos envolvidos na
internalização de diamidinas pelo T. cruzi ainda não são ainda conhecidos. Como já
nos referimos, as características fluorescentes de alguns destes compostos permite
seguir a distribuição no parasita, como foi realizado previamente em tripanosoma
africano (Mathis e cols., 2006, 2007, Wilson e cols., 2008). Nossos resultados
(Batista e cols., 2010b) em T.cruzi revelaram que a semelhança de T.brucei, estes
seis derivados da DB75 acima descritos se localizam no núcleo e kDNA (com uma
maior intensidade na última estrutura) do parasita, sendo que dois deles (DB1582 e
DB1651) foram também localizados em organelas citoplasmáticas desprovidas de
DNA. Estas organelas foram localizadas preferencialmente na porção anterior do
tripomastigota sanguíneo e próximas do núcleo e regiões de cinetoplasto em
amastigotas, logo, sugerindo que sejam acidocalcisomas como observados
previamente em Trypanosoma brucei (Mathis e cols., 2006). Como sugerido para
tripanosomas africanos, a localização destes compostos nestes compartimentos
ácidos pode representar um alvo de ação, assim como locais de armazenamento e
estoque dos compostos (Mathis e cols., 2006, 2007).
Outras observações feitas pelo nosso grupo, revelaram a ação de outras DA
na desorganização de microtúbulos conduzindo à formação de axonemas múltiplos
em formas sangüíneas tratadas (Silva e cols., 2007a, Batista e cols., 2010a). Como
esta estrutura em tripanosomatideos é muito resistente, quando comparado com as
estruturas de microtúbulos de células de mamífero, pode representar um alvo
interessante para desenvolvimento de novas drogas anti-T.cruzi.
Foi sugerido que a natureza dicatiônica de DA como a pentamidina permite
seu acúmulo na mitocôndria de cinetoplastideos podendo levar ao colapso do
potencial da membrana interna mitocondrial, resultando assim na permeabilização
desta organela, deflagrando a morte dos parasitos (Soeiro e cols., 2005; Werbovetz,
2006, Tidwell e Boykin 2003; Nguyen e cols., 2004; Soeiro e cols., 2008). Recentes
relatos sugerem que a associação das diamidinas com o DNA seja um passo inicial
e que é seguido por mudanças morfológicas que conduzem a instabilidade da
13
Introdução
molécula e modificação e/ou destruição das interações do DNA com a proteína; isto,
levando a erros de replicação, degradação do DNA e morte do parasita (Singh e Dey
2007, Wilson e cols., 2008). Como já discutido, recentes resultados inéditos de
nosso grupo com onze novos compostos dicatiônicos heterocíclicos também
derivados da DB75 mostram que embora estas drogas se localizem no T. cruzi em
maior intensidade no cinetoplasto que no núcleo dos parasitos, nenhuma correlação
pode ser identificada entre acúmulo no kDNA e atividade (Daliry e cols., 2009). Estes
resultados são consistentes com dados prévios de T. brucei (Mathis e cols., 2006).
Arilimidamidas (AIA), previamente conhecidas como amidinas reversas,
apresentam extraordinária ação contra Leishmania (Stephens e cols., 2003, Rosypal
e cols., 2007, 2008) e T. cruzi (Silva e cols., 2007a, b, Pacheco e cols., 2009). AIAs
diferem de outros análogos por apresentar a amidina ligada diretamente ao
nitrogênio do grupo anilino, contrastando com a amidina original, na qual o grupo
imino está diretamente ligado a um anel arila (Stephens e cols., 2001, 2003; Rosypal
e cols., 2008). Dados da literatura demonstram a atividade de AIAs, em
promastigotas e amastigotas de Leishmania major e Leishmania tropica (Rosypal e
cols., 2008). Os autores demonstraram que a maioria dos compostos (9 de 10)
exibiram uma atividade de 250 a 4.5 vezes superior que a pentamidina (Rosypal et
al. 2008). De acordo, dados in vitro sobre o T. cruzi também demonstraram a alta
atividade dose-dependente (IC50 com valores micromolares), sendo também superior
a análogos de DA contendo grupamentos diguanidino (Silva e cols., 2007a). Dados
de MET e citometria de fluxo, também mostraram alterações na mitocôndria em
parasitas tratados com AIAs (Silva e cols., 2007b).
Em outro recente estudo verificamos o efeito tripanocida de vários compostos
heterociclicos catiônicos incluindo diamidinas, um monoamidina, uma arilimidamida e
uma
guanil-hidrazona.
Estes
análogos
mostraram
atividade
em
baixas
concentrações sobre parasitas intracelulares e tripomastigotas sangüíneos de
T.cruzi (Pacheco e cols., 2009). Porém, a potência e seletividade de uma delas, a
AIA DB613A, confirmou resultados anteriores que demonstram a superior eficácia de
AIAs em relação a outras DA contra este parasita.
Com uma AIA, a DB766, ensaios a 37°C in vitro sobre a cepa Y do T. cruzi,
alcançou valores de IC50 de 60 e 25 nanomolar sobre tripomastigotas e amastigotas,
após incubação por 24 e 72 horas, respectivamente. A atividade desta AIA foi
evidente mesmo a 4°C na presença de sangue (96 e 50%). Vale ressaltar a DB766
foi efetiva contra todas as cepas de T.cruzi testadas (12 – isoladas de ciclos
14
Introdução
peridomiciliares, silvestres e domésticos, incluindo as cepas YuYu e Colombiana
consideradas resistentes aos nitroderivados Bz e Nf), sempre com superior eficácia
que o Bz (Batista e cols., 2010a).
As análises in vivo, mostram que a administração da DB766 reduziu a
parasitemia e o parasitismo cardíaco, apresentando atividade sobre a cepa Y e
Colombiana maior ou igual que o BZ, e resultando (dependendo do esquema de
tratamento – doses de até 50 mg/kg/dia, por 10 dias consecutivos, iniciando-se
tratamento no início da parasitemia e somente avaliando animais positivos) em
100% de sobrevida. Entretanto, apesar dos excelentes resultados, o tratamento com
DB766 (intraperitoneal - ip e via oral - p.o.) por até 10 dias não resultou em
significativa cura parasitológica, avaliada pelo hemocultivo e PCR, que também não
foi observado no tratamento com a droga de referência (Batista e cols., 2011a).
O uso combinado de compostos representa uma interessante abordagem
terapêutica. A combinação de Bz (oral) e DB766 (ip) resultou em parasitemia não
detectável, sobrevida de 100% e recuperação de caquexia. Em relação à análise de
cura parasitológica avaliada por hemocultivo e PCR, observamos que embora em
nenhum dos protocolos utilizados houvesse cura parasitológica com o Bz (até 20
dias de tratamento), a terapia combinada de DB766+Bz resultou na cura de 2
animais dos quinze sobreviventes (13%). Este tratamento combinado resultou em
reduções superiores a 99.5% na parasitemia e parasitismo cardíaco dos animais, e
de 60 e 90% nos níveis de marcadores de lesões teciduais (hepático e cardíaco,
respectivamente). Verificou-se que um dos três animais sobreviventes tratados com
DB766 (50 mg/kg/dia, p.o.) revelou-se curado pelos parâmetros de hemocultivo e
PCR (Batista e cols., 2011b)
Estes dados estimulam a continuidade de estudos com esta nova classe de
compostos (AIA) isoladamente ou associada a outros fármacos licenciados, como os
medicamentos de referência NF e Bz, objetivando a identificação de novos
candidatos para o tratamento da doença de Chagas.
15
Objetivos
Objetivos
16
Objetivos
Objetivo Geral
A presente tese tem como proposta avaliar através de estudos in vitro e in
vivo a atividade biológica de diamidinas aromáticas, e análogos como
arilimidamidas, sobre o Trypanosoma cruzi. Neste contexto, os seguintes
objetivos específicos foram contemplados:
Objetivos específicos
Objetivo específico 1: Avaliar a atividade tripanocida in vitro de
diamidinas
aromáticas
e
arilimidamidas
contra
formas
tripomastigotas
sanguíneas, amastigotas intracelulares e epimastigotas de diferentes cepas do
T. cruzi, comparando-as com a ação das drogas de referências (benznidazol e
violeta de genciana).
Objetivo específico 2: Determinar o limiar de toxicidade in vitro das
diamidinas aromáticas e arilimidamidas sobre células de mamíferos (cultivo
primário de células cardíacas).
Objetivo específico 3: Identificar por ensaios de microscopia de
fluorescência, microscopia eletrônica de transmissão e citometria de fluxo, a
localização e distribuição intracelular dos compostos e seus alvos celulares em
formas tripomastigotas sanguíneas e intracelulares do T. cruzi frente ao
tratamento in vitro.
Objetivo específico 4: Com base na determinação dos valores de IC 50 e
LC50, estabelecer os índices de seletividade (IS) dos compostos visando
selecionar os mais ativos para condução de estudos in vivo.
Objetivo específico 5: Investigar in vivo a toxicidade aguda e eficácia de
diamidinas aromáticas (DB1362) e arilimidamidas (DB1965) sobre diferentes
modelos experimentais de infecção aguda pelo T. cruzi.
17
Objetivos
Objetivo específico 6: Verificar o efeito in vivo do co-tratamento da
arilimidamida
DB1965
associada
ao
Benznidazol
experimental aguda de camundongos pelo T. cruzi.
18
durante
a
infecção
Resultados
RESULTADOS
19
Resultados
Artigo#01: Publicado na Antimicrobial Agents and Chemotherapy, em 2008
Título: “In vitro and in vivo studies of the trypanocidal activity of a
Diarylthiophene dimidine against Trypanosoma cruzi”
Estado do conhecimento quando da concepção do trabalho:
 A doença de Chagas é uma doença tropical negligenciada, mas que apesar
de sua importância epidemiológica, ainda não apresenta terapia ideal
justificando a busca por novos agentes quimioterápicos.
 Diamidinas aromáticas utilizadas na clínica médica (ex. pentamidina), apesar
de excelente atividade biológica, apresentam efeitos colaterais indesejáveis
além de baixa biodisponibilidade oral, estimulando vários grupos de química
medicinal a sintetizar análogos que mantenham sua excelente ação, mas que
apresentem menor toxicidade e que possam ser administrados via oral.
 Questões propostas:
1. Investigar através de ensaios in vitro, a atividade antiparasitária, toxicidade,
seletividade e alvos celulares da diamidina DB1362 sobre tripomastigotas de
sangue e forma intracelular de Trypanosoma cruzi
2. Correlacionar atividade tripanocida in vivo da DB1362 com a droga de
referência, o benznidazol, através do uso de modelos experimentais de
infecção aguda pelo T.cruzi.
Seguem 8 páginas
20
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 2008, p. 3307–3314
0066-4804/08/$08.00⫹0 doi:10.1128/AAC.00038-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Vol. 52, No. 9
In Vitro and In Vivo Studies of the Trypanocidal Activity of a
Diarylthiophene Diamidine against Trypanosoma cruzi䌤†
Cristiane França da Silva,1 Marcos Meuser Batista,1 Denise da Gama Jaen Batista,1 Elen Mello de Souza,1
Patrı́cia Bernardino da Silva,1 Gabriel Melo de Oliveira,1 Andrea Souza Meuser,1 Abdur-Rafay Shareef,2
David W. Boykin,2 and Maria de Nazaré C. Soeiro1*
Lab. Biologia Celular, Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro, Brazil,1 and
Department of Chemistry, Georgia State University, Atlanta, Georgia2
Received 9 January 2008/Returned for modification 22 February 2008/Accepted 24 June 2008
Aromatic diamidines are DNA minor groove-binding ligands that display excellent antimicrobial activity
against fungi, bacteria, and protozoa. Due to the currently unsatisfactory chemotherapy for Chagas’ disease
and in view of our previous reports regarding the effect of diamidines and analogues against both in vitro and
in vivo Trypanosoma cruzi infection, this study evaluated the effects of a diarylthiophene diamidine (DB1362)
against both amastigotes and bloodstream trypomastigotes of T. cruzi, the etiological agent of Chagas’ disease.
The data show the potent in vitro activity of DB1362 against both parasite forms that are relevant for
mammalian infection at doses which do not exhibit cytotoxicity. Ultrastructural analysis and flow cytometry
studies show striking alterations in the nuclei and mitochondria of the bloodstream parasites. In vivo studies
were performed at two different drug concentrations (25 and 50 mg/kg/day) using a 2-day or a 10-day regimen.
The best results were obtained when acutely infected mice were treated with two doses at the lower concentration, resulting in 100% survival, compared to the infected and untreated mice. Although it did not display
higher efficacy than benznidazole, DB1362 reduced both cardiac parasitism and inflammation, and in addition,
it protected against the cardiac alterations (determined by measurements) common in T. cruzi infection. These
results support further investigation of diamidines and related compounds as potential agents against Chagas’
disease.
based largely on nifurtimox and benznidazole (Bz), which are
only partially effective and have considerable side effects (21,
29), and this clearly demonstrates the urgent need for new
drugs.
Despite their well-known antimicrobial activity, diamidines
often exhibit high toxicity, such as cardiotoxicity, nephrotoxicity, and pancreatic complications, and display poor oral bioavailability, which is likely due to their cationic character (30).
To overcome these limitations, new aromatic dications and
their prodrugs have been synthesized and screened both in
vitro and in vivo against different pathogens (2, 26). Recent
studies have shown good in vitro and in vivo activity for diamidines such as furamidine (DB75), its N-phenyl-substituted
analogue (DB569), and reversed amidines (5, 7, 8, 23, 24)
against T. cruzi. The trypanocidal effect of these dications led
to the evaluation of in vitro and in vivo antiparasitic activity of
the diarylthiophene diamidine DB1362 against T. cruzi.
Aromatic diamidines, such as pentamidine, have been studied since the 1930s, when significant activity against African
trypanosomes was reported (25). Since then, several studies
have demonstrated their excellent activity against different
pathogens, such as bacteria, fungi and protozoa, which has
been attributed, in part, to the association of the dicationic
molecules to the DNA minor groove at AT-rich sites (28).
Although recent data obtained with African trypanosomes
show that neither the DNA affinity nor the distribution in the
parasite can be directly related to diamidine (and analogue)
activity (16, 17), the concentration of diamidines in parasite
mitochondria (kinetoplast) appears to represent a pivotal step
in their antitrypanosomal action, and thus the diamidine-kinetoplast DNA interaction seems to be an important part of
their biological activity (13, 17). Chagas’ disease, caused by the
protozoan Trypanosoma cruzi, is a neglected disease that affects 12 to 14 million people in areas of endemicity in Latin
America, where approximately 100 million people are at risk
(19). The disease is a major public health problem in the
affected areas. The infection triggers an important cardiomyopathy, for which the pathophysiological mechanisms are not
completely understood (20, 27). Current chemotherapy is
MATERIALS AND METHODS
The synthesis of 3-bromo-4-methyl-2,5-bis(4-amidinophenyl)thiophene dihydrochloride (DB1362) is described in the supplemental material.
Drug solutions. Stock solutions (5 mM) of DB1362 (Fig. 1) were prepared in
dimethyl sulfoxide, with the final concentration of the latter in the experiments
never exceeding 0.6%, which did not exhibit any toxicity for the parasite or
mammalian host cells (data not shown).
Cell cultures. For both drug toxicity and infection assays, primary cultures of
peritoneal mouse macrophages were obtained as described previously (1),
seeded at a density of 5 ⫻ 104 cells/well into 96-well culture plates or at 3 ⫻ 105
cells/well into 24-well culture plates, respectively, and sustained in Dulbecco’s
modified medium supplemented with 10% fetal bovine serum and 4 mM Lglutamine (DMES). All the cell cultures were maintained at 37°C in an atmo-
* Corresponding author. Mailing address: Lab. Biologia Celular, Instituto Oswaldo Cruz, FIOCRUZ, Avenida Brasil 4365, Manguinhos,
21045-900, Rio de Janeiro, RJ, Brazil. Phone: (55-21) 25984534. Fax:
(55-21) 25984577. E-mail: [email protected].
† Supplemental material for this article may be found at http://aac
.asm.org/.
䌤
Published ahead of print on 14 July 2008.
3307
3308
SILVA ET AL.
FIG. 1. Chemical structure of DB1362.
sphere of 5% CO2 and air, and the assays were run three times at least in
duplicate.
Parasites. The Y strain of T. cruzi was used throughout the experiments. Cell
culture-derived trypomastigotes were isolated from the supernatant of Vero
lineage cells (from green monkey kidney) which had been previously infected
with bloodstream trypomastigotes (5). Bloodstream forms were harvested by
heart puncture from T. cruzi-infected Swiss mice at the parasitemia peak day (4).
Toxicity for mammalian cell cultures. Uninfected peritoneal macrophages
were incubated for 24 to 48 h at 37°C in the absence of DB1362 or the presence
of increasing doses (10.6 to 96 ␮M) of DB1362, their viability was evaluated by
light microscopy using the trypan blue exclusion assay (23), and the 50% lethal
dose (drug concentration that reduces the number of viable cells 50%) was
calculated.
Trypanocidal analysis. Bloodstream trypomastigotes were incubated at 37°C
for 24 h in the presence of increasing doses (0 to 32 ␮M) of DB1362 diluted in
DMES (24). Alternatively, bloodstream parasites were incubated for 24 h at 4°C
with DB1362 diluted in whole blood collected from T. cruzi-infected mice (23).
After drug incubation, the death rates were determined by using light microscopy
for direct quantification of the number of live parasites using a Neubauer chamber, and the 50% inhibitory concentration (IC50) (drug concentration that reduces the number of treated parasites 50%) was calculated (24). For the analysis
of the effect on intracellular amastigotes, after initial host cell-parasite contact
(24 h) with cell culture-derived trypomastigotes, the macrophages were washed
to remove free parasites and treated at 37°C for 24 and 48 h with DB1362 (0.39
to 10.6 ␮M). Infected cultures not subjected to the drug treatment were used as
controls. All cell cultures were maintained at 37°C in an atmosphere of 5% CO2
and air, and culture medium was replaced every 24 h. After the drug exposure,
the untreated and treated infected cultures were fixed and stained with Giemsa
solution and the mean numbers of infected host cells and of parasites per
infected cell were then scored as reported previously (23). Only characteristic
parasite nuclei and kinetoplasts were counted as surviving parasites, since irregular structures could indicate parasites undergoing death. The drug activity was
estimated by calculating the endocytic index (percentage of infected cells times
the average number of intracellular amastigotes per infected host cell) (23).
Flow cytometry analysis. Bloodstream trypomastigotes (2 ⫻ 106 cells/ml) were
briefly washed in phosphate-buffered saline (PBS) and treated for 24 h at 37°C
with the respective IC50 (previously determined) of the compound diluted in
dimethyl sulfoxide. After treatment, the parasite suspension was incubated for 15
min at 37°C with 10 ␮g/ml rhodamine 123 (Rh123) (24). Data acquisition and
analysis were performed with a FACSCalibur flow cytometer (Becton Dickinson,
San Jose, CA) equipped with Cell Quest software (Joseph Trotter, Scripps
Research Institute, San Diego, CA). A total of 10,000 events were acquired in the
region established as that corresponding to bloodstream trypomastigotes, and
the alterations in the Rh123 fluorescence were quantified by calculating the
mean percentages of treated and untreated parasite populations that displayed
depolarization of the mitochondrial membrane (designated M2). All assays were
run three times at least in duplicate.
TEM analysis. Bloodstream trypomastigotes and uninfected host cells treated
for 24 h at 37°C with the corresponding IC50 of the drug or left untreated were
fixed for 60 min at 4°C with 2.5% glutaraldehyde and 2.5 mM CaCl2 in 0.1 M
cacodylate buffer, pH 7.2, and postfixed for 1 h at 4°C with 1% OsO4, 0.8%
potassium ferricyanide, and 2.5 mM CaCl2 using the same buffer. Samples were
routinely processed for transmission electron microscopy (TEM) and examined
in a Zeiss EM10C electron microscope (Oberkochen, Germany) (5).
In vivo infection. Male Swiss mice were obtained from the Fundação Oswaldo
Cruz (FIOCRUZ) animal facilities (Rio de Janeiro, Brazil). Mice were housed
at a maximum of eight per cage and kept in a conventional room at 20 to 24°C
with a 12/12-h light/dark cycle. The animals were provided with sterilized water
and chow ad libitum. Infection was performed by intraperitoneal (i.p.) injection
of 104 bloodstream trypomastigotes. The animals (28 to 33 g) were divided into
the following groups: uninfected (not infected and not treated); untreated (in-
ANTIMICROB. AGENTS CHEMOTHER.
fected with T. cruzi but not treated); and treated (infected and treated with 25
and 50 mg of DB1362 per kg of body weight per day or with 100 mg/kg/day Bz).
For DB1362 treatment, mice received a 0.1-ml i.p. injection at 5 and 8 days
postinfection (dpi) or starting at 3 dpi for 10 consecutive days as described
previously (7). For Bz treatment, infected mice received a 0.2-ml oral dose
(gavage) according to the therapeutic schemes described above. At least eight
mice from each group were used for analysis in each of two or three independent
experiments that were performed.
Parasitemia, mortality rates, and ponderal curve analysis. Parasitemia was
individually checked by direct microscopic counting of parasites in 5 ␮l of blood,
as described before (7). At 7, 14, and 21 dpi, body weight was evaluated, and
mortality was checked daily until 60 dpi and expressed as a percentage of
cumulative mortality (8).
ECG. Electrocardiography (ECG) recording and analysis were performed in
uninfected mice and in acutely T. cruzi-infected mice (14 dpi) receiving DB1362
and Bz therapy or not treated, as previously described (8). Briefly, mice were
placed under stable sedation with diazepam (20 mg/kg, i.p.) and fixed in the
supine position, and an eight-lead ECG was recorded from 18-gauge needle
electrodes subcutaneously implanted in each limb and two electrodes at precordial position lead II. The electrocardiographic tracings were obtained with a
standard lead (dipolar lead DII), recording with an amplitude set to give 2 mV/s.
The ECG was recorded by using band-pass filtering (Bio Amp; AD Instruments,
Hastings, United Kingdom) between 0.1 and 100 Hz. Supplementary amplification and analog-digital conversion was performed with a Powerlab 16S
instrument (AD Instruments). Digital recordings (16 bit, 4 kHz/channel) were
analyzed with the Scope (version 3.6.10) program (AD Instruments). The
signal-averaged ECG was calculated by using the mouse signal-averaged ECG
extension (version 1.2) program (AD Instruments) and a template-matching
algorithm. ECG parameters were evaluated using the following standard criteria:
(i) the heart rate (beats/minute) was monitored, and (ii) the variation at P wave
and the PQ, QRS, and QT intervals were measured in milliseconds.
Histopathological analysis. At 14 dpi, hearts were removed, cut longitudinally,
rinsed in ice-cold PBS, and fixed in Millonig-Rosman solution (10% formaldehyde in PBS). The tissues were dehydrated and embedded in paraffin. Sections
(3 ␮m) were stained with hematoxylin-eosin and were analyzed by light microscopy. The number of amastigote nests and of inflammatory infiltrates (more than
10 mononuclear cells) was determined in at least 30 fields (total magnification,
⫻40) for each slide. The mean number of amastigote nests or inflammatory
infiltrates per field was obtained from at least three mice per group with three
sections from each mouse.
Statistical analysis. Statistical analysis was carried out using an analysis of
variance program with the level of significance set at a P value of ⱕ0.05. The data
are representative of two to four experiments run in duplicate.
All procedures were carried out in accordance with the guidelines established
by the FIOCRUZ Committee of Ethics for the Use of Animals (CEUA 0099/01).
RESULTS
Treatment of bloodstream parasites with DB1362 for 24 h at
4°C in the presence of blood constituents resulted in an IC50 of
7.07 ␮M (Fig. 2A). Although treatment performed at 37°C
showed an IC50 of 6.6 ␮M, about 90% of parasites died with
the dose of 32 ␮M (Fig. 2B), while only 60% was with the same
dose when mouse blood constituents were added (Fig. 2A).
TEM studies showed that in untreated parasites typical organelles, such as nuclei and mitochondria, could be easily identified (Fig. 2C, inset). However, diamidine treatment induced
profound alterations in the kinetoplast organization (Fig. 2D)
and in the nucleus (Fig. 2D, inset). Due to the ultrastructural
findings showing striking changes in the mitochondria, Rh123
was further used as a probe of the mitochondrial membrane
potential (MMP) (4). Incubation of bloodstream trypomastigotes with the DB1362 caused an increase (P ⫽ 0.06) in the
number of parasites that displayed interference in the proton
electrochemical potential gradient of the mitochondrial membrane (Fig. 2F). Treatment reduced the MMP in 57% of the
bloodstream forms exposed to DB1362 (Fig. 2F), in contrast to
what occurred in the untreated group, which displayed a 14%
VOL. 52, 2008
ANTI-T. CRUZI ACTIVITY OF DB1362
3309
FIG. 2. Effect of DB1362 on bloodstream trypomastigotes of T. cruzi (Y strain) in vitro. Activity was evaluated during treatment at 4°C with
the drug diluted in whole mouse blood (A) and at 37°C with the drug diluted in culture medium (B). The percentage of dead parasites was measured
after 24 h of treatment. Asterisks indicate significant differences for DB1362-treated parasites in relation to the untreated samples (P ⱕ 0.05). (C
to F) Transmission electron micrographs (C and D) and flow cytometry analysis (E and F) of trypomastigotes exposed to DB1362 for 24 h.
Untreated parasites display typical mitochondria (C, inset) and nuclei (C), while DB1362-treated parasites show swelling mitochondria and
damaged kinetoplasts (D) and alterations in nuclear morphology (D, inset). Bars ⫽ 2 ␮m (C and D) and 10 ␮m (insets). (E and F) Histograms
showing results of a representative assay, displaying fluorescence intensities of untreated (E) and diamidine-treated parasites (F) after incubation
with Rh123. M1, high-fluorescence-intensity peaks; M2, low-fluorescence-intensity peaks, which represent decreased MMP. k, kinetoplast; n,
nucleus.
reduction (Fig. 2E). The latter value corresponds to the percentage of bloodstream parasites that displayed apoptosis-like
characteristics before drug incubation (4, 15).
Treatment with DB1362 resulted in considerable loss of
mammalian cell viability only when the cultures were incubated with 32 ␮M or higher doses, showing 50% lethal doses of
22.8 (Fig. 3A) and 20 (data not shown) ␮M after 24 and 48 h
of incubation, respectively. TEM analysis performed in the
3310
SILVA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 3. Cytotoxicity analysis of DB1362 in mammalian host cells (A and B) and diamidine activity against T. cruzi-infected peritoneal
macrophages after 24 (C) and 48 (C to F) h of treatment. The effect of DB1362 on mammalian host cells was evaluated by both trypan blue
exclusion assays (A) and TEM (B). Loss of cellular viability was noticed only when the cultures were incubated with 32 ␮M or higher doses (A).
Ultrastructural analysis shows characteristic nuclei and mitochondria of the mammalian cell after exposure to the diamidine (B). N, nuclei; M,
mitochondria. Bar ⫽ 10 ␮M. (C to F) DB1362 activity against intracellular amastigotes in T. cruzi-infected host cells. The activity of DB1362 after
24 and 48 h of drug incubation is shown by the inhibition of the endocytic index (EI) (C). Asterisks indicate significant differences between
treated-T. cruzi-infected peritoneal macrophages and untreated cultures (P ⱕ 0.05). (D to F) Light microscopy of untreated (D) and T.
cruzi-infected (E and F) host cells exposed to 0.39 ␮M (E) and 1.18 ␮M (F) DB1362 for 48 h. Arrows indicate intracellular parasites. Bars ⫽
1 ␮m.
DB1362-treated mammalian cells did not reveal ultrastructural damage in either nuclei or mitochondria of the host
cells (Fig. 3B).
Incubation of infected cultures with selected nontoxic doses
(up to 10.6 ␮M) of DB1362 significantly reduced both the
percentage of infected cells and the mean number of parasites
per infected cells (Fig. 3C and E to F). The endocytic index
(Fig. 3C) showed IC50s of 10.6 ␮M and 0.62 ␮M after 24 and
48 h of treatment, respectively.
In vivo studies were performed using different drug concentrations and treatment schemes (doses up to 50 mg/kg/day, i.p.
route) at doses which did not induce mortality in the control
group (data not shown). The infected and untreated group
presented high parasitemia levels, peaking at 8 dpi (Fig. 4A
and B) and displayed 40 to 50% mortality at 60 dpi (Fig. 4C).
As expected, T. cruzi infection caused loss of body weight (P ⫽
0.014) compared to uninfected animals (Fig. 4D). When a
25-mg/kg/day dose of DB1362 was administered twice (at 5 dpi
and 8 dpi), 100% survival was observed. However, only a 40%
reduction (P ⫽ 0.1) in the bloodstream parasitemia levels
compared to controls was noted. Furthermore, only a moderate improvement in the ponderal curve was observed (Fig. 4A
to D). Administration of 50 mg/kg/day, following the protocol
described above, resulted in a slight increase in both parasitemia peak levels (P ⫽ 0.15) and cumulative mortality
compared to infected and untreated animals (Fig. 4A to D).
The oral administration (gavage) of 100 mg/kg/day Bz (reference drug) at 5 and 8 dpi reduced both the parasitemia
VOL. 52, 2008
ANTI-T. CRUZI ACTIVITY OF DB1362
3311
FIG. 4. Parasitemia levels (A and E), parasitemia peak at 8 dpi (B and F), mortality rates (C), and mean weights at 21 dpi (D) of mice infected with
the Y strain of T. cruzi and treated with DB1362 or Bz at 5 and 8 dpi (A to D) and 3 to 12 dpi (E and F). The single asterisk indicates significant differences
between T. cruzi-infected mice and uninfected mice (P ⱕ 0.05). Double asterisks indicate significant differences between T. cruzi-infected, treated mice
and infected, untreated animals (P ⱕ 0.05).
3312
SILVA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 5. Parasitism and inflammatory infiltrates in the heart (A) and ECG findings (B and C) for mice infected with T. cruzi and treated with
DB1362 or Bz or left untreated. (A) Parasitism and inflammatory infiltration were decreased by diamidine and Bz treatment. (B) Mean cardiac
frequencies were determined by ECG analysis in uninfected, infected but untreated, Bz-treated, and DB1362-treated mice. The single asterisk
indicates significant differences between T. cruzi-infected mice and uninfected mice (P ⱕ 0.05). Double asterisks indicate significant differences
between T. cruzi-infected, treated mice and infected, untreated animals (P ⱕ 0.05). (C) Representative electrocardiographic tracing of uninfected,
infected but untreated, Bz-treated, and DB1362-treated mice. Note the normal patterns in uninfected mice and the variations in the heart rate
(traced lines) for infected but untreated animals, which were partially recovered in both drug-treated groups.
peak levels (P ⫽ 0.002) and mortality rates and led to a
partial recovery of body weight compared to the uninfected
group (Fig. 4A to D).
Administration of 25 mg/kg/day of DB1362 at 3 dpi for 10
consecutive days did not abolish circulating parasitemia peak
levels (P ⫽ 0.2), as was observed for the Bz group also treated
for 10 consecutive days (P ⫽ 0.0008) (Fig. 4E and F). However,
DB1362 significantly decreased cardiac parasitism (P ⫽ 0.02),
VOL. 52, 2008
ANTI-T. CRUZI ACTIVITY OF DB1362
reducing by 90% the number of parasite nests at 14 dpi compared to untreated animals (Fig. 5A). Histopathological analysis of DB1362-treated animals also showed an important decrease (P ⫽ 0.0016) in cardiac inflammatory infiltration,
reaching about 70% reduction, compared to nontreated mice
(Fig. 5A). Cardiac parasitism and inflammation were completely eliminated in the Bz group after 10 days of treatment
(Fig. 5A).
The analysis of ECG showed that sinus bradycardia, detected by low heart rates, was the prevailing disorder found in
untreated mice compared to the uninfected group (Fig. 5B and
C). At 14 dpi, infected mice displayed a 32% reduction in heart
rate (P ⫽ 0.000005) compared to uninfected animals (Fig. 5B).
DB1362 treatment partially reversed (P ⫽ 0.037) this ECG
alteration, and diamidine-treated mice displayed rate reductions of only 16% compared to uninfected mice (Fig. 5B and
C). Treatment with Bz also blocked the ECG alteration,
giving values similar to those for the counterpart uninfected
group (Fig. 5B and C).
DISCUSSION
In view of the long history of aromatic diamidines as antiparasitic agents along with the promising activity of diamidines
and analogues against T. cruzi (5, 8, 23, 24), the present study
evaluated both in vitro and in vivo effects of DB1362 against
this protozoan parasite. The present results show that DB1362
displays a trypanocidal effect against both bloodstream trypomastigotes and amastigotes localized within host cells in vitro,
corroborating previous data that showed good dose-dependent
activity of dicationic molecules against T. cruzi at noncytotoxic
doses (5). The effect of DB1362 against bloodstream forms in
the presence of mouse blood was reduced, possibly due to the
association of the diamidine with serum components, as demonstrated with other drugs (22).
Ultrastructural analysis showed that the parasite mitochondria (kinetoplasts) were significantly affected by diamidine
treatment without similar alterations in the mammalian host
cells. This type of damage has been reported with other
diamidines (3, 5, 9, 10, 12) and reversed amidines (24).
Significantly, the flow cytometry studies corroborated the
TEM results showing that DB1362 targeted the mitochondrion-kinetoplast complex. The use of Rh123 suggested interference with the proton electrochemical potential gradient of the mitochondrial membrane of T. cruzi similar to
that shown upon treatment of trypomastigotes with other
diamidines and reversed amidines (6, 24). Additional biochemical, ultrastructural, and biophysical studies are needed
to more fully understand the mechanism of action of such
diamidines.
Due to the trypanocidal effect of DB1362 in vitro, we performed in vivo studies to evaluate the activity of this diamidine
against T. cruzi infection in mice. Since preliminary data
showed that the intravenous dosing route resulted in high
mortality rates, we opted for the i.p. route, using drug concentrations (up to 50 mg/kg) that did not result in any animal
mortality (data not shown). In these studies, we employed
different protocols for the administration of DB1362: 2 or 10
consecutive injections before or at the onset of parasitemia,
respectively. The best results were obtained when acutely in-
3313
fected mice were treated with two doses of 25 mg/kg. DB1362
resulted in animal protection against T. cruzi infection, with
100% survival in this group, compared to 40 to 50% mortality
in the control group at 60 dpi. These trypanocidal data for
aromatic diamidines against T. cruzi in vivo corroborate previous studies in the same mouse model, which demonstrated
the protective role of the diamidine DB569 (7). Importantly,
although a 10-dose regimen did not eliminate the circulating
parasites, histological analysis of heart samples at 14 dpi, corresponding to the peak of both cardiac parasite load and inflammation in our experimental model (7), showed a striking
statistically significant decline of both of these factors in the
DB1362 group compared to untreated mice. Similar results
were found with DB569, which did not entirely reduce all of
the circulating bloodstream trypomastigotes; however, it did
clear cardiac parasitism and protected against heart rate alterations characteristic of T. cruzi infection (8).
This study shows that while displaying in vivo activity superior to that of DB569 by resulting in 100% survival of mice, the
diarylthiophene diamidine did not clear the circulating parasites as did Bz. The latter fact may be attributed to parasite
burden in noncardiac tissues. Overall, the in vitro and in vivo
data support further investigation of this class of compounds
against T. cruzi and other trypanosomatids.
ACKNOWLEDGMENTS
The present study was supported by grants from Fundação Carlos
Chagas Filho de Amparo a Pesquisa do Estado do Rio de Janeiro
(FAPERJ and Pensa Rio/FAPERJ), Conselho Nacional Desenvolvimento Cientı́fico e Tecnológico (CNPq), DECIT/SCTIE/MS and MCT
by CNPq, and PAPES/FIOCRUZ. Funding to D.W.B. by the Bill and
Melinda Gates Foundation is gratefully acknowledged.
REFERENCES
1. Araujo-Jorge, T. C., E. P. Sampaio, W. De Souza, and M. N. Meirelles. 1989.
Trypanosoma cruzi: the effect of variations in experimental conditions on the
levels of macrophage infection in vitro. Parasitol. Res. 75:257–263.
2. Barrett, M. P., D. W. Boykin, R. Brun, and R. R. Tidwell. 2007. Human
African trypanosomiasis: pharmacological re-engagement with a neglected
disease. Br. J. Pharmacol. 152:1155–1171.
3. Croft, S. L., and R. P. Brazil. 1982. Effect of pentamidine isethionate on the
ultrastructure and morphology of Leishmania mexicana amazonensis in vitro.
Ann. Trop. Med. Parasitol. 76:37–43.
4. de Meirelles, M. N., T. C. Araújo-Jorge, and W. de Souza. 1982. Interaction
of Trypanosoma cruzi with macrophages in vitro: dissociation of the attachment and internalization phases by low temperature and cytochalasin B. Z.
Parasitenkd. 68:7–14.
5. De Souza, E. M., A. Lansiaux, C. Bailly, W. D. Wilson, Q. Hu, D. W. Boykin,
M. M. Batista, T. C. Araujo-Jorge, and M. N. Soeiro. 2004. Phenyl substitution of furamidine markedly potentates its anti-parasitic activity against
Trypanosoma cruzi and Leishmania amazonensis. Biochem. Pharmacol. 68:
593–600.
6. De Souza, E. M., R. Menna-Barreto, T. C. Araujo-Jorge, A. Kumar, Q. Hu,
D. W. Boykin, and M. N. Soeiro. 2006. Antiparasitic activity of aromatic
diamidines is related to apoptosis-like death in Trypanosoma cruzi. Parasitology 133:75–79.
7. de Souza, E. M., G. M. Oliveira, D. W. Boykin, A. Kumar, Q. Hu, and M. N.
Soeiro. 2006. Trypanocidal activity of the phenyl-substituted analogue of
furamidine DB569 against Trypanosoma cruzi infection in vivo. J. Antimicrob. Chemother. 58:610–614.
8. De Souza, E. M., G. Melo, M. N. Soeiro, and D. W. Boykin. 2007. Electrocardiographic findings in acutely and chronically Trypanosoma cruzi-infected
mice treated by a phenyl-substituted analogue of furamidine DB569. Drug
Target Insights 2:61–69.
9. Fusai, T., Y. Boulard, R. Durand, M. Paul, C. Bories, D. Rivollet, A. Astier,
R. Houin, and M. Deniau. 1997. Ultrastructural changes in parasites induced
by nanoparticle-bound pentamidine in a Leishmania major/mouse model.
Parasite 4:133–139.
10. Hentzer, B., and T. Kobayasi. 1977. The ultrastructural changes of Leishmania tropica after treatment with pentamidine. Ann. Trop. Med. Parasitol.
71:157–166.
3314
SILVA ET AL.
11. Reference deleted.
12. Hu, L., R. K. Arafa, M. A. Ismail, T. Wenzler, R. Brun, M. Munde, W. D.
Wilson, S. Nzimiro, S. Samyesudhas, K. A. Werbovetz, and D. W. Boykin.
2008. Azaterphenyl diamidines as antileishmanial agents. Bioorg. Med.
Chem. Lett. 18:247–251.
13. Ismail, M. A., R. K. Arafa, R. Brun, T. Wenzler, Y. Miao, W. D. Wilson, C.
Generaux, A. Bridges, J. E. Hall, and D. W. Boykin. 2006. Synthesis, DNA
affinity, and antiprotozoal activity of linear dications: terphenyl diamidines
and analogues. J. Med. Chem. 49:5324–5332.
14. Reference deleted.
15. Marin-Neto, J. A., E. Cunha-Neto, B. C. Maciel, and M. V. Simões. 2007.
Pathogenesis of chronic Chagas heart disease. Circulation 115:1109–1123.
16. Mathis, A. M., J. L. Holman, L. M. Sturk, M. A. Ismail, D. W. Boykin, R. R.
Tidwell, and J. E. Hall. 2006. Accumulation and intracellular distribution of
antitrypanosomal diamidine compounds DB75 and DB820 in African trypanosomes. Antimicrob. Agents Chemother. 50:2185–2191.
17. Mathis, A. M., A. S. Bridges, M. A. Ismail, A. Kumar, I. Francesconi, M.
Anbazhagan, Q. Hu, F. A. Tanious, T. Wenzler, J. Saulter, W. D. Wilson, R.
Brun, D. W. Boykin, R. R. Tidwell, and J. E. Hall. 2007. Diphenyl furans and
Aza analogs: effects of structural modification on in vitro activity, DNA
binding, and accumulation and distribution in trypanosomes. Antimicrob.
Agents Chemother. 51:2801–2810.
18. Reference deleted.
19. Pinto Dias, J. C. 2006. The treatment of Chagas disease (South American
trypanosomiasis). Ann. Intern. Med. 144:772–774.
20. Rocha, M. O., M. M. Teixeira, and A. L. Ribeiro. 2007. An update on the
management of Chagas cardiomyopathy. Expert Rev. Anti-Infect. Ther.
5:727–743.
ANTIMICROB. AGENTS CHEMOTHER.
21. Rodriques Coura, J., and S. L. de Castro. 2002. A critical review on Chagas’
disease chemotherapy. Mem. Inst. Oswaldo Cruz 97:3–24.
22. Santa-Rita, R. M., H. S. Barbosa, and S. L. de Castro. 2006. Ultrastructural
analysis of edelfosine-treated trypomastigotes and amastigotes of Trypanosoma cruzi. Parasitol. Res. 100:187–190.
23. Silva, C. F., M. M. Batista, R. A. Mota, E. M. De Souza, C. E. Stephens,
D. W. Boykin, and M. N. Soeiro. 2007. Activity of “reversed” diamidines
against Trypanosoma cruzi in vitro. Biochem. Pharmacol. 73:1939–1946.
24. Silva, C. F., M. B. Meuser, E. M. De Souza, M. N. Meirelles, C. E. Stephens,
P. Som, D. W. Boykin, and M. N. Soeiro. 2007. Cellular effects of reversed
amidines on Trypanosoma cruzi. Antimicrob. Agents Chemother. 51:3803–
3809.
25. Soeiro, M. N., E. M. De Souza, C. E. Stephens, and D. W. Boykin. 2005.
Aromatic diamidines as antiparasitic agents. Expert Opin. Investig. Drugs
14:957–972.
26. Soeiro, M. N. C., E. M. De Souza, and D. W. Boykin. 2007. Anti-parasitic
activity of aromatic diamidines and their patented literature. Expert Opin.
Ther. Patents 17:1–13.
27. Teixeira, A. R. L., N. Nitz, M. C. Guimaro, C. Gomes, and C. A. Santos-Buch.
2006. Chagas disease. Postgrad. Med. J. 82:788–798.
28. Tidwell, R. R., and D. W. Boykin. 2003. Dicationic DNA minor groove
binders as antimicrobial agents, p. 414–460. In M. Demeunynck, C. Bailly,
and W. D. Wilson (ed.), Small molecule DNA and RNA binders: from
synthesis to nucleic acid complexes. Wiley-VCH, New York, NY.
29. Villa, L., S. Morote, O. Bernal, D. Bulla, and P. Albajar-Vinas. 2007. Access
to diagnosis and treatment of Chagas disease/infection in endemic and nonendemic countries in the XXI century. Mem. Inst. Oswaldo Cruz 102:87–94.
30. Werbovetz, K. 2006. Diamidines as antitrypanosomal, antileishmanial and
antimalarial agents. Curr. Opin. Investig. Drugs 7:147–157.
Resultados
Artigo#02: Publicado na Memórias do Instituto Oswaldo Cruz, em 2010.
Título: “The biological in vitro effect and selectivity of aromatic dicationic
compounds on Trypanosoma cruzi”
Estado do conhecimento quando da concepção do trabalho:
 Amidinas aromáticas são compostos aromáticos dicatiônicos que apresentam
um amplo espectro de ação microbicida, sendo utilizadas na clínica para
tratamento de patologias como a doença do sono (ex. pentamidina).
 Estudos anteriores têm também revelado a promissora atividade de
diamidinas, como a DB1362, sobre infecção in vitro e in vivo pelo T.cruzi
 Questões propostas:
1. Avaliar a atividade antiparasitária, toxicidade e a seletividade in vitro de 10
compostos dicatiônicos aromáticos sobre tripomastigotas de sangue e forma
intracelular do Trypanosoma cruzi.
2. Correlacionar a atividade tripanocida com a localização e distribuição
intracelular dos compostos no T.cruzi
Seguem 07 páginas
29
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 105(3): 239-245, May 2010
239
The biological in vitro effect and selectivity of aromatic dicationic
compounds on Trypanosoma cruzi
Cristiane França da Silva1, Patrícia Bernadino da Silva1, Marcos Meuser Batista1,
Anissa Daliry1, Richard R Tidwell2, Maria de Nazaré Correia Soeiro1/+
1
Laboratório de Biologia Celular, Instituto Oswaldo Cruz-Fiocruz, Av. Brasil 4365, 21045-900 Rio de Janeiro, RJ, Brasil
Department of Pathology and Laboratory Medicine, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA
2
Trypanosoma cruzi is a parasite that causes Chagas disease, which affects millions of individuals in endemic
areas of Latin America. One hundred years after the discovery of Chagas disease, it is still considered a neglected
illness because the available drugs are unsatisfactory. Aromatic compounds represent an important class of DNA
minor groove-binding ligands that exhibit potent antimicrobial activity. This study focused on the in vitro activity
of 10 aromatic dicationic compounds against bloodstream trypomastigotes and intracellular forms of T. cruzi. Our
data demonstrated that these compounds display trypanocidal effects against both forms of the parasite and that
seven out of the 10 compounds presented higher anti-parasitic activity against intracellular parasites compared
with the bloodstream forms. Additional assays to determine the potential toxicity to mammalian cells showed that
the majority of the dicationic compounds did not considerably decrease cellular viability. Fluorescent microscopy
analysis demonstrated that although all compounds were localised to a greater extent within the kinetoplast than
the nucleus, no correlation could be found between compound activity and kDNA accumulation. The present results
stimulate further investigations of this class of compounds for the rational design of new chemotherapeutic agents
for Chagas disease.
Key words: aromatic compounds - Trypanosoma cruzi - chemotherapy - Chagas disease
Chagas disease is a neglected tropical illness caused
by the protozoan Trypanosoma cruzi. Although Carlos
Chagas described it 100 years ago (1909), it is still an
important public health problem in Latin America (Rocha et al. 2007). The main clinical symptoms of Chagas
disease are cardiac and/or digestive alterations and the
overall prevalence of the disease is about 12-14 million
cases, which makes it the major cause of cardiac infectious disease in endemic areas (Stewart et al. 2005, Dias
2007). In addition, despite fruitful attempts to control
vectorial and blood transmission, Chagas disease still
lacks prophylactic therapies and effective chemotherapeutic schemes (Rodrigues Coura & De Castro 2002,
Dias 2007). Nifurtimox and benznidazole are used for
the treatment of Chagas disease (Urbina 2002); although
they are effective for the treatment of acute infections,
they present moderate activity, exhibit undesirable side
effects and require long dosing schedules for chronic
infections, which frequently necessitate the cessation of
treatment (Jannin & Villa 2007, Soeiro et al. 2009). In
addition, the pharmaceutical industries have given little
attention to the design and development of new antiparasitic compounds aromatic dicationic compounds
represent a class of DNA minor-groove binding ligands
Financial support: FAPERJ, Pensa Rio/FAPERJ, CNPq, PAPES V/
Fiocruz, CPPD
+ Corresponding author: [email protected]
Received 6 August 2009
Accepted 13 April 2010
that exhibit high activity against a variety of pathogens,
such as bacteria, fungi and protozoa (Werbovetz 2006,
Wilson et al. 2008). Recent data showed that diamidines
and related compounds, such as the reversed amidines,
present considerable efficacy against T. cruzi both in
vitro (De Souza et al. 2004, Silva et al. 2007a) and in
vivo (De Souza et al. 2006a, da Silva et al. 2008) and
induce striking alterations on the parasite mitochondrion-kinetoplast complex (De Souza et al. 2006b, Silva et
al. 2007b). In this context, the present study investigated
the activity of 10 newly synthesised aromatic dicationic
compounds on trypomastigotes and intracellular amastigotes, the clinically relevant forms of T. cruzi and the
toxicity of these compounds in cardiac cells. Due to the
intrinsic fluorescent characteristics of these compounds,
we also studied their sub cellular distributions to evaluate their preferred targets in T. cruzi.
Materials and Methods
Compounds - The dicationic aromatic compounds
1MAA119 (Compound 1), 25DAP013 (Compound 2),
14SMB013 (Compound 3), 10SAB092 (Compound 4),
10SAB031 (Compound 5), 11SAB081 (Compound 6),
12SMB032 (Compound 7), 150OXD049 (Compound 8),
18SMB092 (Compound 9) and 18SMB096 (Compound 10)
(Fig. 1) were synthesised in the laboratory of R.R.T. and
the previously reported protocol (Daliry et al. 2009) was
used to assess the effectiveness of aromatic compounds
with different shapes, cationic centres and effective motifs. Stock solutions of the drugs (5 mM) were freshly
prepared in dimethyl sulfoxide and the final solvent concentration in the assays never exceeded 0.6%, which is not
toxic for either parasites or mammalian cells.
online | memorias.ioc.fiocruz.br
240
Aromatic compounds effective against T. cruzi • Cristiane França da Silva et al.
Fig. 1: chemical structure of the compounds.
Cell cultures - Primary cultures of embryonic cardiomyocytes (CM) were obtained from Swiss mice
as previously described (Meirelles et al. 1986). After
purification, the CM were seeded at a density of 5 ×
104 cells/well in 96-well microplates containing gelatincoated cover slips and sustained in Dulbecco’s modified medium (DMEM) supplemented with 10% horse
serum, 5% foetal bovine serum (FCS), 2.5 mM CaCl2,
1 mM L-glutamine and 2% chicken embryo extract as
described previously (Meirelles et al. 1986). The cultures were maintained at 37°C in an atmosphere of 5%
CO2 and air and the assays were performed at least three
times with duplicate samples. All procedures were carried out in accordance with the guidelines established by
the Fiocruz Committee of Ethical for the Use of Animals
(CEUA 0099/01).
Parasites - Bloodstream trypomastigotes from the
Y strain of T. cruzi were harvested by heart puncture
from infected Swiss mice at the parasitaemia peak
(Meirelles et al. 1982).
Trypanocidal assays - For the analysis of the effect
of the compounds on the bloodstream trypomastigotes,
5 x 106 parasites/mL were incubated for 24 h at 37°C in
RPMI 1640 medium supplemented with 10% FCS, in the
presence or absence of serial dilutions of the compounds
(0.1-32 µM). Alternatively, the treatment was performed
using trypomastigotes cultured in freshly isolated mouse
blood at 4°C for 24 h with the drugs at concentrations
up to 32 μM. The parasite death rates were determined
through direct analysis by light microscopy using a Neubauer chamber and the IC50 values (the compound concentration that reduces the number of parasites by 50%)
were calculated (Silva et al. 2007b).
Infection assays and effect on intracellular parasites For the analysis of the effects of the drugs on intracellular
parasites, after 24 h of parasite-host cell interaction (ratio
of 10:1), the infected cultures were washed to remove free
parasites and then maintained at 37°C in an atmosphere
of 5% CO2 and air in the presence of the compounds (0.1
to 32 µM). The medium plus drug was replaced every 24
h. After 72 h of treatment, which corresponded to 96 h of
infection, the supernatant was recovered, the number of
released parasites was determined by direct quantification using light microscopy and a Neubauer chamber and
the IC50 values were calculated.
Cytotoxicity assays - To measure the toxic effects
on the host cell, uninfected CM were incubated with
the compounds (up to 96 μM in DMEM) for 24 h and
72 h at 37ºC and then the cell morphology and viability
were evaluated by light microscopy and the method of
transcriptional and translational�����������������������
(MTT) colorimetric assay, respectively (Mosmann 1983). The absorbance was
measured at 490 nm in a spectrophotometer (VERSAmax tunable, Molecular devices, USA) and was directly
proportional to the cell viability, from which the LC50
values (the compound concentration that reduces cellular viability by 50%) were calculated.
Fluorescence microscopic analysis and fluorescent
intensity determination - The bloodstream forms were
treated for 30 min at 37ºC with 10 µg/mL of each compound, fixed with 4% paraformaldehyde and mounted
with 2.5% 1.4-diazabicyclo-(2.2.2)octane (DABCO)
on a slide covered with poly-L-lysine (Sigma Aldrich
Corp). The fluorescence was analysed using a Zeiss
photomicroscope equipped with epifluorescence (Zeiss
Inc, Thornwood, NY). The fluorescence intensity of the
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 105(3), May 2010
241
Fig. 2: effect of (A) Compound 1, (B) Compound 2, (C) Compound 3, (D) Compound 4, (E) Compound 5, (F) Compound 6, (G) Compound
7, (H) Compound 8, (I) Compound 9 and (J) Compound 10 on bloodstream trypomastigotes of Trypanosoma cruzi (Y strain) in vitro. The
activity was evaluated during the treatment at 37ºC with the drugs diluted in culture medium. The percentage of dead parasites was measured
after 24 h of treatment.
treated parasites was determined using the program Image J 1.41 (NHI, Bethesda, Maryland) as the sum of the
fluorescent pixel values in the selected regions (nucleus
DNA - nDNA; kinetoplast DNA - kDNA). The results
were expressed as the means and standard deviations of
the kDNA/nDNA ratios, which reflect the partition of
the kDNA and nDNA fluorescence measurements of at
least 50 individual parasites.
Results
We first evaluated the direct effect of the aromatic dicationic compounds on trypomastigotes, which represent
the main infective stage of T. cruzi (Fig. 2). The most active compounds, Compounds 1, 2 and 3, displayed dosedependent effects, with IC50 values of 2.3, 6.1 and 9.3 µM,
respectively (Table I) and about 70, 85 and 97% parasite
death at a dose of 32 µM (Fig. 2A-C). The other seven
Fig. 3: effect of aromatic dicationic compounds in vitro upon primary
cultures of cardiac cells assessed by method of transcriptional and
translational (MTT) colorimetric assay. Cardiomyocytes were treated
with 10.6, 32 and 96 µM of each compound for 72 h. Data are expressed as mean ± SD of the percentage of survival in drug-treated
cells compared to untreated controls.
242
Aromatic compounds effective against T. cruzi • Cristiane França da Silva et al.
Table I
IC50 and selectivity index (SI) values for the effect of aromatic compounds on Ttypanosoma cruzi
Trypomastigotesa
24 h
Intracellular parasitesb
72 h
IC50 (µM)
4°C
IC50 (µM)
37°C
SI
IC50 (µM)
SI
Compound 1
Compound 2
> 32.0
> 32.0
2.3
6.1
> 40.0
> 15.0
10.6
> 32.0
2.3
2.7
Compound 3
> 32.0
9.3
> 10.0
0.6
> 160.0
Compound 4
> 32.0
> 32.0
3.0
0.1
> 960.0
Compound 5
> 32.0
> 32.0
3.0
0.3
> 331.0
Compound 6
> 32.0
> 32.0
3.0
2.3
> 43.0
Compound 7
> 32.0
> 32.0
3.0
0.8
> 126.0
Compound 8
> 32.0
> 32.0
3.0
20.0
> 4.7
Compound 9
Compound 10
> 32.0
> 32.0
> 32.0
> 32.0
3.0
3.0
20.0
> 32.0
> 4.9
3.0
SI corresponds to the ratio LC50/IC50. a: direct effect of the compounds on trypomastiotes performed after 24 h of incubation at
4°C in whole blood or at 37ºC, in RPMI medium; b: effect on intracellular parasites measured by trypomastigotes release into the
supernatant culture medium (96 h of infection) performed after 72 h of treatment at 37ºC.
compounds displayed only modest activities, with IC50
values higher that 32 µM (Fig. 2D-J, Table I). However,
when the bloodstream forms were exposed to Compounds
1, 2 and 3 in the presence of freshly isolated mouse blood,
which tested the possible application of these compounds
for the prophylaxis of banked blood, we observed a substantial decrease in the trypanocidal activities, with IC50
values higher than 32 µM (Table I).
Next, to evaluate the toxicity on mammalian host
cells, uninfected cardiac cultures were incubated for 24
and 72 h with different doses of the compounds and then
cellular viability was evaluated by both light microscopy
and the MTT colorimetric assay. The compounds did not
induce loss of cellular viability after incubation for 24 h
with doses up to 96 µM (data not shown); however, most
of the aromatic dicationic compounds displayed low toxicity after 72 h of incubation and Compounds 1 and 2
exhibited moderate toxicity, with LC50 values of 25 and
85 µM, respectively (Fig. 3).
Next, the anti-parasitic activity of the compounds
against the intracellular forms of T. cruzi was assessed
through the direct quantification of the number of parasites released in the supernatant of infected CM after 96
h of parasite interaction. Incubation for 72 h with Compounds 7, 4, 3, 6 and 5 resulted in dose-dependent effects that lead to considerable reductions in the number
of parasites released into the supernatant, with micromolar and sub-micromolar IC50 values (Fig. 4C-G, Table
I). On the other hand, Compounds 1, 8 and 9 exerted
moderated activity while Compounds 2 and 10 were not
active and had IC50 values higher that 32 µM (Fig. 4A-B,
H-J, Table I). With the exceptions of Compounds 1 and
2, the other compounds displayed equal or better activity
on intracellular parasites compared to the bloodstream
parasites (Table I).
Based on the IC50 and LC50 values, the selectivity
index (SI) of each compound was determined. This parameter reflects the quantity of compound that is active
against the pathogen but is not toxic towards the host cell.
For the bloodstream trypomastigotes, only one dicationic
compound (Compound 1) showed a high SI value (> 40),
but for the intracellular parasites, five out of 10 compounds displayed considerable selectivity: Compounds
7, 4, 3, 6 and 5 with SI ranging between > 43 and > 960.
These five aromatic compounds also displayed higher
anti-proliferative effects on the intracellular parasites.
Within the treated bloodstream parasites, all of the
fluorescent compounds were localised in DNA-enriched
structures, i.e., the kinetoplast and nucleus (Fig. 5).
However, although there was consistently higher labelling within the kDNA compared to the nuclei (Fig. 5),
the kDNA/nDNA ratios showed that the higher accumulation in the kDNA (ratios ≥1.28) did not correlate with
compound efficacy: Compound 7, one of the less active
compounds, showed the highest accumulation in the kinetoplast, with a 1.77 kDNA/nDNA ratio (Table II).
Discussion
Diamidines and related dications are considered to
be potential anti-parasitic agents due to their known activities against several pathogens (Soeiro et al. 2005).
However, as they possess critical limitations regarding
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 105(3), May 2010
243
Fig. 4: activity of (A) Compound 1, (B) Compound 2, (C) Compound 3, (D) Compound 4, (E) Compound 5, (F) Compound 6, (G) Compound
7, (H) Compound 8, (I) Compound 9 and (J) Compound 10 upon intracellular parasites lodge in Trypanosoma cruzi-infected cardiac cells. The
activity of compounds after 72 h of drug incubation is shown by the percentage of reduction in the number of released parasites into the supernatant of the infected cultures.
their poor oral bioavailability and considerable toxicity,
new dicationic analogs have been synthesised to address
this situation.
Our assays evaluated the effect of 10 aromatic dicationic compounds on trypomastigotes under different
experimental conditions to explore their potential uses
as chemotherapeutics (assays conducted at 37°C) and/
or prophylactic compounds for banked blood (assays using whole blood at 4°C). Our data showed that although
three compounds, Compounds 1, 2 and 3, induced high
levels of parasite lysis and dose-dependent effects with
low micromolar IC50 values when assayed at 37°C, all of
them showed decreased activity in the presence of blood,
possibly due to their association with and/or inactivation
by serum components as reported previously (SantaRita et al. 2004, 2006, Silva et al. 2007a). Therefore, the
decreased activity at 4°C in the presence of blood constituents demonstrated that the studied compounds are
ineffective for the sterilisation of ex vivo blood batches
to control Chagas disease.
In agreement with our previous studies showing that
reversed amidines, also named arylimidamides, exhibited low toxicity to mammalian cells in vitro (Silva et al.
2007a), our present data showed that, except for Compounds 1 and 2, only high drug concentrations (> 96
µM) induced alterations in host cell viability.
We also found that five out of 10 Compounds (Compounds 7, 4, 3, 6 and 5) exerted considerable activity
against the intracellular forms of T. cruzi at low micromolar and sub-micromolar doses and with high SI values (ranging between > 43 and > 960). This difference
in activity on the intracellular forms compared to the
244
Aromatic compounds effective against T. cruzi • Cristiane França da Silva et al.
Table II
Mean and standard deviation values of fluorescence intensity
ratios among kinetoplast and nuclei of bloodstream trypomastigotes treated for 30 min with 10 µg/mL of each compound
Kinetoplast/nucleus
Compound 1
Compound 2
Compound 3
Compound 4
Compound 5
Compound 6
Compound 7
Compound 8
Compound 9
Compound 10
1.60 ± 0.44
1.61 ± 0.36
1.58 ± 0.38
1.50 ± 0.32
1.61 ± 0.30
1.48 ± 0.31
1.77 ± 0.38
1.28 ± 0.33
1.53 ± 0.30
1.39 ± 0.35
bloodstream forms requires further analysis but could
represent differences in drug uptake by these different
parasite stages and/or different mechanisms of action
upon non-dividing trypomastigotes and the highly multiplicative intracellular stages of the parasite.
Aromatic dicationic compounds, such as pentamidine, bind non-covalently and in a non-intercalative
manner to the minor-groove of the DNA; however, their
mechanism of action has not been fully elucidated and it
has been proposed that they may possess multiple modes
of action (Wilson et al. 2005). One of the long-hypothesised mechanisms of action of diamidines is related
to their ability to bind to AT-rich regions of the DNA
minor groove, but other mechanisms have also been
proposed, such as inhibition of tyrosyl-DNA phosphodiesterase, topoisomerases, protein kinase A, proteases
and polymerases (Tidwell & Boykin 2003, Soeiro et al.
2008, Soeiro & De Castro 2009).
According to our present results, we could not find
any correlation between the localisation and higher accumulation of these dicationic fluorescent compounds
within the T. cruzi kDNA and their trypanocidal activity, which we also found in another recent study of other
dicationic compounds (Daliry et al. 2009). In fact, previous reports on African trypanosomes also could not correlate either intracellular accumulation or sub cellular
localisation and distribution of aza analogs and diphenyl
furans with their in vitro activities (Mathis et al. 2007).
Our present paper describes the potential effect of
the aromatic dicationic compounds on T. cruzi, which
supports further screening of new analogs that could be
used alone or in combination with other drugs for the
treatment of Chagas disease.
References
Daliry A, Silva PB, Silva CF, Meuser MB, de Castro SL, Tidwell
RR, Soeiro MNC 2009. In vitro analyses of the effect of aromatic diamidines upon Trypanosoma cruzi. �����������������
J Antimicrob Chemother 64: 747-750.
Fig. 5: fluorescent (A-E, K-O) and differential interference contrast
(F-J, P-T) analysis showing intracellular localization of the aromatic
dicationic compounds within bloodstream trypomastigotes of Trypanosoma cruzi after incubation for 30 min at the concentration of 10
μg/mL: Compound 1 (A, F), Compound 2 (B, G), Compound 3 (C, H),
Compound 4 (D, I), Compound 5 (E, J), Compound 6 (K, P), Compound 7 (L, Q), Compound 8 (M, R), Compound 9 (N, S) and Compound 10 (O, T). Note that compound accumulation was higher in the
kinetoplast (white arrow) than in the nucleus (asterisk). Bar = 2 µm.
da Silva CF, Batista MM, Batista D da G, de Souza EM, da Silva PB,
de Oliveira GM, Meuser AS, Shareef AR, Boykin DW, Soeiro M
de N 2008. Trypanocidal activity of a diarylthiophene diamidine
against Trypanosoma cruzi: in vitro and in vivo studies. Antimicrob Agents Chemother 52: 3307-3314.
De Souza EM, Lansiaux A, Bailly C, Wilson WD, Hu Q, Boykin DW,
Batista MM, Araújo-Jorge TC, Soeiro MN 2004. Phenyl substitution of furamidine markedly potentiates its antiparasitic activity
against Trypanosoma cruzi and Leishmania amazonensis. Biochem Pharmacol 68: 593-600.
De Souza EM, Menna-Barreto R, Araújo-Jorge TC, Kumar A, Hu Q,
Boykin DW, Soeiro, MNC 2006a. ������������������������������
Antiparasitic activity of aromatic diamidines is related to apoptosis-like death in Trypanosoma cruzi. Parasitology 133: 75-79.
De Souza EM, Oliveira GM, Boykin DW, Kumar A, Hu Q, Soeiro
MNC 2006b. Trypanocidal activity of the phenyl-substituted
analogue of furamidine DB569 against Trypanosoma cruzi infection in vivo. J Antimicrob Chemother 58: 610-614.
Dias JC 2007. Southern Cone Initiative for the elimination of domestic populations of Triatoma infestans and the interruption of
transfusion Chagas disease: historical aspects, present situation
and perspectives. Mem Inst Oswaldo Cruz 102: 11-18.
Jannin J, Villa L 2007. An overview of Chagas disease treatment.
Mem Inst Oswaldo Cruz 102: 95-97.
Mathis AM, Bridges AS, Ismail MA, Kumar A, Francesconi I, Anbazhagan M, Hu Q, Tanious FA, Wenzler T, Saulter J, Wilson
WD, Brun R, Boykin DW, Tidwell RR, Hall JE 2007. Diphenyl
furans and aza analogs: effects of structural modification on in
vitro activity, DNA binding and accumulation and distribution in
trypanosomes. Antimicrob Agents Chemother 51: 2801-2810.
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 105(3), May 2010
Meirelles MN, de Araújo Jorge TC, de Souza W 1982. Interaction
of Trypanosoma cruzi with macrophages in vitro: dissociation
of the attachment and internalization phases by low temperature
and cytochalasin B. Z Parasitenkd 68: 7-14.
Meirelles MN, de Araujo-Jorge TC, Miranda CF, de Souza W, Barbosa
HS 1986. Interaction of Trypanosoma cruzi with heart muscle
cells: ultrastructural and cytochemical analysis of endocytic vacuole formation and effect upon myogenesis in vitro. Eur J Cell
Biol 41: 198-206.
Mosmann T 1983. Rapid colorimetric assay for cellular growth and
survival: application to proliferation and cytotoxicity assays.
J Immunol Methods 65: 55-63.
Rocha MO, Teixeira MM, Ribeiro AL 2007. An
���������������������
update on the management of Chagas cardiomyopathy. Expert Rev Anti Infect Ther
5: 727-743.
Rodriques Coura RJ, de Castro SL 2002. A critical review on Chagas
disease chemotherapy. Mem Inst Oswaldo Cruz 97: 3-24.
Santa-Rita RM, Barbosa HS, de Castro SL 2006. Ultrastructural
analysis of edelfosine-treated trypomastigotes and amastigotes
of Trypanosoma cruzi. Parasitol Res 100: 187-190.
Santa-Rita RM, Santos Barbosa H, Meirelles MN, de Castro SL 2004.
Effect of the alkyl-lysophospholipids on the proliferation and differentiation of Trypanosoma cruzi. Acta Trop 75: 219-228.
Silva CF, Batista MM, Mota RA, de Souza EM, Stephens CE, Som P,
Boykin DW, Soeiro MdeN 2007a. Activity
�����������������������������
of “reversed” diamidines against Trypanosoma cruzi in vitro. Biochem Pharmacol
73: 1939-1946.
Silva CF, Meuser MB, De Souza EM, Meirelles MN, Stephens CE,
Som P, Boykin DW, Soeiro MN 2007b. Cellular effects of reversed
amidines on Trypanosoma cruzi. Antimicrob Agents Chemother
51: 3803-3809. Soeiro MNC, De Castro SL, De Souza EM, Batista
245
DGJ, Silva CF, Boykin DW 2008. Diamidine
�������������������������������
activity against trypanosomes: the state of the art. Curr Mol Pharmacol 1: 151-161.
Soeiro MN, Dantas AP, Daliry A, Silva CF, Batista DG, de Souza
EM, Oliveira GM, Salomão K, Batista MM, Pacheco MG, Silva
PB, Santa-Rita RM, Barreto RF, Boykin DW, Castro SL 2009.
Experimental chemotherapy for Chagas disease: 15 years of research contributions from in vivo and in vitro studies. Mem Inst
Oswaldo Cruz 104: 301-310.
Soeiro MN, De Castro SL 2009. Trypanosoma cruzi targets for new chemotherapeutic approaches. Expert Opin Ther Targets 13: 105-121.
Soeiro MN, De Souza EM, Stephens CE, Boykin DW 2005. Aromatic
diamidines as antiparasitic agents. Expert Opin Investig Drugs
14: 957-972.
Stewart M, Krishna S, Burchmore RS, Brun R, de Koning HP, Boykin
DW, Tidwell RR, Hall JE, Barrett MP 2005. ��������������������
Detection of arsenical drug resistance in Trypanosoma brucei with a simple fluorescence test. Lancet 366: 486-487.
Tidwell RR, Boykin DW 2003. Minor groove binders as antimicrobial
agents. In M Demeunynck, C Bailly, WD Wilson (eds.), Small
molecule DNA and RNA binder: synthesis to nucleic acid complexes, Wiley-VCH, New York, p. 416-460.
Urbina JA 2002. Chemotherapy of Chagas disease. Curr Pharm Des
8: 287-295.
Werbovetz K 2006. Diamidines as antitrypanosomal, antileishmanial
and antimalarial agents. Curr Opin Investig Drugs 7: 147-157.
Wilson WD, Nguyen B, Tanious FA, Mathis A, Hall JE, Stephens CE,
Boykin DW 2005. Dications that target the DNA minor groove:
compound design and preparation, DNA interactions, cellular
distribution and biological activity. Curr Med Chem Anticancer
Agents 5: 389-408.
Wilson WD, Tanious FA, Mathis A, Tevis D, Hall JE, Boykin DW 2008.
Antiparasitic compounds that target DNA. Biochimie 90: 999-1014.
Resultados
Artigo # 03: Publicado no Journal of Antimicrobial Chemotherapy, em 2011
Título: “In vitro trypanocidal activity of DB745 and other novel arylimidamides
against Trypanosoma cruzi”
Estado do conhecimento quando da concepção do trabalho:
 Arilimidamidas são amidinas aromáticas com excelente atividade sobre
tripanosomatídeos como Leishmania spp e T.cruzi
 Além da urgente necessidade de se identificar novos fármacos para
tratamento da doença de Chagas, se faz ainda relevante buscar por novas
alternativas para profilaxia de bancos de sangue, sobretudo em áreas
endêmicas e de alta prevalência como algumas regiões da Bolívia.
 Questões propostas:
1. Avaliar a atividade antiparasitária, toxicidade e a seletividade in vitro de 05
arilimidamidas
(DB745B,
DB667,
DB709,
DB945
e
DB709)
sobre
tripomastigotas de sangue e forma intracelular do T. cruzi, avaliando o efeito
sobre diferentes cepas do parasito que apresentam distintos perfis de
susceptibilidade ao Bz (Y, YuYu, CL Brener e Colombiana), e de distintas
regiões geográficas e ciclos de transmissão (peridomicilio e silvestre –
isolados 855, 875, MS153 e RB vii), comparando com atividade da droga de
referência, o benznidazol,
2. Investigar a possível atividade profilática dos compostos para uso em bancos
de sangue, correlacionando atividade tripanocida com a composição química
dos compostos.
Seguem 3 páginas
37
J Antimicrob Chemother 2011; 66: 1295 – 1297
doi:10.1093/jac/dkr140 Advance Access publication 8 April 2011
In vitro trypanocidal activity of DB745B and other novel
arylimidamides against Trypanosoma cruzi
Cristiane França Da Silva 1, Angela Junqueira 2, Marli Maria Lima 3, Alvaro José Romanha 4,
Policarpo Ademar Sales Junior 4, Chad E. Stephens 5, Phanneth Som 6, David W. Boykin 6
and Maria de Nazaré Correia Soeiro 1*
1
Laboratório de Biologia Celular do Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brazil; 2Laboratório de Doenças
Parasitárias do Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brazil; 3Laboratório de Eco-epidemiologia da doença
de Chagas do Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brazil; 4Laboratório de Parasitologia Celular e
Molecular, Centro de Pesquisas René Rachou, Fiocruz-MG, MG, Brazil; 5Department of Chemistry and Physics, Augusta State University,
Augusta, GA, USA; 6Department of Chemistry, Georgia State University, Atlanta, GA, USA
*Corresponding author. Tel: +55-21-25621368; Fax: +55-21-25621432; E-mail: [email protected]
Downloaded from jac.oxfordjournals.org at Funda??o Oswaldo Cruz on June 27, 2011
Received 15 December 2010; returned 25 January 2011; revised 4 March 2011; accepted 6 March 2011
Objectives: As part of a search for new therapeutic opportunities to treat chagasic patients, in vitro efficacy studies
were performed to characterize the activity of five novel arylimidamides (AIAs) against Trypanosoma cruzi.
Methods: The trypanocidal effect against T. cruzi was evaluated by light microscopy through the determination of
IC50 values. Cytotoxicity was determined by MTT assays against mouse cardiomyocytes.
Results: Our data demonstrated the trypanocidal efficacy of these new compounds against bloodstream trypomastigotes and intracellular amastigotes, exhibiting IC50 values ranging from 0.015 to 2.5 and 0.02 to 0.2 mM,
respectively. One of the compounds, DB745B, was also highly active against a broad panel of isolates, including
those naturally resistant to benznidazole. DB745B showed higher in vitro efficacy than the reference drugs
used to treat patients (benznidazole IC50¼12.94 mM) and to prevent blood bank infection (gentian violet
IC50¼ 30.6 mM).
Conclusions: AIAs represent promising new chemical entities against T. cruzi and are also potential trypanocidal
agents to prevent transfusion-associated Chagas’ disease.
Keywords: Chagas’ disease, chemotherapy, T. cruzi
Introduction
Chagas’ disease (CD) is a neglected disease of poor, rural and forgotten populations, representing one of the main public health
problems in 22 developing countries of Latin America.1 Nifurtimox and benznidazole are recommended for all acute, early
chronic and reactivated cases, but produce variable results
mostly related to the endemic area. Both exhibit considerable
undesirable side effects, are administered over 30 or more
days and are not very effective against the late chronic
phase.2,3 Another challenge is blood prophylaxis in endemic
areas, since the only trypanosomicidal agent (gentian violet)
has toxicity problems, gives the blood a purple colour and may
stain the skin and mucosa of recipients.4
In vitro and in vivo studies have shown the promising efficacy
of diamidines and congeners, mainly arylimidamides (AIAs),
against Trypanosoma cruzi.2,5,6 Because recent findings also
reported the pharmacological properties and biological efficacy
of AIAs, such as DB745, against Leishmania in models of
in vitro and in vivo infection,7 in this study the trypanocidal
activity of five novel AIAs was evaluated in vitro against different
strains of T. cruzi.
Methods
Drugs
All amidines (see Figure S1; available as Supplementary data at JAC
Online) were synthesized according to published procedures.8 Benznidazole (LAFEPE, Brazil) and gentian violet (Sigma-Aldrich) were used as previously reported.5
Cardiac cell cultures and cytotoxicity assays
To rule out toxic effects against mammalian cells, uninfected primary cultures of embryonic cardiomyocytes (CMs) were incubated at 378C for 24
and 72 h and LC50 values were determined by MTT colorimetric assays.5
# The Author 2011. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: [email protected]
1295
Da Silva et al.
Table 1. Trypanocidal effect of arylimidamides and benznidazole against T. cruzi (Y strain)a
BTs
Intracellular parasites
Compounds
IC50 (mM) 48C
IC50 (mM)
SI
LC50 (mM)
IC50 (mM)
LC50 (mM)
SI
DB667
DB709
DB745B
DB749
DB946
Benznidazole
.32
.32
0.66+0.253
.32
32
.250
0.078+0.008
0.09+0.03
0.015+0.002
2.5+0.73
0.05+0.002
12.94+1.93
410
352
2133
13
640
77
32
32
32
32
32
1000
0.20+0.01
0.02+0.01
0.03+0.004
0.02+0.004
0.03+0.006
2.77+1.96
10.6
10.6
10.6
8.58
8.58
1000
53
530
353
441
286
360
IC50, drug concentration that reduces the number of parasites by 50%; LC50, drug concentration that reduces cell viability by 50%; SI, corresponds to
the ratio LC50/IC50 (for BTs and intracellular parasites calculated on LC50 values at 24 and 72 h of incubation at 378C, respectively). The IC50 and LC50
values were averaged for at least three determinations done in duplicate.
a
The activity of the compounds against bloodstream trypomastigotes (BTs) and intracellular parasites was evaluated during their incubation at 48C (as
indicated) or otherwise at 378C for 24 h and 72 h.
Different strains of T. cruzi were used (see Table S1; available as Supplementary data at JAC Online). Bloodstream trypomastigotes (BTs)
were obtained from Swiss mice infected with T. cruzi.6 Intracellular amastigotes lodged within CMs were employed as reported previously.6
Antitrypanosomal activity
BTs were incubated with compounds (0– 32 mM) for 24 h at 378C or were
treated for 5 –60 min with 0.1–10 mg/mL DB766, DB745B, DB709 and the
diamidine DB569.6 To identify a possible candidate for blood bank prophylaxis, BTs were maintained at 48C for 24 h in freshly isolated mouse
blood (96% and 50%) in the presence or absence of serial dilutions of
the compound (up to 32 mM).5 The parasite death rates were determined
through direct analysis by light microscopy, allowing the calculation of
IC50 values.5 For the analysis on intracellular parasites, after 24 h of infection using BTs (ratio 10:1), infected CMs were incubated for 72 h with the
compounds (0 –10.6 mM) and the number of released parasites quantified for determination of IC50 values.2
All procedures were carried out in accordance with the guidelines
approved by Fiocruz CEUA 0099/01. Statistical analysis was carried out
using analysis of variance (ANOVA), with the level of significance set at
P≤ 0.05.
Results
DB667, DB709, DB745B, DB749 and DB946 gave a dosedependent trypanocidal effect against BTs (Y strain) (see
Figure S2; available as Supplementary data at JAC Online).
DB709, DB749 and DB946 presented IC50 values of 0.09+0.03,
2.5+0.73 and 0.05+0.002 mM, respectively. DB745B was the
most effective, showing an IC50 value of 0.015+0.002 mM
(Table 1).
To compare the efficacy of DB745B with other AIAs previously
studied (DB766)5 and with a well-known trypanocidal diamidine
(DB569),6 BTs were incubated for 15 min with different concentrations of each compound (0.1 –10 mg/mL). The lower concentrations revealed large differences between the activities of
DB745B and DB766; 78% and 27% parasite death, respectively,
with 1 mg/mL (data not shown). To further explore the efficacies
of these compounds, a time –kill study was conducted using the
1296
higher concentration (10 mg/mL). After 5 min a statistically
significant difference was found between DB745B and DB766
(P ¼ 0.009); DB745B induced 51% parasite lysis, whereas DB569
and DB766 induced only 16% and 27% parasite lysis, respectively (Figure S2a). After 60 min both AIAs induced more than
96% parasite lysis, whereas DB569 produced about 50%
(Figure S2b).
When assayed at 48C using 96% mouse blood, DB745B presented the highest activity, exhibiting IC50 ¼0.66+0.25 mM.
DB667, DB709 and DB749 gave IC50 values .32 mM, while
DB946 showed modest activity (IC50 ¼ 22 mM) (Figure S2c).
DB745B was also assayed against other strains with different
patterns of natural resistance to benznidazole and nifurtimox
(Table S1).5 For comparative purposes we also included the diamidine DB75, which displays only modest activity against T. cruzi.6
Although no effect was found for both DB75 and DB749
(IC50 ≥31 mM), DB745B showed significant activity, regardless of
the drug resistance parasite phenotype, giving IC50 values
ranging from 0.3 to 0.7 mM, and greater efficacy than gentian
violet (Table 2). DB745B and DB667 tested against a broader
panel of T. cruzi strains (855, 875, MS1523 and RBVIII) showed
that although both were more active than benznidazole, DB667
was less active than DB745B (data not shown).
The five novel AIAs did not cause significant loss of cardiac
cell viability after treatment for 24 and 72 h, displaying LC50
values ≥32 and 10.6 mM, respectively (data not shown). The
incubation of T. cruzi-infected CMs with non-toxic concentrations
of AIAs (≤3.5 mM) resulted in strong inhibition of parasite burden,
presenting a dose-dependent and greater activity than benznidazole (Figure S2d and Table 1).
Regarding selectivity indexes (SIs), except for DB749, all the
other AIAs displayed high SIs against BTs and intracellular parasites, ranging from 352 to 2133 and 53 to 530, respectively
(Table 1).
Discussion
A systematic lead discovery programme performed by the Consortium for Parasitic Drug Development (http://www.thecpdd.
org/) demonstrated that novel AIAs such as DB745B and
Downloaded from jac.oxfordjournals.org at Funda??o Oswaldo Cruz on June 27, 2011
Parasites
JAC
Arylimidamides against T. cruzi
Table 2. In vitro activity of DB75, DB745B, DB749 and gentian violet
against BTs from different T. cruzi strainsa
IC50 values (mM)
Compound
DB75
DB745B
DB749
Gentian violet
YuYu
Colombiana
Y
CL
.32
0.701
.32
30.6
.32
0.468
.32
30.6
.32
0.308
.32
30.6
.32
0.387
31
30.6
a
The activity of the compounds against BTs was evaluated for 24 h during
their incubation at 48C with 50% mouse blood.5
Funding
This study was supported by grants from Fundação Carlos Chagas Filho
de Amparo a Pesquisa do Estado do Rio de Janeiro (FAPERJ/APQ1
(2011), Apoio ao Desenvolvimento Cientı́fico e Tecnológico Regional do
Rio de Janeiro (2011), Pronex-Faperj (17/2009), Pensa-Rio (16/
2009-E-26/110-313/2010), Conselho Nacional de Desenvolvimento Cientı́fico e Tecnológico (CNPq), Rede de Plataformas PDTIS/VPPLR/Fiocruz,
PAPES V/FIOCRUZ, Coordenação de Aperfeiçoamento Pessoal do Ensino
Superior (CAPES) and Consortium for Parasitic Drug Development (CPPD).
Transparency declarations
None to declare.
Supplementary data
Figures S1 and S2 and Table S1 are available as Supplementary data at
JAC Online (http://jac.oxfordjournals.org/).
References
1 Clayton J. Chagas disease: pushing through the pipeline. Nature 2010;
465: S12–5.
2 Soeiro MN, de Castro SL. Trypanosoma cruzi targets for new
chemotherapeutic approaches. Expert Opin Ther Targets 2009; 13:
105–21.
3 Rodriques Coura J, de Castro SL. A critical review on Chagas disease
chemotherapy. Mem Inst Oswaldo Cruz 2002; 97: 3 – 24.
4 Docampo R, Moreno SN, Gadelha FR et al. Prevention of Chagas’
disease resulting from blood transfusion by treatment of blood: toxicity
and mode of action of gentian violet. Biomed Environ Sci 1988; 1:
406–13.
5 Batista D da GJ, Batista MM, de Oliveira GM et al. Arylimidamide DB766,
a potential chemotherapeutic candidate for Chagas’ disease treatment.
Antimicrob Agents Chemother 2010; 54: 2940–52.
6 De Souza EM, Lansiaux A, Bailly C et al. Phenyl substitution of
furamidine markedly potentiates its antiparasitic activity against
Trypanosoma cruzi and Leishmania amazonensis. Biochem Pharmacol
2004; 68: 593–600.
7 Wang MZ, Zhu X, Srivastava A et al. Novel arylimidamides for treatment
of visceral leishmaniasis. Antimicrob Agents Chemother 2010; 54:
2507– 16.
8 Stephens CE, Tanious F, Kim S et al. Diguanidino and “reversed”
diamidino 2,5-diarylfurans as antimicrobial agents. J Med Chem 2001;
44: 1741– 8.
9 Romanha AJ, Castro SL, Soeiro M de N et al. In vitro and in vivo
experimental models for drug screening and development for Chagas
disease. Mem Inst Oswaldo Cruz 2010; 105: 233–8.
10 Brener Z. Therapeutic activity and criterion of cure on mice
experimentally infected with Trypanosoma cruzi. Rev Inst Med Trop São
Paulo 1962; 4: 389–96.
1297
Downloaded from jac.oxfordjournals.org at Funda??o Oswaldo Cruz on June 27, 2011
DB766 are effective against Leishmania infection in vitro and in
vivo, do not exhibit mutagenicity, display low acute toxicity,
have moderate oral bioavailability, are distributed to different
tissues such as the liver and spleen, present large volumes of distribution and have an elimination half-life ranging from 1 to
2 days in mice.7 As DB766 also presented potent anti-T. cruzi
activity,5 we screened for the trypanocidal effect of five novel
AIAs, including DB745B. All AIAs exhibited considerable activity
against T. cruzi, but DB745B was the most active, even in the
presence of blood constituents. The loss of activity exhibited by
DB667, DB709, DB749 and DB946 may be related to their association with and/or inactivation by serum components, as reported
previously.2
The efficacy of DB745B in the presence of blood is a desirable
characteristic shared by a few other AIAs, such as DB766,5 that
was noted during the evaluation of new trypanocidal agents for
use in blood banks. Although the transfusion procedures that
have been implemented have reduced the number of bloodrelated new infections, these procedures are not universally followed. Also, the only trypanocidal agent available for chemical
prophylaxis of blood in areas of high endemicity is gentian
violet, which is a toxic cationic dye that has several limitations.1
As recommended for drug screening against CD,9 a promising
agent should: (i) be active against bloodstream and intracellular
forms; (ii) be active against a large panel of parasite isolates,
including those that express natural resistance to benznidazole
and nifurtimox; (iii) present efficacy equal to or better than the
reference drugs; and (iv) display a high SI (≥50). In this study,
all these requirements were fulfilled, especially by DB745B. All
AIAs were more active than benznidazole (e.g. DB745B is
about 860 and 90 times more effective against BTs and intracellular parasites, respectively). DB745B is effective against a
large panel of strains (855, 875, MS1523 and RBVIII strains are
present in peridomiciliary and sylvatic ecotopes), including
those that express natural resistance to benznidazole,10 and is
more active than the diamidines DB569 and DB75, confirming
previous studies that revealed the superior activity of AIAs compared with diamidines against T. cruzi.2,6 Dose-dependent and
timepoint studies demonstrated that DB745B is faster acting
than DB766, requiring further studies to explore the possibility
that different transport mechanisms and/or cellular targets
may be operating. Our findings warrant additional in vivo
studies with DB745B using acute and chronic experimental
models of T. cruzi infection with the goal of identifying novel
lead AIA candidates against this parasite.
Resultados
Artigo # 04:Submetido, em 2011
Título: “The Efficacy of Arylimidamides Against Trypanosoma cruzi in vitro”
Estado do conhecimento quando da concepção do trabalho:
 Os únicos medicamentos disponíveis para terapia da doença de Chagas
apresentam sérias limitações, mas com exceção de alguns azoles e de
poucos inibidores de cisteína proteinases, poucos compostos apresentaram
eficácia semelhante ou superior ao Bz em ensaios in vitro e in vivo,
 Estudos têm demonstrado a excelente atividade e seletividade de
arilimidamidas sobre o T.cruzi (ex. DB745 e DB766) com eficácia comparada
ao Bz.
 Questões propostas:
1. Avaliar a atividade antiparasitária, toxicidade e a seletividade in vitro de 07
novas arilimidamidas sobre a forma intracelular e tripomastigotas de sangue
do Trypanosoma cruzi.
2.Confirmar o efeito de arilimidamidas sobre o T.cruzi como potenciais agentes
profiláticos para bancos de sangue.
Seguem 22 páginas
41
Parasitology
The Efficacy of Novel Arylimidamides Against Trypanosoma
cruzi in vitro
r
Fo
Journal:
Manuscript ID:
Manuscript Type:
Complete List of Authors:
Draft
Research Article
Pe
Date Submitted by the
Author:
Parasitology
n/a
er
da Silva, Cristiane; Instituto Oswaldo Cruz, Laboratório de Biologia
Celular
Daliry, Anissa; Instituto Oswaldo Cruz, 1Laboratório de Biologia
Celular
da Silva, Patricia; Instituto Oswaldo Cruz, Laboratório de Biologia
Celular
Akay, Senol; Georgia State University, Department of Chemistry
Banerjee, Moloy; Georgia State University, Department of
Chemistry
Farahat, Abdelbasset; Georgia State University, Department of
Chemistry
Fisher, Mary; Augusta State University, Department of Chemistry
and Physics
Hu, Laixing; Georgia State University, Department of Chemistry
Kumar, Arvind; Georgia State University, Department of Chemistry
Liu, Zongying; Georgia State University, Department of Chemistry
Stephens, Chad; Augusta State University, Department of
Chemistry and Physics
Boykin, David; Georgia State University, Department of Chemistry
Soeiro, Maria; Instituto Oswaldo Cruz, Laboratório de Biologia
Celular
ew
vi
Re
Key Words:
Trypanosoma cruzi, Chagas disease, chemotherapy,
arylimidamides
Page 1 of 21
Parasitology
The Efficacy of Novel Arylimidamides Against Trypanosoma cruzi in vitro
Cristiane França da Silva1*, Anissa Daliry1*, Patrícia Bernardino da Silva1, Senol
Akay2, Moloy Banerjee2, Abdelbasset A. Farahat2, Mary. K. Fisher3, Laixing Hu2
Arvind Kumar2, Zongying Liu2, Chad E. Stephens3, David W. Boykin2 and Maria
de Nazaré Correia Soeiro1#
1
Laboratório de Biologia Celular, 2Department of Chemistry, Georgia State
Fo
University, Atlanta, Georgia, USA. 3Department of Chemistry and Physics,
Augusta State University, Augusta, GA, USA
rP
*Both authors equally contributed to this study
ee
Running title: Arylimidamides against T. cruzi
ev
rR
.
#
corresponding author:
iew
Laboratory of Cellular Biology
Maria de Nazaré Correia Soeiro
Av. Brasil, 4365. Manguinhos.
Rio de Janeiro, RJ, Brazil.
Tel: +055 21 25621368
Fax: +055 21 2562-1432
E-mail: [email protected]
1
Parasitology
Page 2 of 21
Summary
Objective. The present study aims to determine in vitro biological efficacy
and selectivity of seven novel AIAs upon bloodstream trypomastigotes and
intracellular amastigotes of Trypanosoma cruzi.
Methods. The biological activity of these aromatic compounds was
assayed for 48 and 24 h against intracellular parasites and bloodstream forms
of T. cruzi (Y strain), respectively. Additional assays were also performed to
Fo
determine their potential use in blood banks by treating the bloodstream
parasites with the compounds diluted in mice blood at 4°C/24 h. Toxicity against
rP
mammalian cells was evaluated using primary cultures of cardiac cells
incubated for 24 and 48 h with the AIAs and then cellular death rates
ee
determined by MTT colorimetric assays.
Results. Our data demonstrated the outstanding trypanocidal effect of
rR
AIAs against T.cruzi, especially DB1853, DB1862, DB1867 and DB1868, giving
ev
IC50 values ranging between 16 and 70 nanomolar against both parasite forms.
All AIAs presented superior efficacy to Benznidazole and some such as
iew
DB1868 also demonstrated promising activity as a candidate agent for blood
prophylaxis.
Conclusion. The excellent antitrypanosomal efficacy of these novel AIAs
against T. cruzi stimulates further in vivo studies and justifies the screening of
new analogs with the goal of establishing a useful alternative therapy for
Chagas disease.
Keywords: Trypanosoma cruzi, Chagas disease, chemotherapy, arylimidamides
2
Page 3 of 21
Parasitology
INTRODUCTION
Chagas disease, caused by the intracellular parasite Trypanosoma cruzi,
is a neglected illness affecting 12-14 million people in South and Central
American countries (Clayton, 2010a, Coura and Albajar-Vinas, 2010). This
disease is characterized by two sequential clinical phases: the acute phase
which begins soon after parasite infection and is usually asymptomatic, and the
chronic phase that may, after several years or even decades lead to
Fo
cardiomyopathy and/or digestive megasyndromes in 30-40% of the infected
individuals (Rassi et al., 2010; Laranja et al., 1951).
rP
Nifurtimox (3-methyl-4-(5’-nitrofurfurylideneamine) tetrahydro-4H-1, 4tiazine-1, 1-dioxide) and benznidazole (N-benzyl-2-nitroimidazole acetamide),
ee
were developed empirically more than four decades ago (Rodrigues Coura and
De Castro, 2002), and remain the current treatments for Chagas disease.
rR
These compounds remain in use despite the fact that they are considered far
ev
from ideal because they cause multiple side effects, present limited efficacy,
especially in patients with the late chronic stage of the disease (Rocha et al.,
iew
2007, Soeiro and De Castro, 2009, Bettiol et al., 2009, Machado et al., 2010),
and present unfavorable pharmacokinetic properties (Caldas et al., 2008).
These limitations emphasize the urgent need for development of new
trypanocidal compounds to replace the current chemotherapies (Soeiro and De
Castro, 2009).
In the last decade our group has focused on the study of a class of
synthetic aromatic compounds that has shown promising activity and selectivity
in vitro against a variety of pathogens, including Giardia lamblia (Bell et al.,
1991), Leishmania sp. (Kirk and Sati, 1940; Bell et al., 1990; Werbovetz et al.,
3
Parasitology
Page 4 of 21
2006, Wang et al., 2010), Plasmodium sp. (Bell et al., 1990; Hu et al., 2009,
Purfield et al., 2009), Pneumocystis carinii (Francesconi et al., 1999),
Toxoplasma gondii (Lindsay et al., 1991), and Trypanosoma sp. (Daliry et al.,
2009; Batista et al., 2010, De Souza et al., 2011). Aromatic amidines (AA) and
analogs have also demonstrated effectiveness in in vivo models against a
variety of pathogens including the causative agents of Leishmaniasis (Wang et
al., 2010), Human African Trypanosomiasis (Mathis et al., 2007, Wenzler et al.,
Fo
2009) and Chagas Disease (Da Silva et al., 2008; Batista et al., 2010). In fact,
pentamidine, a representative of the AA class has been widely used clinically
African
trypanosomiasis
(Apted,
rP
against
1980),
antimony-resistant
leishmaniasis (Bryceson et al., 1985), and P. carinii pneumonia (Kim et al.,
ee
2008). Congener aromatic molecules, like arylimidamides (AIAs; previously
described as “reversed” amidines), exhibit submicromolar and nanomolar
rR
efficacy against Leishmania donovani promastigotes and in L. donovani-
ev
infected macrophage assays (Stephens et al., 2003; Rosypal et al., 2007,
Rosypal et al., 2008). In addition, some AIAs demonstrated nanomolar IC50
iew
values against Trypanosoma cruzi parasites in vitro (Pacheco et al., 2009; Silva
et al., 2007a, Stephens et al., 2003, de Souza et al., 2010, Batista et al., 2010).
In mouse models, employing Y and Colombian strains, the AIA DB766
effectively reduced the parasite load in the blood and cardiac tissue and
presented
efficacy
similar
to
that
of
benznidazole,
improving
the
electrocardiographic alterations, and providing 90 to 100% protection against
animal mortality (Batista et al., 2010).
The mechanisms of action of AAs and congeners are still poorly
understood, however biophysical studies (Bailly et al., 1999; Wang et al., 2000;
4
Page 5 of 21
Parasitology
Mazur et al., 2000; Farahat et al., 2011) demonstrated their ability to bind to the
minor-groove of DNA at AT-rich sites, which could explain at least in part, their
microbicidal activity. This association could impair important biological events
associated with the cellular cycle and also prevent the association of
protein/factors to the parasite DNA, arresting steps such as DNA replication and
protein expression, ultimately leading to parasite death (Werbovetz., 2006;
Soeiro et al., 2010; Wang et al., 2010).
Fo
In a screening effort to further explore the anti-parasitic activity of these
promising cationic compounds aiming to identify potential novel candidates for
rP
Chagas disease therapy, the biological efficacy of seven AIAs was evaluated in
vitro against bloodstream and intracellular forms of T. cruzi. Additionally, their
ee
toxicity was determined against primary cultures of cardiac host cells. Our data
demonstrates the high trypanocidal effect of most of these aromatic
rR
compounds, such as DB1867, that displayed higher efficacy than the reference
ev
drug, being about 600 to 50 times more active against both BT and intracellular
forms, respectively. The high selectivity of these novel AIAs confirmed that they
iew
may represent novel therapeutic options for Chagas’ disease treatment.
MATHERIALS AND METHODS
Compounds
The synthesis of the seven compounds (DB1850, DB1852, DB1853, DB1862,
DB1867, DB1868, DB1890 – Figure 1) was performed according to according
to methods we have previously described (Stephens et al., 2003; Wang et al.,
2010) and will be published elsewhere. Benznidazole (Bz, Rochagan; Roche)
was used as reference drug as reported (Batista et al., 2010). Stock solutions
5
Parasitology
Page 6 of 21
were prepared in dimethyl sulfoxide (DMSO), with the final concentration in the
in vitro experiments never exceeding 0.6%, which did not exert any toxicity
toward the parasite or mammalian host cells (data not shown).
Parasites
The Y strain of T. cruzi was used in the present study. Bloodstream
trypomastigote forms (BT) were obtained from T. cruzi infected Swiss mice at
Fo
the peak of parasitemia (Meirelles et al., 1986). For the analyses upon
intracellular forms, parasites lodged within cardiac cell cultures were employed,
ee
rP
as previously reported (Silva et al., 2007a).
Cardiac cell cultures and Cytotoxicity assays
rR
For the evaluation of toxicity and compound activity against intracellular
parasites, primary cultures of embryonic cardiomyocytes (CM) were obtained
ev
from Swiss mice and purified following the method previously described
(Meirelles et al., 1986). In order to rule out toxic effects of the compounds on
iew
the host cells, uninfected CM cultures were incubated at 37ºC with compounds
for 24h and 48 h (0- 96 µM). The cell death rates were measured by the MTT
colorimetric assay allowing the determination of LC50 values (compound
concentration that reduces 50% of cellular viability) (Da Silva et al., 2011). All
cell cultures were maintained at 37 °C in an atmosphere of 5% CO2 and air,
and the assays were run at least three times in duplicates. All procedures were
carried out in accordance with the guidelines established and approved by the
FIOCRUZ Committee of Ethics for the Use of Animals (0099/01).
6
Page 7 of 21
Parasitology
Trypanocidal assays
The effect of the compounds against BT was evaluated through assaying 5 X
106 parasites/mL for 24 h at 37oC in RPMI 1640 medium supplemented with
10% of foetal bovine serum, in the presence of serial dilutions of the AIAs (0 32 µM). Alternatively, experiments were performed at 4°C for 24h, with BT
maintained in the presence of increasing concentrations of each compound (up
to 32 µM) with or without mouse blood contents (96%). Parasite death rates
Fo
were determined by light microscopy using a Neubauer chamber that allows the
direct visualization and quantification of the number of motile and live parasites,
rP
and then IC50 (drug concentration that reduce 50% of the number of the treated
parasites) calculated (Silva et al., 2007a, b).
ee
For the analysis of the effect against intracellular parasites, after 24 h of
parasite-host cell interaction (ratio 10:1), the infected cardiac cultures were
rR
washed to remove the free parasites and then maintained, at 37°C in an
ev
atmosphere of 5% CO2 and air, in the presence of non-toxic concentrations of
each AIA (up to 32 µM), replacing the medium (with the respective compound)
iew
every 24 h. Infected cultures not treated were used as control. After 48 hours,
all cultures were fixed and stained with Giemsa solution. The endocytic index
was used to compare the compound activity and was calculated by multiplying
the percentage of infected cells by the mean number of parasites per infected
cell (Da Silva et al., 2008).
RESULTS
The biological activity of seven novel arylimidamides (AIAs) was initially
assayed against bloodstream trypomastigotes (BT) (Table 1). When the
7
Parasitology
Page 8 of 21
compounds were diluted in the culture medium (RPMI) at 37ºC, all showed a
dose-dependent trypanocidal response (not shown). In these experiments the
compounds exhibited excellent in vitro activity achieving IC50 values in the low
micro molar range (between 0.01 up to 0.19 µM) (Table 1). The two most active
compounds against BT at 37ºC were DB1890 and DB1867, which presented
IC50 values of 0.01 µM and 0.02 µM and SI values of 2461 and 1600,
respectively, while DB1850 was the least active, with values of 0.19 µM and
Fo
168 for IC50 and SI, respectively (Table 1). All the AIAs showed superior activity
to BZ, presenting from 68 to 1200 fold higher efficacy than the reference drug
rP
(Table 1).
The drug activity in the presence of blood at 4ºC was evaluated with the
ee
goal to determine the applicability of these compounds for blood bank
prophylaxis. As it can be seen in Table 1, DB1850, DB1853, DB1862, DB1867
rR
and DB1868 maintained considerable trypanocidal effect at 4ºC, presenting
ev
superior efficacy to that of Bz (Table 1). However, both DB1852 and DB1890
showed a pronounced decrease in activity (>32 µM). Under these conditions,
iew
Bz showed almost a 19 fold decrease in activity.
It is possible that the decreased activity may be related to the low
temperature of the assay instead of only the presence of blood, therefore the
effect of some compounds was investigated at 4ºC but in the absence of blood,
using only culture medium (RPMI). Compounds were selected based on their
previous data: DB1868 that maintained its high trypanocidal activity compared
to two other AIAs that displayed loss of activity (DB1852 and DB1890). For
comparative analyses the reference drug Bz, was also included in the assay.
Interestingly, lowering the temperature of incubation was sufficient to drop the
8
Page 9 of 21
Parasitology
activity of DB1852, DB1890 and Bz while DB1868, alone, was unaffected by the
temperature (see IC50 values in Table 1).
To evaluate the toxicity of each AIA, uninfected cardiac cultures were
incubated for 24 and 48 h with different doses of the compounds and the
cellular viability evaluated by light microscopy and MTT colorimetric assays.
Cellular viability was not significantly reduced by any of the AIAs after
incubation for 24-48 h with doses up to 32 µM (not shown).
Fo
We further investigated the effect of the compounds upon intracellular
parasites by incubating T. cruzi-infected cardiac cells with selected non-toxic
rP
doses of each AIA. The direct quantification of the number of parasites in T.
cruzi-infected cultures after 48 hours of treatment showed a dose-dependent
ee
effect using all compounds (not shown). As found for BT forms, most AIAs
exhibited excellent biological activity with IC50 values in the low micromolar
rR
range: between 0.016 and 0.9 µM (Fig.2 A). All AIAs were again more potent
ev
than Bz, with some of them showing considerably superior efficacy, as can be
seen for DB1853 and DB1862, which were about 60 and170 fold more potent
iew
than Bz, respectively (Fig. 2 A-C).
The promising performance of this set of compounds was also observed by
the evaluation of the selectivity index (SI). For the BT forms the SI values were
between 168 and 2461 (Table 1), and for intracellular forms were >35 and
>2000 (Table 2). Taken together the compound DB1862 displayed the best
overall performance, with IC50 of 0.06 and 0.016 µM and with SI values of ~533
and >2000, for BT and amastigotes, respectively (Table 1 and 2).
9
Parasitology
Page 10 of 21
DISCUSSION
Aromatic amidines (AA), such as pentamidine, propamidine, and
diminazene aceturate, are DNA minor groove binders that have long been used
in infectious disease chemotherapy, exhibit broad-spectrum antimicrobial
effects (Soeiro et al., 2009, Soeiro and De Castro., 2010). However, they
display toxicity, require parenteral administration and present low bioavailability
(Werbovetz et al., 2006), justifying the search for more effective analogues.
Fo
Many AIAs have shown superior trypanocidal and leishmanicidal activity to that
of the related aromatic amidines (De Souza et al., 2004, 2006, 2010; Silva et
rP
al., 2007a,b; Pacheco et al., 2009; Batista et al., 2010, Soeiro et al., 2005;
Batista et al 2010, Wang et al., 2010). Therefore our aim was to evaluate the
ee
activity and selectivity of additional novel AIAs against clinically relevant forms
of Chagas disease.
rR
When assayed against bloodstream trypomastigotes, these AIAs were
ev
able to induce high level of parasite lyses in a dose-dependent manner,
showing IC50 values in the low micromolar range. With the exception of DB1850,
iew
all the compounds had IC50 values lower than 0.07 µM (Table 1), confirming the
excellent activity of the AIA class of compounds against T. cruzi as previously
reported (Pacheco et al., 2009; Silva et al., 2007a,b, Stephens et al., 2003, de
Souza et al., 2010, Batista et al., 2010). The difference found in the activity of
the most active compounds (DB1852, DB1853, DB1862, DB1867, DB1868,
DB1890) compared to the less active compound (DB1850), could be due to
binding to different targets, or even different modes of uptake and/or extrusion
of the drugs. Pentamidine and other amidines such as DB75 are actively
transported into African trypanosomes via the P2, HAPT1, and LAPT1 system
10
Page 11 of 21
Parasitology
of transporters (Lanteri et al., 2006) and accumulate at very high concentrations
in the parasite mitochondria (Mathis et al., 2006). However, until now, no report
has appeared regarding the internalization of amidines by T. cruzi. The superior
activity of AIA compared to AA compounds could be due to their lower pK
values and greater lipophilic character which may contribute to their efficient
entrance into cells (Mathis et al., 2007). The IC50 values against BT forms are
reasonably consistent except for that of DB1850. The lower activity of 1850 may
Fo
be due the markedly different terminal groups (5-membered ring thiazoles for
DB1850 and 6-membered ring pyridine or pyrimidine for the others). The six
rP
compounds with the higher activity against BT forms show that a range of
variations in the O-alkyl groups (OCH2CF3 to O-c-pentyl) are tolerated.
ee
However, additional experimental data are needed to evaluate all of these
hypotheses. Interestingly, all the compounds were significantly more active
rR
against BT forms than the current drug used for Chagas disease treatment, Bz.
ev
The effectiveness of AIAs at 4°C in the presence of blood constituents was
evaluated in order to evaluate their potential use in prophylaxis for blood
iew
banking. This analysis may also identify the potential loss of compound activity
due to plasma protein-compound interactions and may help to understand, in
part, the pharmacokinetics and mechanism of action of these compounds. The
incubation of BT under these experimental conditions showed that most AIAs
maintained their activity in the presence of blood (DB1850, DB1853, DB1862,
DB1867 and DB1868), which confirms their potential as candidates for blood
prophylaxis (Silva et al. 2007a, Batista et al., 2010, Da Silva et al., 2011).
In order to determine if the reduction in activity observed for some AIAs
(DB1852 and DB1890) was due to the low incubation temperature and not to
11
Parasitology
Page 12 of 21
compound instability and/or binding to blood elements, some of the AIAs were
evaluated, along with BT, by substituting mouse blood for RPMI culture
medium. The data demonstrated that these AIAs show decreased activity when
incubated at 4oC with RPMI, suggesting that the drop in activity could be due to
impaired compound uptake due to a transport mediated uptake (de Konning,
2001) and/or due to decreased cellular target metabolism. Further studies are
underway to clarify the effect observed in the present study.
Fo
These novel AIAs also exhibited considerable activity against intracellular
parasites at doses that did not cause host cell damage, presenting superior
rP
activity when compared to Bz. In this case, a slightly different SAR than that
noted for the BT results is seen in that DB1852 and DB1890 are the least active
ee
compounds. The cause of this difference is unclear but may be due to subtle
differences in uptake, mechanisms of action and/or different targets. A viable
rR
drug candidate must be active against both clinically relevant forms, killing BT
ev
that are released from the cells as well as targeting the intracellular
amastigotes. The present study shows that certain AIAs present this desirable
iew
characteristic. DB 1862 showed very high SI against both forms, and thus
deserves to be considered for in vivo studies.
Taken together the set of compounds evaluated here showed excellent
biological activity against clinically relevant forms of T. cruzi, showing high SI
values and limited toxicity towards mammalian cells. The efficacy of these
compounds against T. cruzi encourages in vivo evaluation as well as screening
of new analogs in search of a useful alternative therapy for Chagas disease.
12
Page 13 of 21
Parasitology
Acknowledgments
The present study was supported by Fiocruz and by Fundação Carlos
Chagas Filho de Amparo a Pesquisa do Estado do Rio de Janeiro (FAPERJ –
PP-SUS (2010), APQ1 (2011) and Pensa-Rio (16/2009-E-26/110-313/2010),
Conselho
Nacional
Desenvolvimento
científico
e
Tecnológico
(CNPq),
PDTIS/Fiocruz. The new AIA compounds were synthesisized with support from
the Bill and Melinda Gates Foundation.
iew
ev
rR
ee
rP
Fo
13
Parasitology
Page 14 of 21
REFERENCES
Apted, F.I. (1980). Present status of chemotherapy and chemoprophylaxis
of human trypanosomiasis in the Eastern Hemisphere. Pharmacology &
Therapeutics 11:391-413.
Bailly, C., Dassonneville, L., Carrasco, C., Lucas, D., Kumar, A.,
Boykin, D.W. and Wilson, W.D. (1999). Relationships between topoisomerase
Fo
II inhibition, sequence-specificity and DNA binding mode of dicationic
diphenylfuran derivatives. Anti-Cancer Drug Design 14:47-60.
rP
Bettiol, E., Samanovic, M., Murkin, A.S., Raper, J., Buckner, F. and
Rodriguez, A. (2009). Identification of three classes of heteroaromatic
ee
compounds with activity against intracellular Trypanosoma cruzi by chemical
library screening. PLoS Neglected Tropical Diseases 3:e384.
rR
Bryceson, A.D., Chulay, J.D., Mugambi, M., Were, J.B., Gachihi, G.,
ev
Chunge, C.N., Muigai, R., Bhatt, S.M., Ho, M., Spencer, H.C., et al. (1985).
Visceral leishmaniasis unresponsive to antimonial drugs. II. Response to high
iew
dosage sodium stibogluconate or prolonged treatment with pentamidine.
Transactions of the Royal Society of Tropical Medicine and Hygiene 79:705-14.
Caldas, I.S., Talvani, A., Caldas, S., Carneiro, C.M., de Lana, M., da
Matta Guedes, P.M. and Bahia, M.T. (2008). Benznidazole therapy during
acute phase of Chagas disease reduces parasite load but does not prevent
chronic cardiac lesions. Parasitology Research 103:413-21.
Clayton, J. (2010). Chagas disease: pushing through the pipeline. Nature
S12-S15.
14
Page 15 of 21
Parasitology
Coura, J.R. and Viñas, P.A. (2010). Chagas disease: a new worldwide
challenge. Nature Outlooks 465 (7301 suppl):S6-S7.
da Silva, C.F., Batista, M.M., Batista, D.da G., de Souza, E.M., da Silva,
P.B., de Oliveira, G.M., Meuser, A.S., Shareef, A.R., Boykin, D.W. and
Soeiro, M.de N. (2008). In vitro and in vivo studies of the trypanocidal activity of
a diarylthiophene diamidine against Trypanosoma cruzi. Antimicrobial Agents
Chemotherapy 52:3307-14.
Fo
da Silva, C.F., da Silva, P.B., Batista, M.M., Daliry, A., Tidwell, R.R.
and Soeiro, M.de N. (2010). The biological in vitro effect and selectivity of
rP
aromatic dicationic compounds on Trypanosoma cruzi. Memorias do Instituto
Oswaldo Cruz 105:239-45.
ee
Daliry, A., Da Silva, P.B., Da Silva, C.F., Batista, M.M., De Castro, S.L.,
Tidwell, R.R. and Soeiro, M. de N. (2009). In vitro analyses of the effect of
diamidines
upon
Chemotherapy 64:747-50.
rR
aromatic
Trypanosoma
cruzi.
Jounal
Antimicrobial
ev
de Koning, H.P. (2001). Transporters in African trypanosomes: role in
iew
drug action and resistance. Intenational Journal Parasitology 31:512-22.
Farahat, A.A., Paliakov, E., Kumar, A., Barghash, A.E., Goda, F.E.,
Eisa, H.M., Wenzler, T., Brun, R., Liu, Y., Wilson, W.D. and Boykin, D.W.
(2011). Exploration of larger central ring linkers in furamidine analogues:
Synthesis and evaluation of their DNA binding, antiparasitic and fluorescence
properties. Bioorganic & Medicinal Chemistry 19:2156-67.
Francesconi, I., Wilson, W.D., Tanious, F.A., Hall, J.E., Bender, B.C.,
Tidwell, R.R., McCurdy, D. and Boykin, D.W. (1999). 2,4-Diphenyl furan
15
Parasitology
Page 16 of 21
diamidines as novel anti-Pneumocystis carinii pneumonia agents. Journal of
Medicinal Chemistry 42:2260-5.
Hu, L., Arafa, R.K., Ismail, M.A., Patel, A,. Munde, M., Wilson, W.D.,
Wenzler, T., Brun, R. and Boykin, D.W. (2009). Synthesis and activity of
azaterphenyl diamidines against Trypanosoma brucei rhodesiense and
Plasmodium falciparum. Bioorganic & Medicinal Chemistry 17:6651-8.
Kim, S.Y., Dabb, A.A., Glenn, D.J., Snyder, K.M., Chuk, M.K. and Loeb,
Fo
D.M. (2008). Intravenous pentamidine is effective as second line Pneumocystis
pneumonia prophylaxis in pediatric oncology patients. Pediatric Blood & Cancer
rP
50:779-83.
Lanteri, C. A., Stewart, M.L., Brock, J.M., Alibu, V.P., Meshnick, S.R.,
ee
Tidwell, R.R. and Barrett, M.P. (2006). Roles for the Trypanosoma brucei P2
transporter in DB75 uptake and resistance. Molecular Pharmacology 70:1585-
rR
1592.
ev
Laranja, F.S., Dias, E. and Nobrega, G. (1951). Clinical aspect and
treatment of Chagas' disease. Prensa Medicine Argentina 38:465-84
iew
Machado, F.S., Tanowitz, H.B. and Teixeira, M.M. (2010). New drugs for
neglected infectious diseases: Chagas' disease. British journal of pharmacology
160:258-9
Mathis, A.M., Holman, J.L., Sturk, L.M., Ismail, M.A., Boykin, D.W.,
Tidwell, R.R. and Hall J.E. (2006). Accumulation and intracellular distribution
of antitrypanosomal diamidine compounds DB75 and DB820 in African
trypanosomes. Antimicrobial Agents and Chemotherapy 50:2185-2191.
Pacheco, M.G., da Silva, C.F., de Souza, E.M., Batista, M.M., da Silva,
P.B., Kumar, A., Stephens, C.E., Boykin, D.W. and Soeiro, M.deN. (2009).
16
Page 17 of 21
Parasitology
Trypanosoma cruzi: activity of heterocyclic cationic molecules in vitro.
Experimental Parasitology 123:73-80.
Purfield, A.E., Tidwell, R.R. and Meshnick, S.R. (2009). The diamidine
DB75 targets the nucleus of Plasmodium falciparum. Malaria Jounal 14;8:104.
Rassi, A.Jr., Rassi, A. and Marin-Neto, J.A. (2010). Chagas disease.
Lancet 375:1388-402.
Rocha, M.O., Teixeira, M.M. and Ribeiro, A.L. (2007). An update on the
Fo
management of Chagas cardiomyopathy. Expert Review of Anti-Infective
Therapy 5:727-43.
rP
Rodriques Coura, J. and de Castro, SL. (2002). A critical review on
Chagas disease chemotherapy. Memórias do Instituto Oswaldo Cruz 97:3-24.
ee
Silva, C.F., Batista, M.M., Mota, R.A., de Souza, E.M., Stephens, C.E.,
Som, P., Boykin, D.W. and Soeiro, M.deN. (2007a). Activity of "reversed"
rR
diamidines against Trypanosoma cruzi "in vitro". Biochemical Pharmacology
ev
73:1939-46.
Silva, C.F., Meuser, M.B., De Souza, E.M., Meirelles, M.N., Stephens,
iew
C.E., Som, P., Boykin, D.W. and Soeiro, M.N. (2007b). Cellular effects of
reversed
amidines
on
Trypanosoma
Chemotherapy 51:3803-9.
cruzi.
Antimicrobial
Agents
and
Soeiro, M.N. and de Castro, S.L. (2009). Trypanosoma cruzi targets for
new chemotherapeutic approaches. Expert Opinion Therapy Targets 13:105-21.
Stephens, C.E., Tanious, F., Kim, S., Wilson, W.D., Schell, W.A.,
Perfect, J.R., Franzblau, S.G. and Boykin, D.W. (2001). Diguanidino and
"reversed" diamidino 2,5-diarylfurans as antimicrobial agents. Journal of
Medicinal Chemistry 44:1741-8.
17
Parasitology
Page 18 of 21
Stephens, C. E., Brun, R., Salem, M.M., Werbovetz, K.A., Tanious, F.,
Wilson, W.D. and Boykin, D.W. (2003). The activity of diguanidino and
“reversed”
diamidino
2,5-diarylfurans
versus
Trypanosoma
cruzi
and
Leishmania donovani. Bioorganic & Medicinal Chemistry Letters 13:2065–2069.
Wang, L., Bailly, C., Kumar, A., Ding, D., Bajic, M., Boykin, D.W. and
Wilson, W.D. (2000). Specific molecular recognition of mixed nucleic acid
sequences: an aromatic dication that binds in the DNA minor groove as a dimer.
Fo
Proceedings of the National Academy of Sciences of the United States of
America 97:12-6.
rP
LEGENDS TO FIGURES
ee
Figure 1. Chemical structure of the compounds used in the study.
rR
Figure 2. Effect of arylimidamides and benznidazole against intracellular forms
of T. cruzi. A: IC50 values based on the reduction of the Endocytic Index (EI); B
ev
and C: Light microscopy analysis of infected cardiac cells submitted (C) or not
(B) to 0.13 µM DB 1862 treatment.
iew
18
Page 19 of 21
Parasitology
O
N
H3C
O
NH
HN
O
N
H
S
N
H
DB1850
O
CH3
S
O
NH
HN
O
N
H
N
N
N
H
N
DB1852
r
Fo
O
O
NH
N
HN
O
N
H
N
N
CF3
F3C
O
O
er
N
H
HN
O
N
H
Re
DB1862
O
N
H
DB1867
O
O
O
N
N
ew
N
H
HN
vi
S
NH
H3C
N
O
NH
N
N
DB1853
Pe
NH
N
H
N
HN
O
N
H
N
H
N
DB1868
O
O
NH
N
N
H
HN
O
DB1890
N
H
N
O
CH3
Parasitology
A
IC50 values of EI reduction
Compounds
DB1852
DB1853
DB1867
DB1890
Bz
SI
0.184 ± 0.077
82
0.538 ± 0.218
> 59
0.044 ± 0.034
294
0.016 ± 0.02
> 2000
0.058 ± 0.047
> 551
0.066 ± 0.004
48
0.9 ± 0.0007
> 35
2.77 ± 1.96
> 360
er
DB1868
RPMI
Pe
DB1862
Intracellular (48h of treatment)
r
Fo
DB1850
Control
Re
B
Page 20 of 21
C
DB1862
ew
vi
Page 21 of 21
Parasitology
Table 1. IC50 (µM) values of AIAs and benznidazole against BT forms of T. cruzi and
their respective SI values.
Compounds
IC50 (µM) after 24 h treatment
RPMI
Blood
37°C (SI)
4°C
4°C
Fo
0.19 ± 0.01 (168)
ND
2.35 ± 0.75
DB1852
0.06 ± 0.01 (>533)
>32
>32
DB1853
0.07 ± 0.01 (457)
ND
0.14 ± 0.07
DB1862
0.06 ± 0.01 (533)
ND
0.79 ± 0.82
DB1867
0.02 ± 0 (>1600)
ND
0.70 ± 0.19
DB1868
0.06 ± 0.02 (533)
0.157 ± 0.064
0.28 ± 0.08
DB1890
0.01 ± 0.0 (>2461)
>32
>32
Bz
12.94 ± 1.9 (>77)
>250
>250
iew
ev
rR
ee
rP
DB1850
BT = Bloodstream trypomastigotes
SI* = selectivity index corresponds to the ratio LC50/IC50 : For BT, the SI was calculated on
LC50 values of 24h.
Bz = Benznidazole
Resultados
Artigo # 05:Submetido, em 2011
Título: “In vitro and In vivo Investigation of the Efficacy of the Arylimidamide
DB1831 and its mesylated salt form - DB1965 - Against Trypanosoma cruzi
Infection”
Estado do conhecimento quando da concepção do trabalho:
 Arilimidamidas são agentes dicatiônicos com atividade na faixa nanomolar
sobre o T.cruzi in vitro, exibindo ainda excelente efeito in vivo,
 A terapia combinada representa uma abordagem interessante, pois permite a
aplicação de pelo menos dois compostos que atuem sobre diferentes alvos
celulares e vias metabólicas, possibilitando reduzir concentrações e número
de doses, levando a diminuição de efeitos colaterais e do risco de indução de
resistência a drogas.
 Questões propostas:
1. Investigar o efeito biológico in vitro da arilimidamida DB1831 e de seu
derivado (superior solubilidade) a DB1965 sobre modelos de infecção aguda
experimental de camundongos pelo Trypanosoma cruzi (cepa Y), analisando
diversos
parâmetros
parasitológicos
(parasitemia
e
mortalidade),
histopatológicos (parasitismo e inflamação), clínicos (curva ponderal), e de
cura parasitológica (hemocultivo e PCR).
2. Verificar o efeito in vivo do co-tratamento da DB1965 associada ao
Beznidazol durante a infecção experimental aguda de camundongos pelo T.
cruzi (cepa Y), analisando distintos parâmetros parasitológicos (parasitemia e
mortalidade), histopatológicos (carga parasitária e inflamação), clínicos (curva
ponderal e eletrocardiograma), bioquímicos (dosagem de CK , uréia e ALT) e
de cura parasitológica (hemocultivo e PCR).
Seguem 30 páginas
64
In vitro and In vivo Investigation of the Efficacy of the Arylimidamide
DB1831 and its mesylated salt form - DB1965 - Against
Trypanosoma cruzi Infection
Cristiane França da Silva1, Denise da Gama Jaen Batista1, Gabriel Melo de
Oliveira1, Elen Mello de Souza1, Erica Ripoll Hammer1, Patricia Bernardino da
Silva1, Anissa Daliry1, Julianna Araujo Siciliano1, Constança Britto2, Ana
Carolina Mondaine Rodrigues2, Zongying Liu3, Abdelbasset A. Farahat3, Arvind
Kumar3, David W. Boykin3 and Maria de Nazaré Correia Soeiro1*
1
Laboratório de Biologia Celular, 2 Laboratório de Biologia Molecular e Doenças
Endêmicas do Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de
Janeiro, RJ, Brazil, and 3Department of Chemistry, Georgia State University,
Atlanta, Georgia, USA.
*Corresponding author:
Laboratory of Cellular Biology
Maria de Nazaré Correia Soeiro
Av. Brasil, 4365. Manguinhos. Rio de Janeiro, Rio de Janeiro.
Tel: +055 21 25621368
Fax: +055 21 25621432
Email: [email protected]
Abstract
Chagas disease is caused by infection with the intracellular protozoan
parasite Trypanosoma cruzi. At present, nifurtimox and benznidazole, both
compounds developed empirically over four decades ago, represent the
chemotherapeutic arsenal for treating this highly neglected disease. However,
both drugs present variable efficacy depending on the geographical area, the
occurrence of natural resistance and are poorly effective against the later
chronic stage. As a part of a search for new therapeutic opportunities to treat
chagasic patients, pre-clinical studies were performed to characterize the
activity of a novel arylimidamide (AIA) [DB1831 (hydrochloride salt) and
DB1965 (mesylate salt)] against T.cruzi. DB1831 displayed a high trypanocidal
effect in vitro against both relevant forms in mammalian hosts, exhibiting a high
selectivity index and a very high efficacy (IC50 value/48h of 5nM) against
intracellular parasites. DB1965 shows high activity in vivo in acute experimental
models of T.cruzi, showing a similar effect to Bz when compared under a
scheme of 10 daily consecutive doses with 12.5mg/kg. Although no
parasitological cure was observed after treating with 20 daily consecutive
doses, a combined dosage of DB1965 (5mg/kg) with Bz (50mg/kg) resulted in
parasitaemia clearance and 100% animal survival. In summary, our present
data confirmed that aryimidamides represent promising new chemical entities
against T.cruzi in therapeutic schemes using the AIA alone or in combination
with other drugs, like benznidazole.
1. Introduction
Chagas disease is a neglected illness caused by the obligatory intracellular
protozoan Trypanosoma cruzi, extending from Central to South America (Prata,
2001). This disease has two consecutive clinical phases: acute phase, in which
the parasite dissemination can be seen directly on examination of blood. After
few weeks, the parasitism burden is controlled by host immune response and
the disease moves to the chronic stage. Most of the infected individuals do not
present recognizable pathological markers, however, after a long period (about
10-30 years) of clinical latency called the indeterminate form, some of them
show disease manifestations, mainly associated with cardiac and/or digestive
disturbances
(Prata, 2001;
Rodrigues Coura
and
De Castro,
2002).
Benzinidazole (BZ) and Nifurtimox (NF), introduced into clinical therapy about
40 years ago, cause many side effects, besides displaying limited efficacy,
especially in later chronic phase (Rodrigues Coura and De Castro, 2002;
Romanha et al., 2010). Also, several reports have demonstrated that some
strains are refractory to treatment (Moreno et al., 2010, Wilkinson et al., 2008).
Presently, posaconazole, a new anti-fungal agent that has been effective
against T.cruzi in vitro and in vivo assays, is expected to be entered into clinical
trials in the near future, however, even if effective, its use may be limited due to
its high costs (Soeiro and De Castro, 2009; Clayton 2010). Aromatic amidines
(AD) are DNA minor groove binders that recognize enriched AT sequences
(Werbovetz, 2006). In addition to showing high anti-parasitic activity against
fungi, amoeba, bacteria and especially protozoan parasites, some of these
cationic compounds, such as pentamidine have been used to treat neglected
diseases such as African trypanosomiasis and leishmaniasis. Despite having
unfavorable characteristics like poor oral bioavailability and undesirable side
effects (Soeiro et al., 2005), the broad activity of these compounds has
stimulated further screening of new analogs and prodrugs (Soeiro and De
Castro, 2009). One class of analogues that have different physiochemical
properties are the arylimidamides (AIAs) which have showed high efficacy in
vitro and in vivo against T.cruzi (Batista et al., 2010, Silva et al., 2007a,b , Da
Silva et al., 2011, Stephens et al., 2003). Studies in vivo with the AIA DB766
demonstrated a reduction in the parasite load levels in the blood and cardiac
tissue with similar trypanocidal activity as that of Bz in a mouse model of acute
T.cruzi infection using both Y and Colombian strains (Batista et al., 2010, 2011).
This AIA lead to the recovery of electrocardiographic alterations in addition to
reducing hepatic and heart lesions induced by the parasite infection (Batista et
al., 2010). The excellent activity of DB766 motivated the design and synthesis
of
novel
structurally
related
compounds
including
the
AIA,
DB1831
(hydrochloride salt) and its mesylate salt form (DB1965) for which in vitro and in
vivo studies are reported here with the goal of identifying novel anti-T. cruzi
candidates for possible future alternative therapies for Chagas disease.
2.
Materials and Methods
2.1. The synthesis of DB1831 and DB1965 (Figure 1) was performed as
reported for other analogues (Stephens et al, 2003; Wang et al, 2010 and will
be reported elsewhere). Benznidazole (Bz, Laboratório Farmacêutico do
Estado de Pernambuco - LAFEPE, Brazil) was used as reference drug (Batista
et al., 2010). Stock solutions of the compounds (5 mM) were prepared in
dimethyl sulfoxide (DMSO) and fresh final solvent concentration in the assays
never exceeded 0.6%, which is not toxic for both parasites and mammalian
cells. For acute toxicity studies and for efficacy analysis in vivo, DB1965 was
diluted in DMSO (never exceeding 10%) and then with distilled and sterile
water (Batista et al., 2010).
2.2. Cell cultures
For both drug toxicity and infection assays, primary cultures of cardiac
cells were obtained as reported (Meirelles et al., 1986). The cultures were
sustained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with
10% horse serum, 5% fetal bovine serum (FCS), 2.5 mM CaCl2, 1 mM
-
glutamine, and 2% chicken embryo extract. Cell cultures were maintained at
37 °C in an atmosphere of 5% CO2 and air, and assays were run at least three
times in duplicates.
2.3. Parasites
Y stock of Trypanosoma cruzi was used throughout the experiments.
Bloodstream trypomastigotes (BT) were harvested by heart puncture from T.
cruzi-infected Swiss mice at the parasitaemia peak day (Meirelles et al., 1986).
Intracellular amastigotes lodged within cardiac cell cultures were employed as
reported (Batista et al., 2010).
2.4. In Vitro Cytotoxicity assays.
In order to rule out toxic effects of the compounds against mammalian host
cells, uninfected cardiac cultures were incubated for 24 and 48 h at 37°C in the
presence or absence of each compound diluted in DMEM. The CM morphology
and spontaneous contractibility were evaluated by light microscopy. The cell
death rates were measured by MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl2H-tetrazolium bromide] colorimetric assay (Mosman, 1983). The absorbance
was measured at a wavelength of 490 nm with a spectrophotometer (VersaMax
tunable microplate
reader; Molecular Devices),
which
allows for the
determination of LC50 (compound concentration that reduces 50% of cellular
viability).
2.5. Trypanocidal analysis
BT were incubated at 37°C for 24 h in the presence of increasing nontoxic concentrations of the tested compounds diluted in in RPMI 1640 medium
(Roswell Park Memorial Institute- Sigma Aldrich. – USA) supplemented with 5%
fetal bovine serum. Alternatively, according to protocols already established by
our group (Batista et al., 2010), experiments were also performed with BT for 24
h using serial dilutions of the tested compound at 4ºC in the presence or
absence of freshly isolated mouse blood (96%). Death rates were determined
by light microscopy through direct quantification of the number of live parasites
using a Neubauer chamber, and the IC50 (drug concentration that reduces 50%
of the number of the treated parasites) calculated. For the analysis of the effect
against intracellular amastigotes, after 24 h of parasite-host cell interaction
(10:1 parasite:CM ratio), the infected cultures were washed to remove free
parasites and then incubated for another 48 h with increasing but non-toxic
doses of the test compounds. CM were maintained at 37°C in an atmosphere of
5% CO2 and air and the medium replaced every 24 h. Then, untreated and
treated infected CM were fixed and stained with Giemsa solution and the mean
number of infected host cells and of parasites per infected cells scored as
reported (Silva et al., 2007a). Only characteristic parasite nuclei and
kinetoplasts were counted as surviving parasites since irregular structures could
mean parasites undergoing death. The drug activity was estimated by
calculating the infection index (II - percentage of infected cells times the
average number of intracellular amastigotes per infected host cell) (Silva et al.,
2007a).
All assays in vitro were run at least three times in duplicates.
2.6. Mice acute toxicity
In order to determine the NOAEL (No Observed Adverse Effect Level) for
further in vivo efficacy studies against T. cruzi, 20-23g Swiss Webster ono
female and one male mice were treated with DB1965 under two therapeutic
schemes: (i) On day 1, a male and a female mice were injected ip with DB1965
every 2 h, with an increasing doses, starting at 25 mg/kg up to 400mg/kg
(Batista et al., 2010), (ii) On day 1, female mice were injected by intraperitoneal
(ip) or per oral (p.o) with DB1965, with different doses of the AIA, from 25 up to
400mg/kg. In both schemes, on days 2 and 3, mice were inspected for toxic and
sub-toxic symptoms according to OECD guidelines (Organization for Economic
Co-operation and Development). Forty-eight hours after compound injection,
the NOAEL values were determined (Batista et al., 2010).
2.7 Mice infection and treatment schemes
Male Swiss mice were obtained from the Fundação Oswaldo Cruz
(FIOCRUZ) animal facilities (Rio de Janeiro, Brazil). Mice were housed at
maximum 8 per cage and kept in a conventional room at 20-24ºC under a
12/12-h light/dark cycle. The animals were provided with sterilized water and
chow ad libitum. Infection was performed by ip injection of 104 bloodstream
trypomastigotes. The animals (18-21 g) were divided into the following groups:
uninfected (non-infected and non-treated); untreated (infected with T. cruzi but
non-treated); and treated (infected and treated - ip and p.o - with 12.5 up to 100
mg/kg/day DB1965 or with 100 mg/kg/day benznidazole). For DB1965
treatment, mice received 0.1 mL i.p injection or 0.2 mL oral dose, starting at the
5dpi followed by (i) for 5, (ii) 10 or (iii) 20 consecutive daily doses. For Bz
treatment, infected mice received 0.2 mL oral dose (gavage) following the same
therapeutic schemes as above described. Thirty days after compound
administration, about 1000 µL of blood were collected from the heart of
anesthetized mice and then 500, 200 and 250 µL were used for PCR,
hemoculture and biochemical analysis, respectively (Batista et al., 2010).
2.8. Parasitaemia, mortality rates and ponderal curve analysis
Parasitaemia was individually checked by direct microscopic counting of
parasites in 5 µL of blood, as described before (De Souza et al., 2006). At 7, 14,
21 and 28 dpi body weight was evaluated, and mortality checked daily until 30
days post treatment and expressed as percentage of cumulative mortality
(%CM) (Batista et al., 2010).
2.9. Electrocardiography (ECG)
ECG recording and analysis were performed in uninfected, acutely T.
cruzi-infected mice (after 30 days post treatment) subjected or not to DB1965
and Bz therapy, as previously described (Batista et al., 2010). Briefly, mice were
placed under stable sedation with diazepan (20mg/kg, ip), fixed in the supine
position, and eight-lead ECG was recorded from 18-gauge needle electrodes
subcutaneously implanted in each limb and two electrodes at precordial
positions lead II. The electrocardiographic tracings were obtained with a
standard lead (dipolar lead DII), recording with amplitude set to give 2 mV/1s.
ECG was recorded by using band-pass filtering (Bio Amp - AD Instruments,
Hastings, United Kingdom) between 0.1 and 100 Hz. Supplementary
amplification and analog-digital conversion was performed with a Powerlab 16S
instrument (AD Instruments, Hastings). Digital recordings (16bit, 4kHz/channel)
were analyzed with the Scope (version v3.6.10) program (AD Instruments). The
signal-averaged ECG (SAECG) was calculated by using the mouse SAECG
extension (version 1.2) program (AD Instruments) and a template-matching
algorithm. ECG parameters were evaluated using the following standard
criteria: (i) the heart rate was monitored by beats/minute, and (ii) the variation at
P wave and PQ, QRS and QT intervals were measured in milliseconds (ms).
2.10. Blood pressure
Before evaluation of blood pressure, mice were daily adapted for seven days
and a tail sphygmomanometer was fitted for three consecutive readings until
stabilization was observed. Blood pressure was individually recorded at 30 days
post treatment using an LE 5001 Pressure meter® (PanLab Instruments,
Barcelona - Spain), evaluating caudal artery pressure in non-sedated animals.
Values of systolic (SP), diastolic (DP) and the mean (MP) pressure were
calculated as indicated by the manufacturer (De Oliveira et al., 2009)
2.11. Biochemical analysis
At 30 days post treatment, plasma measurements of alanino Aminotransferase
(ALT), urea and creatine kinase (CK) were performed through the Program for
Technological Development in Tools for Health (PDTIS-FIOCRUZ).
2.12. Histopathology analysis
At 30 days post treatment, hearts were removed, cut longitudinally, rinsed in
ice-cold PBS, and fixed in Millonig-Rosman solution (10% formaldehyde in
phosphate-buffered saline). The tissues were dehydrated and embedded in
paraffin. Sections (3 µm) stained by routine hematoxylin-eosin were analyzed
by light microscopy. The number of amastigote nests and of inflammatory
infiltrates (more than 10 mononuclear cells) was determined in at least 30 fields
(total magnification, 40x) for each slide, from at least three mice per group with
three sections from each mouse (Da Silva et al., 2008).
2.13. Cure assessment
As reported (Batista et al., 2010, 2011), cure criteria were based on three
parasitological methods: (i) Parasitaemia Negativation observed by light
microscopy, (ii) Polymerase Chain Reaction (PCR) and (iii) Hemoculture
assays. Animals presenting negative results for all tests were considered cured.
For PCR, 500 µL blood was diluted in 1:3 volume of guanidine solution
(guanidine-HCl 6 M/EDTA 0.2M), and heated for 90 sec. in boiling water in
order to cleave the parasite kDNA network (Britto et al., 1993). The PCR was
performed using the primers: (5´AAATAATGTACGGG(T/G)GAGATGCATGA3´)
and (5´GGTTCGATTGGGGTTGGTGTAATATA3´), which amplify a 330bp
sequence
from
the
minicircles
kinetoplast
DNA
(aprox.
120,000
copies/parasite), as previously described (Wincker et al., 1994). The PCR was
carried out using a GeneAmp® PCR Sytem 9700 (Applied Biosystems) as
follows:
one step at 94ºC for 3 min (to activate the Taq platinum DNA
polymerase), 2 cycles at 98ºC for 1 min and 64ºC for 2 min, 38 cycles at 94ºC
for 1 min and 64ºC for 1 min, followed by a final extension at 72ºC for 10 min.
The amplification products were detected by 1.5% agarose gel electrophoresis
following staining with ethidium bromide staining (5 mg/mL). For hemoculture,
200 µL of blood was added to 5 mL LIT medium and incubated at 28ºC for 30
days, being weekly examined by light microscopy to detect epimastigote forms
(Gascón et al., 2007). Only negative parasitaemia and hemocultive samples
were further screened by PCR analysis (Batista et al., 2010, 2011).
2.14. Statistical analysis
Statistical analysis was carried out using a variance (ANOVA) program
with the level of significance set at p≤0.05. The data are representative of 2-4
experiments run in duplicate.
All procedures were carried out in accordance with the guidelines
established by the FIOCRUZ Committee of Ethics for the Use of Animals
(CEUA 0028/09).
3. RESULTS
Our first step was to evaluate the direct effect of DB1831 against bloodstream
trypomastigotes during treatment for 24 h at 37ºC. This AIA displayed a dosedependent trypanocidal activity, with IC50 value of 20 nM (Table 1). With the
goal of possible application for blood bank prophylaxis, BT was assayed at 4ºC
in the presence or absence of blood constituents. The data at 4ºC showed that
DB1831 retained a high efficacy (IC50 values of 80 and 24 nM with or without
mice blood, respectively) as compared to reference drug (IC50 > 250.000 nM)
(Table 1). Afterwards, toxicity aspects of DB1831 were evaluated in vitro using
cardiomyocytes cultures. Treatment at 37ºC for 24 and 48 h resulted in loss of
cellular viability only when higher doses were employed, showing 50% lethal
doses of 32 and 15 µM, respectively. Next, the effect of this AIA was screened
against T.cruzi-infected cultures using nontoxic doses (up to 10.6 µM). DB1831
also reduced both the percentage of infected cells and the mean number of
parasites per infected cells, revealed by the infection index determination, which
exhibited an outstanding IC50 = 5 nM after 48 h of treatment (Table 1). Excellent
SI values (1600 and 2900 for BT and intracellular parasites) were found (Table
1). However, due to the poor solubility of DB1831, a methanesulfonic acid salt
(DB1965) was obtained and used for the in vivo analysis. Before assaying
DB1965 in an experimental model of an acute T.cruzi infection (Batista et al.,
2010), its trypanocidal effect upon trypomastigotes was confirmed. The data
confirmed its high activity, showing an IC50 = 31 nM after 24 h of incubation at
37º C (Table 1). These data confirmed the high activity and selectivity of both
(DB1831 and DB1965) when compared with Bz (Table 1). Before assaying the
in vivo efficacy of DB1965, two schemes of acute toxicity studies were
conducted aiming to determine the NOAEL values. In the first set, both female
and male mice were injected ip with increasing doses of DB1965, both animals
died at the dose of 400mg/kg, yielding a NOAEL value of 50mg/kg (data not
shown). When DB1965 was given to female mice by different routes (ip and
p.o), considerable toxic side effects like ataxia and tremors (gross pathology
also showed hemorrhagic intestinal signs) were also found with doses ≥
200mg/Kg administrated by ip, inducing animal death at 400mg/Kg dose (Table
2). However, on oral administration neither lead to mortality nor revealed
significant side effects when followed up to 48h after DB1965 injection (up to
400mg/kg) (Table 2). The efficacy of DB1965 was assayed in Swiss male mice
inoculated with 104 bloodstream parasites using three different treatment
schemes employing doses that did not cause mortality in the acute toxicity
studies (doses up to 100mg/Kg/day via po route or up to 25 mg/kg/day via ip
route). Only those mice that presented positive parasitaemia were used in the
following studies. In the first scheme of treatment (Scheme 1), DB1965 was
administered at 5 to 9 dpi (5 daily consecutive doses) using 12.5 and
25mg/kg/day, and 100mg/kg/day by ip and p.o routes, respectively. As
expected for this experimental mouse model of T.cruzi acute infection using Y
strain, infected and untreated mice (untreated group) presented high
parasitaemia levels, peaking at 8 dpi (Fig. 2A). When DB1965 was
administrated via ip a reduction of 93 and 99% in parasitaemia levels was
observed using 12.5 and 25 mg/kg/day dose, respectively. On the other hand,
gavage administration of DB1965 and Bz resulted in 51 and 100% of decrease
in parasitaemia levels, respectively (Fig 2A). Biochemical analysis performed at
30 days post treatment showed that although some differences could be noted
between untreated and uninfected mice groups, only ALT measurements
displayed a statistically significant increase in plasma levels (p=0.02) during the
parasite infection as compared to uninfected mice group (Table 3). Also, except
for the 12.5mg/kg DB1965 data on urea levels (p=0.03), neither Bz and DB1965
showed considerable differences related to measurements of tissular markers
for the hepatic, renal and muscular lesions as compared to infected and
untreated animals (Table 3). The analysis of parasitological cure (by
hemocultive and PCR) demonstrated that no cure was achieved in both Bz and
DB1965 treated mice (Table 4). Also, as the ip dose of 12.5mg/kg of the AIA
achieved 100% of animal survival (Fig. 2B), this later dose was selected for the
second round of assays, using 10 daily consecutive doses (at 5 dpi for 10 dpi).
The data showed that quite similar parasitaemia control was reached using Bz
(99.8) and DB1965 (97%) (Fig. 2C). Although both DB1965 and Bz were
effective in protecting against animal mortality, resulting in about 90 and 100%
of survival, respectively (Fig. 2D), neither were able to produce parasitological
cure of the animals (Table 4).
Because some reversible side effects like
hyperactivity was noted for the DB1965 group at the end of the treatment (after
the 7th day of DB1965 administration), and aiming to find an alternative scheme
of therapy using this highly active AIA, a combined treatment of DB1965
(5mg/kg/day) and Bz (50mg/kg/day) was next employed, under a scheme of 20
daily consecutive doses. Our data showed that all treated mice (treated with
each compound alone and with Bz + DB1965) presented 100% of survival (Fig.
2F). These treated mice also displayed a suppression of the parasitaemia at the
peak day exhibiting 100, 100 and 84% of decrease after Bz, BZ+DB1965 and
DB1965 administration (Fig. 2E). The ponderal curve shows that neither
DB1965 alone nor in combination with Bz was able to lead to recovery of the
mice weight loss induced by the parasite infection (data not shown). The
analysis of organ weight revealed that although parasite infection induced an
increase in all studied organs (heart, spleen, liver and kidney), only statistically
significant differences were observed in liver weight (p=0.022) from infected and
untreated mice as compared to uninfected animal groups (data not shown). As
compared to untreated mice, all treated groups – Bz (p=0.029), DB1965
(p=0.013) and Bz+ DB 1965 (p=0.022) lead to a return of heart weight to preinfection values (data not shown). Regarding liver, only the combined therapy
partially restored (p=0.03) the organ weight increase due to parasite infection
(data not shown). ECG analysis showed a statistically significant bradycardia
(p=0.02) in infected and untreated mice group as already reported in this
experimental model of acute T.cruzi infection (da Silva et al., 2008). However,
none of the therapeutic groups were able to avoid this cardiac electric alteration
(data not shown).
Also, no statistically significant differences were found in
blood pressure analysis among all studied groups (data not shown). Also,
among all treatment regimens, only 1 out of 06 surviving mice from the DB1965
treated groups (12.5mg dose – scheme 1 and DB1965+Bz – scheme 3)
displayed negative hemocultive. However, both animals displayed positive
PCR, showing no parasitological cure (Table 4). Histopathology analysis
revealed that no major differences could be found in the cardiac tissues among
the different experimental infected mice groups (data not shown).
Discussion
AIAs belong to a class of amidine compounds with high trypanocidal
activity in vitro (Da Silva et al., 2011) and in vivo (Batista et al., 2010) and the
present study confirmed and extended previous observations of their properties.
The evaluation of both in vitro and in vivo effects of DB1831/DB1965
against T.cruzi infection showed their excellent efficacy against bloodstream
trypomastigotes and intracellular amastigotes, with high selectivity indexes,
confirming previous data using other AIAs (Silva et al., 2007a, Batista et al.,
2010, Da Silva et al., 2011). DB1831 exhibited an outstanding effect against
intracellular parasites (IC50 = 5nM), which is about 560-fold higher than Bz. The
high activity of DB1831 was maintained when BT were incubated at different
temperatures and with blood mice, also confirming the promising activity of AIAs
for a blood decontamination protocol (Da Silva et al., 2011; Batista et al., 2010).
Due to the high selectivity indexes for both parasite forms, DB1965 was moved
to in vivo studies of acute T. cruzi experimental infection. Since acute toxicity
studies showed NOAEL data of ≥ 50mg/kg, different protocols were used using
non-toxic doses.
Our findings demonstrated that the administration of DB1965 by 5 and 10
daily consecutive doses of 12.5 mg/kg give the best results, leading to similar
efficacy as Bz. Also, DB1965 did not induce alterations in CK and ALT plasma
levels, as also demonstrated by the use of another AIA, the DB766 (Batista et
al., 2010) as well as with other amidines (De Souza et al., 2006, Da Silva et al.,
2008). The analysis by ECG showed that DB1965 alone or associated to Bz did
not revert cardiac electric alterations induced by the parasite infection.
However, although DB1965 alone or in combination with Bz did not induce,
under the present studied therapy schemes, parasitological cure (evaluated by
parasitaemia negativation, hemocultive and PCR assays), this AIA as well as
the combined therapy suppressed the parasitemia and provided 100% survival
of the infected animals.
DB1831 is an analog of DB766, a AIA that presents high efficacy against
in vitro and in vivo experimental models of T.cruzi (Batista et al., 2010) and
Leishmania (Wang et al., 2010) infections but showing low activity against
Besnoitia besnoiti in vitro (Cortez et al., 2011). Although AIAs also contain
amidine groups, they have lower pKa values and thus are more hydrophobic
than classical AD since in AIAs an amidine nitrogen atom is bound to an
aromatic unit (Richard and Werbovetz, 2010). DB766 (IC50 = 60nM against
bloodstream forms) is a modified version of furamidine (DB75) that only
displays a moderate anti-T.cruzi effect against bloodstream forms (IC50 = 16 M)
(De Souza et al., 2004) confirming that small modifications of the chemical
structure of these synthetic compounds can lead to a higher selectivity and
efficacy. In DB766, the 2 core structure-benzene rings of DB75 were altered
through the addition of two iso-propoxy groups, leading to superior
effect
against intracellular trypanosomatid parasites like Leishmania (Wang et al.,
2010, Richard and Werbovetz, 2010) and T.cruzi (Batista et al., 2010, 2011).
Similarly, DB1831 and its mesylate form (DB1965) also showed high antiT.cruzi activity and selectivity in vitro and in vivo. The only difference in
structure between DB766 and DB1831 is the terminal groups (pyridine and
pyrimidine, respectively); which suggests that both pyrimidine and pyridine units
in these systems are advantageous for T. cruzi activity and merits further
investigation. Although treatment with 12.5 mg/kg of DB1965 for 10 days
suppressed the parasitaemia and gave 90% protection against mortality, due to
the detection of some undesirable sides effects (like hyperactivity), longer
periods of therapy (>10 daily consecutive doses) were not performed and a
combined treatment of 5mg/kg DB1965 + 50mg/kg Bz (sub-optimal dose) was
chosen following a protocol previously established (Batista et al., 2011). When
comparing the efficacy of DB766 and DB1965 our data demonstrated that this
later AIA was not as effective in vivo as DB766, especially by p.o route (Batista
et al., 2010). Since DB766 yields NOAEL values of 400mg/kg for both p.o and
ip routes in the mouse (Batista et al., 2010), DB1965 is less well tolerated since
it presents NOAEL values of 50mg/kg and 400mg/kg by ip and p.o routes,
respectively. As above briefly discussed, the difference in toxicity between
DB766 and DB1965, like the difference in efficacy, must be attributed to the
difference in terminal groups. Further investigations are required to sort out the
effect of this small structural change on both efficacy and toxicity. It is important
to note that histopathological and biochemical data gave no major signals of
toxicity for DB1965 in the three different schemes of treatment employed, using
doses up to 100mg/kg via p.o. and 25mg/kg via ip.
The present report shows the promising in vitro and in vivo activity of
arylimidamides like DB1965 against T. cruzi infection and validates further
exploration of AIAs as new candidate for Chagas disease therapy. In fact,
although DB1965 did not produce parasitological cure rates, its ability to reduce
parasite burden and to yield high protection against mortality highlights the
efficacy of these AIAs against T.cruzi. These results are encouraging because
Chagas disease is commercially an unattractive field for the pharmaceutical
industry despite a lack of therapeutic options other than Bz and Nifurtimox
whose short comings are well known (De Castro et al., 2011; Wainwright, 2010,
Caldas et al., 2008).
Acknowledgments
The present study was supported by Fiocruz and by Fundação Carlos
Chagas Filho de Amparo a Pesquisa do Estado do Rio de Janeiro (FAPERJ –
PPSUS, APQ1 and Pensa-Rio (16/2009-E-26/110-313/2010)), Conselho
Nacional Desenvolvimento científico e Tecnológico (CNPq), PDTIS/Fiocruz,
and CPDD. The authors thank the Program for Technological Development in
Tools for Health-PDTIS-FIOCRUZ for use of their facilities.
References
Batista D da G, Batista MM, de Oliveira GM, do Amaral PB, LannesVieira J, Britto CC, Junqueira A, Lima MM, Romanha AJ, Sales Junior PA,
Stephens CE, Boykin DW, Soeiro Mde N. Arylimidamide DB766, a potential
chemotherapeutic candidate for Chagas' disease treatment. Antimicrob Agents
Chemother. 2010;54(7):2940-52.
Batista DGJ, Batista MM, Oliveira GM, Britto CC, Rodrigues ACM,
Stephens CE, Boykin DW, Soeiro MNC. 2011. Treatment of Heterocyclic
Analogues and Benznidazole upon Trypanosoma cruzi in vivo. Plos One. In
press.
Britto, C., M. A. Cardoso, P. Wincker, and C. M. Morel. 1993. A simple
protocol for the physical cleavage of Trypanosoma cruzi kinetoplast DNA
present in blood samples and its use in polymerase chain reaction (PCR)-based
diagnosis of chronic Chagas disease. Mem. Inst. Oswaldo Cruz 88:171-172
Caldas IS, Talvani A, Caldas S, Carneiro CM, de Lana M, da Matta
Guedes PM, Bahia MT. Benznidazole therapy during acute phase of Chagas
disease reduces parasite load but does not prevent chronic cardiac lesions.
Parasitol Res. 2008 Jul;103(2):413-21.
Clayton J. Chagas disease: pushing through the pipeline. Nature
2010;465:S12-5. doi:10.1038/nature09224.
Cortes HC, Muller N, Boykin D, Stephens CE, Hemphill A. In vitro effects
of arylimidamides against Besnoitia besnoiti infection in Vero cells.Parasitology.
2011: 138(5):583-92.
Da Silva CF, Junqueira A, Lima MM, Romanha AJ, Sales Junior PA,
Stephens CE, Som P, Boykin DW, Soeiro Mde N. In vitro trypanocidal activity of
DB745B and other novel arylimidamides against Trypanosoma cruzi. J
Antimicrob Chemother. 2011 Jun;66(6):1295-7.
da Silva, C. F., M. M. Batista, D. G. J. Batista, E. M. De Souza, P. B. da
Silva, G. M. de Oliveira, A. S. Meuser, A. R. Shareef, D. W. Boykin, and M. N.
Soeiro. 2008. In vitro and in vivo studies of the trypanocidal activity of a
diarylthiophene diamidine against Trypanosoma cruzi. Antimicrob. Agents
Chemother. 52:3307-3314.
De Castro S, Batista DGJ, Batista MM, Batista W, Daliry A, De Souza
EM, Menna-Barreto RFS, Oliveira GM, Salomão K, Silva CF, Silva PB, Soeiro
MNC. Experimental chemotherapy for Chagas´ disease: a morphological,
biochemical and proteomic overview of Trypanosoma cruzi targets. 2011.
Molecular Biology International. In press.
de Oliveira GM, da Silva TM, Batista WS, Franco M, Schor N. Acute
Trypanosoma cruzi experimental infection induced renal ischemic/reperfusion
lesion in mice. Parasitol Res. 2009 Dec;106(1):111-20
De Souza, E. M., A. Lansiaux, C. Bailly, W. D. Wilson, Q. Hu, D. W.
Boykin, M. M. Batista, T. C. Araújo-Jorge, and M. N. Soeiro. 2004. Phenyl
substitution of furamidine markedly potentiates its anti-parasitic activity against
Trypanosoma cruzi and Leishmania amazonensis. Biochem. Pharmacol.
68:593-600
de Souza, E. M., G. M. Oliveira, D. W. Boykin, A. Kumar, Q. Hu, and M.
N. C. Soeiro. 2006. Trypanocidal activity of the phenyl-substituted analogue of
furamidine DB569 against Trypanosoma cruzi infection in vivo. J. Antimicrob.
Chemother. 58:610-614.
Gascón, J., P. Albajar, E. Cañas, M. Flores, i Prat. J. Gómez, R. N.
Herrera, C. A. Lafuente, H. L. Luciardi, A. Moncayo, L. Molina, J. Muñoz, S.
Puente, G. Sanz, B. Treviño, and X. Sergio-Salles. 2007. Diagnosis,
management and treatment of chronic Chagas' heart disease in areas where
Trypanosoma cruzi infection is not endemic. Rev. Esp. Cardiol. 60:285-293
Meirelles, M. N., T. C. Araujo-Jorge, C. F. Miranda, W. De Souza, and H.
S. Barbosa. 1986. Interaction of Trypanosoma cruzi with heart muscle cells:
ultrastructural and cytochemical analysis of endocytic vacuole formation and
effect upon myogenesis in vitro. Eur. J. Cell Biol. 41:198-206.
Moreno M, D'ávila DA, Silva MN, Galvão LM, Macedo AM, Chiari E,
Gontijo ED, Zingales B. Trypanosoma cruzi benznidazole susceptibility in vitro
does not predict the therapeutic outcome of human Chagas disease. Mem Inst
Oswaldo Cruz. 2010 Nov;105(7):918-24.
Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and
survival: application to proliferation and cytotoxicity assays. J. Immunol.
Methods 65:55-63.
Prata A. Clinical and epidemiological aspects of Chagas disease. Lancet
Infect Dis. 2001 Sep;1(2):92-100
Richard JV, Werbovetz KA. New antileishmanial candidates and lead
compounds. Curr Opin Chem Biol. 2010 Aug;14(4):447-55.
Rodriques Coura, J., and S. L. De Castro. 2002. A critical review on
Chagas disease chemotherapy. Mem. Inst. Oswaldo Cruz 97:3-24.
Romanha AJ, Castro SL, Soeiro M de N, et AL. In vitro and in vivo
experimental models for drug screening and evelopment for Chagas disease.
Mem Inst Oswaldo Cruz 2010;105:233-8
Silva, C. F., M. M. Batista, R. A. Mota, E. M. De Souza, C. E. Stephens,
P. Som, D. W. Boykin, and M. N. Soeiro. 2007a. Activity of “reversed”
diamidines against Trypanosoma cruzi in vitro. Biochem. Pharmacol. 73:19391946
Silva CF, Meuser MB, De Souza EM, Meirelles MN, Stephens CE, Som
P, Boykin DW, Soeiro MN 2007b. Cellular effects of reversed amidines on
Trypanosoma cruzi. Antimicrob. Agents Chemother 51: 3803-9.
Soeiro MN, De Souza EM, Stephens CE, Boykin DW. Aromatic
diamidines as antiparasitic agents. Expert Opin Investig Drugs. 2005
Aug;14(8):957-72.
Soeiro, M. N., and S. L. de Castro. 2009. Trypanosoma cruzi targets for
new chemotherapeutic approaches. Expert Opin. Ther. Targets 13:105-121
Stephens CE, Brun R, Salem MM, Werbovetz KA, Tanious F, Wilson WD,
Boykin DW. The activity of diguanidino and 'reversed' diamidino 2,5-diarylfurans
versus Trypanosoma cruzi and Leishmania donovani. Bioorg Med Chem Lett.
2003 Jun 16;13(12):2065-9.
Wainwright M. Dyes, trypanosomiasis and DNA: a historical and critical
review. Biotech Histochem. 2010 Dec;85(6):341-54.
Wang MZ, Zhu X, Srivastava A, Liu Q, Sweat JM, Pandharkar T,
Stephens CE, Riccio E, Parman T, Munde M, Mandal S, Madhubala R, Tidwell
RR, Wilson WD, Boykin DW, Hall JE, Kyle DE, Werbovetz KA. Novel
arylimidamides for treatment of visceral leishmaniasis. Antimicrob Agents
Chemother. 2010 Jun;54(6):2507-16
Werbovetz K. Diamidines as antitrypanosomal, antileishmanial and
antimalarial agents. Curr Opin Investig Drugs. 2006 Feb;7(2):147-57.
Wilkinson SR, Taylor MC, Horn D, Kelly JM, Cheeseman I. A mechanism
for cross-resistance to nifurtimox and benznidazole in trypanosomes. Proc Natl
Acad Sci U S A. 2008 Apr 1;105(13):5022-7
Wincker, P., C. Britto, J. B. Pereira, M. A. Cardoso, W. Oelemann, and C.
M. Morel. 1994. Use of a simplified polymerase chain reaction procedure to
detect Trypanosoma cruzi in blood samples from chronic chagasic patients in a
rural endemic area. Am. J. Trop. Med. Hyg. 51:771-777
Legends
Fig.1 – Chemical structure of the compounds
Fig.2 - Treatment of T. cruzi-infected mice (104 Y strain/mice) with DB1965. The
activity of 5 (E-F), 12.5 and 25 (A-D) mg/Kg/day of DB1965 (ip) and
100mg/kg/day DB1965 via p.o (A-B) is presented. As reference drug, 50 and
100 mg/Kg/day benznidazole (by p.o.) was also evaluated using similar
therapeutic schemes at the 5-9 dpi (A-B), 5-14 dpi (C-D) and 5-24dpi (E-F).
Parasitaemia curves (A, C and E) and percentage of cumulative mortality (B, D
and F) are shown.
O
O
NH
N
HN
N
O
N
N
H
N
H
DB1831 hydrochloride salt
DB1965 mesylate salt
N
Table 1. Trypanocidal effect of Arylimidamides and Benznidazole against T. cruzi (Y strain)
Bloodstream Trypomastigotes (24h)
Intracellular Parasites
(48h)
4ºC
37ºC
Compounds
Blood
IC50 (µM)
DB1831
0.08
0.04
RPMI
IC50(µM)
IC50(µM)
SI
IC50(µM)
SI
0.024 0.004
0.02 0
1600
0.005 0.001
2900
DB1965
nd
nd
0.031 0.01
342
nd
nd
Bz
>250
>250
12.94 1.93
> 77
2.8 1.96
> 360
The activity of the compounds against bloodstream trypomastigotes (BT) and intracellular
parasites was evaluated during their incubation at 37 C and at 4 C for 24 h and 48 h.
IC50 values = Drug concentration that reduces the number of parasites by 50%
SI* = selectivity index corresponds to the ratio LC50/IC50 – For BT and intracellular
parasites calculated on LC50 values of 24 and 48 h of incubation at 37ºC, respectively
Nd: not done
Bz = Benznidazole
Table 2: Acute toxicity analysis –Escalating doses using single doses on day 1 (starting at
25mg/kg up to 400mg/kg – ip and po – using 0.2mL final volume per mice): Swiss female mice
(20-23g – one mouse per each dose)
via
25mg/kg
50mg/kg
100mg/kg
200mg/kg
400mg/kg
NOAEL
ip
NDE
NDE
Slight
ataxia
*Euthanized
Died
50mg/kg
p.o
NDE
NDE
NDE
NDE
NDE
400mg/kg
AIA
DB1965
Nd = not done due to solubility issues.
NDE: No detectable effect
NOAEL (No observed adverse effect level)
* Mouse was euthanized after 20h post treatment due to side effects (ataxia
and tremors) and the gross pathology showed hemorrhagic signs (intestine)
Uninfected
Untreated
% of cumulative mortality
x10e4 par/ml
100
450
400
350
300
250
200
150
100
50
0
100 BZ vo
100 DB1965 vo
12,5 DB1965 ip
25 DB1965 ip
80
Untreated
100 po DB1965 5-9 dpi
60
100 po BZ 5-9 dpi
40
12,5 DB1965 5-9dpi
25DB1965 ip 5-9dpi
20
0
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30
dpi
0
7
14
% of cumulative mortality
x10e4 par/ml
A
450
400
350
300
250
200
150
100
50
0
Untreated
100 BZ po 5-14dpi
12,5 DB1965 ip
35
B
Uninfected
80
Untreated
60
12,5 DB1965 ip 5-14dpi
100 BZ po 5-14dpi
40
20
0
dpi
0
Untreated
5 DB1965 ip +50 BZ vo 5-24dpi
50 BZ vo 5-24dpi
5 DB1965 ip 5-24dpi
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30
dpi
E
5
10
15
20
25
30
35
40
dpi
C
% of cumulative mortality
x10e4 par/ml
28
100
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30
450
400
350
300
250
200
150
100
50
0
21
dpi
45
D
100
80
60
Uninfected
Untreated
5 DB 1965 ip + 50 B Z vo 5-24dpi
50 B Z vo 5-24dpi
5 DB 1965 ip 5-24dpi
40
20
0
0
5 10 15 20 25 30 35 40 45 50
dpi
F
Table 3: Biochemical analysis (at CECAL/Fiocruz) of T.cruzi infected submitted our not to the
treatment with DB1965 and Benznidazole (Bz) performed at 30 days post treatment using
Urea
ALT
CK
Uninfected
53 8,4
33 5,6
383 223
Infected and untreated
44 6,7
45 5
595 622
25mg/kg DB1965 ip
59 11
43 14
208 73
12.5mg/kg DB1965 ip
58 9
40 7,6
357 61
100mg/kg BZ ip
56 12
35 11
296 122
Table 4: Cure assessment of DB1965 combined or not with benznidazole (Bz) in murine model
of acute T. cruzi-infection1
Assays performed after 30 days post
treatment
Experimental
groups
Untreated
Bz 100mg/kg
Scheme 1
(5 consecutive
daily doses)
DB1965 100mg/kg
p.o.
4/4
5/6
0/3
-
0/4
nd
0/5
nd
3/5
0/3
nd
DB1965 12.5
mg/kg
ip
6/6
1/6
0/1
-
2/7
0/2
nd
5/5
0/5
7/8
0/7
Bz 100mg/kg
Untreated
1
p.o
3/5
Number of
negative blood PCR
samples/number of
mice
ip.
DB1965 12.5
mg/kg
Scheme 3
(20 consecutive
daily doses)
-
Number of
negative
hemoculture
samples/number of
mice
DB1965 25 mg/kg
Untreated
Scheme 2
(10 consecutive
daily doses)
Therapy
route1,2
Number of
surviving/
total number of
animals
p.o.
ip
-
2/6
0/2
nd
nd
nd
Bz 50mg/kg
p.o
6/6
0/6
nd
DB1965 5mg/kg
ip
6/6
0/6
nd
DB1965 5 mg/kg +
Bz 50 mg/kg
ip+p.o
6/6
1/6
0/1
Swiss male mice weight 20 to 24 g inoculated with 104 blood trypomastigotes (Y strain).
Treatment was initiated at 5º dpi followed by different schemes of treatment (up to 20 consecutive daily
doses).
2Intraperitoneal – ip
3per oral – p.o.
Nd= not done
Discussão
DISCUSSÃO
95
Discussão
4. DISCUSSÃO
Apesar dos avanços alcançados nas últimas décadas quanto aos controles
vetoriais e pela via transfusional adotados por países do Cone Sul, esta
parasitose causada pelo Trypanosoma cruzi representa ainda um sério
problema de saúde pública em áreas endêmicas das Américas Central e do
Sul. No Brasil, os 3-4 milhões de indivíduos infectados, atingidos em plena fase
produtiva, justificam o estudo e identificação de novos compostos que possam
ser efetivos contra o parasito, e que apresentem menos efeitos colaterais. De
fato, dados da SVS (Secretaria de Vigilância Sanitária do Brasil) comprovam a
necessidade de se manter as políticas de vigilância epidemiológica e de se
buscar terapias alternativas haja vista o novo quadro epidemiológico de
recentes surtos no país, totalizando 727 notificações de 2005-2010, sendo a
grande maioria (cerca de 71%) decorrente da via oral de transmissão (Tabela
1) alcançando letalidade de 2.6% (SVS, 2010).
Amidinas aromáticas e análogos, como as arilimidamidas, possuem uma
promissora atividade contra vários patogenos. Vários destes compostos
aromáticos dicatiônicos se ligam de forma não covalente e não intercalante a
96
Discussão
fenda menor do DNA, porém o exato mecanismo de ação ainda não foi
completamente elucidado, tendo sido propostos vários modos de ação (Wilson
e cols., 2005, Werbovetz, 2006). Frente a limitada biodisponibilidade das
amidinas clássicas devido principalmente ao seu caráter dicatiônico, vários
grupos de síntese medicinal tem trabalhado na produção de prodrogas, como é
o caso da DB289, visando sobrepor estas limitações físico-químicas, uma vez
que o tratamento via oral é preferencial sobre as outras vias de administração
(Arafa e cols., 2005). A DB289 mostrou resultados promissores na fase clinica I
e II contra tripanossomiase africana e malária. Infelizmente, em um estudo
adicional de segurança da prodroga em paralelo com a fase III, alguns
voluntários apresentaram toxicidade no fígado e rim, e assim os ensaios foram
encerrados (Ismail e cols., 2011). Dados da literatura (De Souza e cols., 2004,
2006b, 2010; Silva e cols., 2007a; Pacheco e cols., 2009; Batista e cols., 2010)
somados aos que observamos na presente tese (Da Silva et al., 2008, 2010,
2011a, b, c) demonstram que AIAS, têm atividade tripanocida superior em
relação a outros representantes da classe de amidinas, incluindo as diamidinas
aromáticas. É ainda importante ressaltar que a superior atividade das AIAs
pode estar relacionado com suas propriedades químicas, pois estas moléculas
não possuem seus grupamentos catiônicos expostos na extremidade da
molécula, resultando em menores valores de pKa, apresentando portanto, um
carácter mais hidrofóbico que as diamidinas clássicas cujo pKa é em geral
próximo a 10 (Arafa e cols., 2005). Esta particularidade estrutural das AIAs
contribui para sua captação e internalização mais eficiente através de
membranas biológicas de células hospedeiras e dos parasitos (Mathis e cols.,
2007; Richard e Werbovetz, 2010).
Ainda com relação a urgente necessidade de se identificar novas
abordagens terapeuticas para DC, é relevante citar que esta parasitose foi
classificada como a mais importante doença tropical da América Latina, em
termos de impacto no desenvolvimento sócio-econômico influenciando
principalmente na saúde e na produtividade
de populações carentes e
desprovidas de representação (“sem voz”) e de cuidados médicos holísticos
(Oliveira, 2009, Franco-Paredes e cols., 2009). No Brasil, o Bz é a única opção
de tratamento (Wilkinson e cols., 2008), e como já citado anteriormente não é a
droga ideal por desencadear severos efeitos colaterais frequentemente levando
97
Discussão
a interrupção do tratamento que requer longos períodos (em média 30-60 dias),
além de apresentar eficácia variada (a depender da idade do paciente, região
geográfica e fase da doença) e da ocorrência de cepas do parasito
naturalmente resistentes a nitroderivados (Yun e cols., 2009; Beyer e cols.,
2007; Clayton, 2010b). De fato, os efeitos colaterais do tratamento com Bz
levam em torno de 18% dos pacientes a interrupção do tratamento, sendo as
principais causas a hipersensibilidade (89% dos casos) e intolerância digestiva
(11% dos casos) (Viotti e cols., 2009). As razões para limitada eficácia dos
compostos nitro heterociclicos em especial na fase crônica podem estar
relacionados com suas propriedades farmacocinéticas desfavoráveis, tais como
curta meia vida e limitada penetração nos tecidos (Urbina, 2009). Outro dado
impactante é que nos pacientes que desenvolvem a cardiomiopatia chagásica
crônica, o transplante de coração é o único tratamento disponível para
modificar a progressão natural desta patologia na sua fase terminal.
Infelizmente, a taxas de sucesso são muito baixas principalmente decorrentes
da reativação do parasitimo (reagudização) e rejeição, alcançando taxas de
mortalidade de cerca de 43% (Fiorelli e cols., 2011). Outro ponto a ser
considerado é a resistência a drogas que representa um grave problema em
diferentes tipos de patologias causadas por parasitos, fungos e bactérias. Esta
resistência (natural e adquirida) pode ocorrer por vários mecanismos que
podem ser divididos em dois principais grupos: (i) aqueles relacionados
diretamente a estrutura da droga (nível de captação e/ou de extrusão do
fármaco pelo agente infeccioso) e/ou (ii) aqueles que incidem sobre a droga
através do metabolismo do paciente (tais como a modificação a partir de
enzimas hepáticas, e/ou sequestro e inativação do composto por elementos
plasmáticos). Compostos nitro-heterociclicos, como Bz e Nf são caracterizados
com um grupo nitro ligado ao anel aromático, e requerem ativação metabólica
para mediar o efeito citotóxico/citostático sobre o parasita. Portanto, fatores que
interfiram neste processo podem levar à eventos de resistência, e assim, outra
característica desejável para um novo fármaco para DC é que este agente
tenha uma ampla ação sobre diferentes cepas do parasito incluindo as
naturalmente resistentes a Bz e Nf, além de eficácia sobre cepas isoladas dos
diferentes ciclos (domiciliar, peridomiciliar e silvestre) (Batista e cols., 2010;
98
Discussão
Wilkinson e cols., 2008). Este foi também um dos aspectos explorados na
presente tese e que será mais detalhado a seguir (Da Silva e cols., 2011a).
A partir dos dados acima apresentados, na presente tese tivemos por
objetivo avaliar a ação tripanocida de novas amidinas que possam ser eficazes
e seguras para o tratamento contra DC. A síntese de vários análogos/
derivados de diamidinas tem sido realizada por alguns grupos, em especial
pelo laboratório do Dr. D. Boykin (Universidade de Atlanta, EUA) e Dr. R.
Tidwell (Universidade do Norte da California, EUA), nossos colaboradores que
nos cederam os compostos testados através de ensaios in vitro e in vivo.
Neste estudo realizado com a DB1362 (Da Silva e cols., 2008) confirmamos
dados anteriores referentes ao efeito tripanocida dose-dependente – em faixa
micromolar - de diamidinas aromáticas - contra as formas relevantes para
infecção de mamíferos - as formas tripomastigotas e amastigotas, em
concentrações não citotóxicas as células hospedeiras (De Souza e cols., 2004,
2011). No estudo publicado nas Memórias do Instituto Oswaldo Cruz (Da Silva
e cols., 2010) com outros compostos dicationicos aromáticos que pertencem a
biblioteca de compostos do Dr. Tidwell, também demonstramos a atividade de
compostos amidínicos (14SMB013, 10SAB092, 10SAB031, 11SAB081 e
12SMB032), em doses micromolares, sobre as formas intracelulares do
parasito (cepa Y), sendo mais ativos que o Bz. Visando seu potencial uso em
bancos de sangue, estes compostos foram também testados a 4ºC na
presença de sangue (96%) de camundongo, e os resultados (Da Silva e cols.,
2010) mostraram uma considerável redução na atividade tripanocida,
possivelmente devido à associação/inibição dos compostos por componentes
plasmáticos, como já relatados frente ao tratamento de parasitas com outros
fármacos (Santa-Rita e cols., 2000, 2006). De fato, observamos uma
considerável diminuição na atividade de algumas amidinas, incluindo DB1852 e
DB1890, de cerca de 500 e 3200 vezes, respectivamente.
Por outro lado, algumas AIAs que estudamos (em especial a DB745 e a
DB1831) mantiveram promissora atividade neste esquema de tratamento, não
sendo observados efeitos inibitórios, confirmando dados anteriormente descrito
para outras AIAs como a DB889 (Silva e cols., 2007a e b). De fato, a excelente
eficácia das amidinas DB1850, DB1853, DB1862 e DB1868, DB745B e
DB1831 na presença de sangue é uma característica farmacológica desejável
99
Discussão
(para profilaxia) compartilhada por outras AIAs bastante promissoras, como a
DB766 (Batista e cols., 2010a), e que deve ser mais explorada quanto ao seu
potencial uso em bancos de sangue. Embora os procedimentos adotados para
transfusão de sangue e transplante de órgãos, em especial por países
endêmicos (mas presentemente também adotados também em países como
EUA com grande fluxo imigratório de indivíduos de países da A. Latina) incluam
testes sorológicos para detecção de possíveis contaminações pelo T.cruzi e
que resultaram numa importante redução de novos casos, é importante
ressaltar, que estes procedimentos não são seguidos universalmente, em
especial em áreas mais carentes de recursos. O risco de infecção pelo T.cruzi
por transfusão em bancos de sangue ainda permanece significativo,
alcançando índices de 10-20%, a depender de vários fatores, incluindo a
concentração no sangue do doador e cepa do parasita (Rassi e cols., 2010;
Moraes-Souza e Ferreira-silva, 2011). No entanto, ainda hoje, o único agente
tripanocida disponível para profilaxia do sangue em áreas endêmicas é a
violeta de genciana, um corante catiônico tóxico que possui várias limitações
(Chiari e cols., 1996; Clayton, 2010b). No Brasil, o controle nos bancos de
sangue tem se revelado efetivo, mas em algumas cidades da Bolívia (como
Cochabamba e Santa Cruz de La Sierra), este controle ainda representa um
grande problema pela ausência de uma política universal de vigilância
epidemiológica. Este aspecto torna-se ainda mais crítico por que nestas
localidades estima-se que cerca da metade dos potenciais doadores estejam
infectados pelo T.cruzi (Coura e Viñas, 2010; Moraes-Souza e Ferreira-Silva,
2011).
Alternativamente,
quando
testamos
os
compostos
nas
condições
desenhadas para profilaxia em bancos de sangue, analisamos ainda a
possibilidade da perda de atividade estar relacionada às condições de baixa
temperatura, e não devido somente a presença de sangue. Nestes últimos
ensaios, substituímos o sangue de camundongo por meio de cultivo, mantendo
a temperatura a 4ºC. Observamos que a incubação em meio de cultivo a 4ºC
resultou em perda da atividade de alguns compostos (DB1852 e DB1890A)
mesmo na ausência de sangue, sugerindo que esta perda possa ser indicativa
de inibição da internalização mediada por sistemas de transporte (de Konning,
2001). A pentamidina e outras diamidinas, como a DB75, são captadas
100
Discussão
ativamente em tripanosomas africanos por transportadores de purinas em
especial, via P2, mas também (em menor escala) por HAPT1 e LAPT1 (Lanteri
e cols., 2006). Porém, com relação ao T.cruzi, não há ainda relatos sobre o
mecanismo de transporte de amidinas por estes parasitos, o que representa
uma interessante área de estudo a ser analisada. Por outro lado, observamos
(Silva e cols., 2011b) que a atividade tripanocida da DB1831 não foi reduzida a
4ºC, em presença ou mesmo ausência de sangue, sugerindo que este
composto possa apresentar, como sugerido para outras AIAs (Batista e cols.,
2010b), uma maior permeabilidade a membranas biológicas frente a não
exposição de seus grupos catiônicos, apresentando assim, uma natureza de
internalização diferente de outras diamidinas clássicas.
AIAs apresentaram alta seletividade contra as formas tripomastigotas,
como por exemplo DB745B apresentando índice de selectividade (IS) de 2133.
Também é importante notar que este mesmo composto foi mais eficaz que o
benzonidazol em cerca de 860 vezes sobre parasitas sanguíneos. A DB745 foi
ainda ativa contra um amplo painel de cepas isoladas de ciclos peridomiciliares
e silvestres, sendo mais ativa que a violeta de genciana e que as diamidinas
DB569 e DB75 (Da Silva e cols., 2011; Soeiro e cols., 2009).
É possível que as diferenças de atividade tripanocida entre as amidinas (ex.
AIAs versus diamidinas) tenham correlação com (i) pequenas alterações na
estrutura molecular destes compostos (ex. presença de diferentes grupos
químicos, tipo de associação da amidina ao esqueleto do composto – grupo
arila que com as AIAs é mediado por um átomo de N), (ii) diferentes alvos
celulares, ou até mesmo, (iii) distintos mecanismos de internalização dos
compostos. Mesmo entre as AIAs observamos diferenças relativas a sua
eficácia e seu tempo de ação. Como observamos nos estudos realizados com
as duas AIAs DB745 e DB766 (Da Silva e cols., 2011), a análise de atividade
dose-dependente e de “timepoint” demonstram que a DB745B é mais efetiva
em curtos períodos de tratamento em relação a DB766. Estes resultados
sugerem uma captação mais eficiente da DB745 em relação a DB766,
mostrando que mesmo entre as AIAS possa haver pequenas variações
estruturais que induzam a diferentes alvos celulares e/ou distintos mecanismos
de transporte.
101
Discussão
Visando verificar possíveis alvos celulares de algumas destas amidinas,
estudo ultraestrutural conduzido com a diamidina DB1362 mostrou que a
mitocôndria do parasita foi significantemente afetada com o tratamento (Da
Silva e cols., 2008). Este dano mitocondrial foi observado também com outras
diamidinas (Hentzer e Kobayasi, 1977; De Souza e cols., 2004; Fusai e cols.,
2007; Hu e cols., 2009) e arilimidamidas (Silva e cols., 2007b, Batista e cols.,
2010a). Nesta tese, ensaios por citometria de fluxo também revelaram que a
DB1362 altera o potencial de membrana mitocondrial identificado pela
marcação de rodamina 123 (Da Silva e cols., 2008). Estes dados sugerem a
interferência
no
gradiente
eletroquímico
de
prótons,
semelhante
ao
demonstrado no tratamento de formas tripomastigotas com outras diamidinas e
arilimidamidas (De Souza e cols., 2006; Silva e cols., 2007b). Quanto à
localização intracelular destes compostos aromáticos (alguns deles são
fluorescentes) em formas tripomastigotas, observamos na presente tese que
todos os compostos estudados são encontrados em estruturas enriquecidas de
DNA como o cinetoplasto e núcleo (Da Silva e cols., 2010). No entanto,
também demonstramos a falta de correlação entre localização e acúmulo
destas amidinas e sua atividade, como também anteriormente demonstrado
com outros representantes desta classe de compostos em T.cruzi (Daliry e
cols., 2009). Estudos in vitro realizados em tripanosomas africanos, também
não puderam correlacionar à distribuição, localização e acúmulo de aza
análogos de diamidinas com sua respectiva atividade (Mathis e cols., 2007).
Nossos resultados também confirmaram a baixa citotoxicidade da maioria
dos compostos amidínicos, exibindo baixa toxicidade quando incubados com
culturas primárias de cardiomiocitos in vitro (Silva e cols., 2007a, De Souza e
cols., 2010; Batista e cols., 2010). As amidinas estudadas no artigo publicado
em 2010 (Da Silva e cols., 2010) demonstraram uma considerável atividade
contra formas intracelulares do parasita com valores de IS (percorrendo entre >
43 e > 960). As AIAs apresentaram uma maior selectividade contra os
parasitas intracelular, como por exemplo, DB745B e DB1831, com IS entre de
aproximadamente 353 e 2900.
O efeito das AIAs sobre formas intracelulares revelou a excelente atividade
e superior eficácia quando comparado ao Bz, como pode ser visto com a
DB745B e DB1831 que foram cerca de 90 e 560 vezes mais eficientes que a
102
Discussão
droga de referência, respectivamente. Por outro lado, observamos uma
diferença na atividade de algumas amidinas (como reportado no artigo Da Silva
e cols., 2010) sobre as distintas formas do parasita que pode ser atribuída a
diferentes mecanismos de ação dos compostos. Assim, um composto
tripanocida promissor para estudos in vivo, deve apresentar atividade
considerável contra ambas as formas relevantes para a infecção no hospedeiro
mamífero, lisando as formas tripomastigotas e atingindo também as formas
intracelulares albergadas em células hospedeiras (Romanha e cols., 2010). Já
que alguns compostos testados neste estudo atenderam a estes pré-requisitos
(atividade sobre ambas formas do parasita, altos IS com atividade ≥ droga de
referência), e havia uma quantidade suficiente para condução de ensaios em
modelos experimentais, testamos em estudos in vivo a diamidina DB1362 e a
AIA DB1965 (análogo da DB1831).
Dados preliminares com a DB1362 in vivo mostraram que a via intravenosa
resultou em altas taxas de mortalidade, e assim, optamos pela via
intraperitoneal, usando concentrações que não acarretou efeitos colaterais
detectáveis no camundongo (até 50 mg/kg). O tratamento com a DB1362 por
10 dias com doses diárias resultou na proteção contra a infecção pelo T.cruzi
com 100% de sobrevivência, comparando com cerca de 50% de mortalidade
no grupo infectado e não tratado após 60 dias de infecção (dpi). Estes dados
confirmam dados prévios que demonstram o papel protetor da diamidina
DB569 sobre a infecção experimental pelo T. cruzi in vivo (De Souza e cols.,
2006). Importante ressaltar, que o esquema de tratamento com 10 doses de
DB1362 embora não tenha suprimido totalmente a parasitemia circulante, foi
capaz de reduzir, em niveis semelhantes ao Bz, o parasitismo cardíaco (e
infiltrado inflamatório) avaliado pela análise histológica das amostras do
coração no 14º dpi, que corresponde ao pico da carga parasitária cardíaca e
inflamação no nosso modelo experimental (De Souza e cols., 2006). A DB1362
foi também capaz de reverter as arritmias elétricas induzidas neste modelo
experimental (Swiss Webster macho inoculado com 10 4 formas sanguíneas da
cepa Y). Resultados semelhantes foram achados com a DB569 que apesar de
não reduzir completamente a parasitemia; diminuiu, porém, o parasitismo
cardíaco e protegeu contra alterações do EGC, características da infecção por
T.cruzi (De Souza e cols., 2007). Dados na literatura demonstraram que AIAs,
103
Discussão
como DB745B e DB766, são ativas contra infecção por Leishmania in vitro e in
vivo, não exibindo mutagenicidade, apresentando baixa toxicidade aguda,
moderada biodisponibilidade oral, intensa distribuição para diferentes tecidos
como o fígado, baço e coração, e possuindo uma meia-vida que varia de 1 a 2
dias em camundongos (Wang e cols., 2010). Frente a excelente atividade da
DB766 sobre Leishmania (Wang e cols., 2010) e sobre T.cruzi (Batista e cols.,
2010a), mas baixa atividade contra Besnoitia besnoiti (Cortes e cols., 2011),
vários derivados foram sintetizados visando ampliar sua seletividade e eficácia
sobre estes parasitos. A DB1831 é um destes análogos da DB766, que
apresenta alta atividade in vitro e in vivo contra o T. cruzi (Batista e cols.,
2010a). Na presente tese mostramos a excelente atividade e seletividade da
DB1831 in vitro (Da Silva e cols., 2011b), e visando potencializar sua
solubilidade, nossos colaboradores (grupo do Dr. Boykin) sintetizaram um
análogo utilizando outros sais (“mesylated salt”), sendo então denominada
DB1965. Estudos de toxicidade aguda com diferentes protocolos realizados
com a DB1965 mostraram valores de NOAEL (“No observed adverse effect
levels”) 50mg/kg e 400mg/kg (Da Silva e cols., 2011b) para vias ip e p.o (per
oral), apresentando neste aspecto, maior toxicidade que a DB766 que exibe
valores de NOAEL de 400mg/kg para ambas vias (Batista et al., 2010a). No
entanto, é importante afirmar que dados histopatológicos e bioquímicos não
demonstraram sinais importantes de toxicidade da DB1965 nos três diferentes
regimes de tratamento, utilizando doses de até 100mg/kg via po e 25mg/kg via
ip.
Apesar da análise da atividade in vivo da DB1965 não resultar em índices
de cura parasitológica, esta AIA apresentou semelhante eficácia que o Bz (nos
esquemas terapêuticos utilizados) com importante redução da carga parasitária
e indução de proteção contra a mortalidade, ressaltando a promissora ação de
AIAs contra T. cruzi. A administração da DB1965 por cinco e dez doses diárias
consecutivas de 12,5,mg/Kg levou a uma eficácia similar ao Bz, não resultando
em alterações dos níveis plasmáticos de creatina cinase (CK) e alanina
aminotransferase (ALT). Estes dados corroboram estudos anteriores realizados
com a DB766 (Batista et al., 2010a), e também com outras diamidinas (De
Souza et al. 2006, Da Silva et al. 2008). O uso da DB1965 por 10 dias
consecutivos (dose de 12,5mg/Kg) reduziu a parasitemia em 97%, protegendo
104
Discussão
ainda em grande magnitude (90%) a mortalidade induzida pela infecção. No
entanto, como no final do curso do tratamento observamos alguns efeitos
colaterais indesejáveis, mas reversíveis (como hiperatividade), foram então
realizados ensaios de tratamento combinado utilizando 5mg/kg DB1965 +
50mg/kg Bz (dose sub-ótima) por 20 dias consecutivos de tratamento. O uso
combinado possibilita reduzir a dose de cada fármaco, diminuindo assim os
efeitos colaterais além de permitir a atuação sobre diferentes alvos celulares
(Muñoz e cols., 2011). Algumas drogas quando combinadas com o Bz reduzem
seus os efeitos colaterais, principalmente relacionados ao metabolismo
hepático e na toxicidade dos radicais livres formados na nitro redução deste
nitro-derivado (Viotti e cols., 2009). Na presente tese, observamos proteção de
100% contra a mortalidade e supressão superior a 99% frente a combinação de
DB1965+ Bz, porém, em nenhum dos grupos, observamos cura parasitológica
(avaliada pela negativação da parasitemia, ensaios de hemocultivo e PCR)
nem proteção contra as arritmias elétricas (análise por ECG) induzidas pela
infecção.
Ao comparar a eficácia da DB766 e DB1965, nossos dados demonstraram
que esta última AIA não apresentou superior atividade in vivo em comparação
com a DB766, especialmente quando avaliamos os dados por via oral (Batista
et al., 2010a).
Contudo, é importante ressaltar que mesmo que não seja
alcançada a cura parasitológica estéril, deve-se considerar outros aspectos
incluindo a supressão da carga parasitária e proteção considerável contra
mortalidade, objetivando aumento da qualidade de vida e prevenção da
evolução da doença (Machado e cols., 2010; Rassi e col., 2010).
Resumindo, os nossos dados in vitro e in vivo revelam a superior eficácia
das AIAs sobre seus análogos, as outras amidinas como diamidinas aromáticas
e mesmo sobre as drogas de referência para doença de Chagas (Bz e violeta
de genciana). Nossos dados reforçam e justificam o rastreamento de novos
análogos desta classe de compostos que possam ser usados sozinhos ou em
combinações com outras drogas para o tratamento da doença de Chagas.
Como para qualquer novo fármaco, estudos farmacológicos e de toxicidade
mais detalhados devem ser explorados, visando a identificação de novas AIAs
que apresentem potencial para o tratamento da doença de Chagas.
105
Conclusões
CONCLUSÕES
106
Conclusões
1. A atividade in vitro de amidinas, como diamidinas aromáticas (DA) e
arilimidamidas (AIAs), avaliada sobre formas tripomastigotas sanguíneas e
intracelulares do T. cruzi revelou um aspecto terapêutico promissor.
2. Dentre as amidinas testadas, as arilimidamidas foram as que exibiram superior
atividade sobre formas intracelulares e tripomastigotas sanguíneos de T. cruzi
in vitro, em concentrações nanomolares, que não afetam a viabilidade de
células de mamíferos.
3. De fato, pequenas variações na estrutura química das amidinas resultaram em
diferenças significativas na sua potência anti-parasitária: as AIAs DB745B e
DB1831 apresentaram superior atividade tripanocida na maioria dos sistemas
testados (diferentes formas evolutivas, cepas do parasita, condições de
temperaturas e frente a adição de sangue) em relação as outras AIAs testadas
e as drogas de referencia.
4. A DB745B revelou importante efeito tripanocida também sobre cepas
naturalmente resistentes ao Bz, como a YuYu e Colombiana.
5. A análise do efeito da maioria dos compostos (AIAs e DA) contra
tripomastigotas em presença de sangue total, mostrou uma diminuição na
atividade tripanocida de várias amidinas. Porém, algumas AIAs incluindo a
DB745 e a DB1831 mantiveram excelente ação em presença de sangue a 4C,
corroborando dados anteriores com outras AIAs e sugerindo seu potencial uso
profilático em bancos de sangue.
6. Como já observado frente à incubação de tripanosomas com diamidinas
aromáticas, a análise por microscopia eletrônica de transmissão (MET) revelou
que o tratamento com a DB1362 induziu importantes alterações ultraestruturais em tripomastigotas de T. cruzi, principalmente no núcleo e
mitocôndria dos parasitas tratados. A análise por citometria de fluxo corroborou
os dados de MET revelando alterações em mitocôndrias (perda do potencial de
membrana mitocondrial) do T. cruzi frente ao tratamento com esta diamidina.
Por outro lado, ensaios de fluorescência revelaram que algumas amidinas
localizam-se no núcleo e na mitocondria, e que embora houvesse maior
acúmulo na última estrutura, não foi observada correlação entre acúmulo e
eficácia tripanocida.
107
Conclusões
7. Ensaios in vivo conduzidos frente infecção aguda experimental por T. cruzi
(cepa Y) mostram que DB1362 reduziu parcialmente a carga parasitária, o que
reverteu alterações elétricas cardíacas e mortalidade induzida pela infecção.
8. Dados in vivo, com a AIA DB1965 conduzidos frente infecção aguda
experimental por T. cruzi (cepa Y) mostram supressão da parasitemia e
proteção (90-100%) contra mortalidade, com semelhante eficácia que Bz. Esta
AIA protegeu contra lesões hepáticas e musculares induzidas pela infecção.
Embora DB1965 e Bz não tenham induzido cura parasitológica, possivelmente
devido aos protocolos de alta estringência utilizados (tratamento até 10 dias),
nossos dados confirmam a promissora atividade das AIAs, com ≥ eficácia in
vivo que a droga de referência utilizada na clínica para doença de Chagas
9. Na terapia combinada o uso de doses sub-ótimas de Bz (p.o.) associadas a
DB1965 (ip) por 20 dias consecutivos, apesar de não induzir cura
parasitológica, resultou na supressão de parasitemia e 100% de proteção
sobre mortalidade, estimulando a continuidade de ensaios pré-clínicos com
outras AIAs visando identificação de novos fármacos para a doença de
Chagas.
108
Referências Bibliográficas
REFERÊNCIAS
BIBLIOGRÁFICAS
109
Referências Bibliográficas
6. REFERÊNCIAS BIBLIOGRÁFICAS
Amato Neto V. 1999. Etiological treatment for infection by Trypanosoma cruzi.
Mem Inst Oswaldo Cruz 94 Suppl 1:337-339.
Apt W. 2010. Current and developing therapeutic agents in the treatment of
Chagas disease. Drug Des Devel Ther. 24;4:243-253.
Arafa RK, Brun R, Wenzler T, Tanious FA, Wilson WD, Stephens CE, Boykin
DW. 2005. Synthesis, DNA affinity, and antiprotozoal activity of fused ring dicationic
compounds and their prodrugs. J Med Chem. 48(17):5480-5488.
Araújo A, Jansen AM, Reinhard K, Ferreira LF. 2009. Paleoparasitology of
Chagas disease--a review. Mem Inst Oswaldo Cruz. 104 Suppl 1:9-16.
Barrett MP, Burchmore RJ, Stich A, Lazzari JO, Frasch AC, Cazzulo JJ, Krishna
S. 2003. The trypanosomiases. Lancet 362:1469-1480
Batista D da G, Batista MM, de Oliveira GM, do Amaral PB, Lannes-Vieira J,
Britto CC, Junqueira A, Lima MM, Romanha AJ, Sales Junior PA, Stephens CE,
Boykin
DW,
Soeiro
Mde
N.
2010a.
Arylimidamide
DB766,
a
potential
chemotherapeutic candidate for Chagas' disease treatment. Antimicrob Agents
Chemother. 54(7):2940-2952.
Batista DGJ, Pacheco MGO, Kumar A, Branowska D, Ismail M, Hu L, Boykin
DW, Soeiro MN. 2010b. Biological, ultrastructural effect and subcellular localization
of aromatic diamidines in Trypanosoma cruzi. Parasitology. 137(2):251-259
Batista DGJ, Silva PB, Stivanin L, Lachter DR, Silva RS, Felcman J, Louro SR,
Teixeira LR, Soeiro MNC. 2011a. Co(II), Mn(II) and Cu(II) complexes of
fluorquinolones: synthesis, spectroscopical studies and biological evaluation against
Trypanosoma cruzi. Polyhedron 30: 1718–1725
Batista DGJ, Batista MM, Oliveira GM, Britto CC, Rodrigues ACM, Stephens
CE, Boykin DW, Soeiro MNC. 2011b. Treatment of Heterocyclic Analogues and
Benznidazole upon Trypanosoma cruzi in vivo. Plos one. In press.
110
Referências Bibliográficas
Beyrer C, Villar JC, Suwanvanichkij V, Singh S, Baral SD, Mills EJ. 2007.
Neglected diseases, civil conflicts, and the right to health. Lancet. 370(9587):619627.
Blum J, Hatz C, Junghanss T. 1994. The therapy of cutaneous and
mucocutaneous leishmaniasis. Dtsch Med Wochenschr. 119(34-35):1169-1172.
Bonney KM, Taylor JM, Daniels MD, Epting CL, Engman DM. 2011. Heat-killed
Trypanosoma cruzi induces acute cardiac damage and polyantigenic autoimmunity.
PLoS One. 6(1):e14571.
Bray PG, Barrett MP, Ward SA, de Koning HP. 2003. Pentamidine uptake and
resistance in pathogenic protozoa: past, present and future. Trends in Parasitology
19:232-239.
Brener Z. 1973. Biology of Trypanosoma cruzi. Annu Rev Microbiol 27: 347-382.
Buckner FS, Navabi N. 2010. Advances in Chagas disease drug development:
2009-2010. Curr Opin Infect Dis. 23(6):609-616.
Carter NS, Berger BJ, Fairlamb AH. 1995. Uptake of diamidine drugs by the P2
nucleoside transporter in melarsen-sensitive and -resistant Trypanosoma brucei
brucei. The Journal of Biological Chemistry 270:28153-28157.
Castro JA, de Mecca MM, Bartel LC. 2006. Toxic side effects of drugs used to
treat Chagas' disease (American trypanosomiasis). Hum Exp Toxicol. 25(8):471-479.
Chatelain E, Ioset JR. 2011. Drug discovery and development for neglected
diseases: the DNDi model. Drug Des Devel Ther. 5:175-181.
Chiari E, Oliveira AB, Prado MA, Alves RJ, Galvão LM, Araujo FG. 1996.
Potential use of WR6026 as prophylaxis against transfusion-transmitted American
trypanosomiasis. Antimicrob Agents Chemother. Mar;40(3):613-615
Clayton J. 2010a. Chagas disease: pushing through the pipeline. Nature: S12S15.
Clayton J. 2010b. Chagas disease 101. Nature. S4-S5.
111
Referências Bibliográficas
Cortes HC, Muller N, Boykin D, Stephens CE, Hemphill A. 2011. In vitro effects
of arylimidamides against Besnoitia besnoiti infection in Vero cells. Parasitology.
2011 Apr;138(5):583-592.
Coura JR, Viñas PA. 2010. Chagas disease: a new worldwide challenge.
Nature Outlooks 465 (7301 suppl):S6-S7.
Coura JR, Borges-Pereira J. 2010. Chagas disease: 100 years after its
discovery. A systemic review. Acta Trop. 115(1-2):5-13.
Coura JR, Dias JCP. 2009. Epidemiology, control and surveillance of Chagas
disease - 100 years after its discovery. Mem Inst Oswaldo Cruz. 104 (Suppl 1): 3140.
Coura JR. 2009. Present situation and new strategies for Chagas disease
chemotherapy: a proposal. Mem Inst Oswaldo Cruz. 104(4):549-54.
Da Silva CF, Batista MM, Batista Dda G, de Souza EM, da Silva PB, de Oliveira
GM, Meuser AS, Shareef AR, Boykin DW, Soeiro Mde N. 2008. In vitro and in vivo
studies of the trypanocidal activity of a diarylthiophene diamidine against
Trypanosoma cruzi. Antimicrob Agents Chemother.52(9):3307-3314.
Da Silva CF, da Silva PB, Batista MM, Daliry A, Tidwell RR, Soeiro Mde N.
2010. The biological in vitro effect and selectivity of aromatic dicationic compounds
on Trypanosoma cruzi. Mem Inst Oswaldo Cruz.105(3):239-245.
Da Silva CF, Junqueira A, Lima MM, Romanha AJ, Sales Junior PA, Stephens
CE, Som P, Boykin DW, Soeiro Mde N. 2011a. In vitro trypanocidal activity of
DB745B and other novel arylimidamides against Trypanosoma cruzi. J Antimicrob
Chemother. 66(6):1295-1297.
Da Silva CF, Daliry A, Silva PB, Boykin DW, Soeiro MNC. 2011b. The Efficacy
of Arylimidamides Against Trypanosoma cruzi in vitro. Submetido: Parasitology.
Da Silva CF, Batista DGJ, Oliveira GM, De Souza EM, Hammer ER, Silva PB,
Daliry A, Siciliano JA, Stephens CE, Som P, Britto CC, Boykin DW, Soeiro MNC. In
vitro and In vivo Investigation of Amidine DB1965 Efficacy Against Trypanosoma
cruzi Infection. Submetido: International Journal of Parssitology..
112
Referências Bibliográficas
Daliry A, Da Silva PB, Da Silva CF, Batista MM, De Castro SL, Tidwell RR,
Soeiro Mde N. 2009. In vitro analyses of the effect of aromatic diamidines upon
Trypanosoma cruzi. J Antimicrob Chemother.64(4):747-750.
De Almeida EA, Silva EL, Guariento ME, Aoki FH, Pedro Rde J. 2009.
Aetiological treatment with itraconazole or ketoconazole in individuals with
Trypanosoma cruzi/HIV co-infection. Ann Trop Med Parasitol 103(6):471-476.
de Koning HP. Transporters in African trypanosomes: role in drug action and
resistance. Int J Parasitol. 2001 May 1;31(5-6):512-522.
De Souza EM, Lansiaux A, Bailly C, Wilson WD, Hu Q, Boykin DW, Batista MM,
Araújo-Jorge TC, Soeiro MN. 2004. Phenyl substitution of furamidine markedly
potentiates its antiparasitic activity against Trypanosoma cruzi and Leishmania
amazonensis. Biochem Pharmacol 68:593-600.
De Souza EM, Menna-Barreto R, Araújo-Jorge TC, Kumar A, Hu Q, Boykin DW,
Soeiro, MNC. 2006a. Antiparasitic activity of aromatic diamidines is related to
apoptosis-like death in Trypanosoma cruzi. Parasitology 133:75-79.
De Souza EM, Oliveira GM, Boykin DW, Kumar A, Hu Q, Soeiro MNC. 2006b.
Trypanocidal activity of the phenyl-substituted analogue of furamidine DB569 against
Trypanosoma cruzi infection in vivo. J Antimicrob Chemother 58:610-614.
De Souza EM, Oliveira GM, Soeiro MNC. 2007. Electrocardiographic finding in
acutely and chronically Trypanosoma cruzi-infected mice treated by a phenylsubstituted analogue of Furamidine DB569. Drug Target Insight 2: 61-69.
De Souza EM, Nefertiti AS, Bailly C, Lansiaux A, Soeiro MN. 2010. Differential
apoptosis-like cell death in amastigote and trypomastigote forms from Trypanosoma
cruzi-infected heart cells in vitro. Cell Tissue Res. 341(1):173-180.
De Souza EM, da Silva PB, Nefertiti AS, Ismail MA, Arafa RK, Tao B, NixonSmith CK, Boykin DW, Soeiro MN. 2011. Trypanocidal activity and selectivity in vitro
of aromatic amidine compounds upon bloodstream and intracellular forms of
Trypanosoma cruzi. Exp Parasitol. 127(2):429-35.
113
Referências Bibliográficas
De Souza, W. 1984. Cell biology of Trypanosoma cruzi. Int Rev Cytol 86:197283.
De Souza W. 1999. A Short Review on the Morphology of Trypanosoma cruzi:
from 1909 to 1999. Mem Inst Oswaldo Cruz. 94: 17-36,
De Souza W, Carreiro IP, Miranda K, Silva NL. 2000. Two special organelles
found in Trypanosoma cruzi. An Acad Bras Cienc. 72(3):421-432
De Souza W, de Carvalho TM, Barrias ES. 2010. Review on Trypanosoma
cruzi: Host Cell Interaction. Int J Cell Biol.2010. pii: 295394
Dias JC. 2006. The treatment of Chagas disease (South American
trypanosomiasis). Ann Intern Med 144:772-774.
Dias JC. 2007. Southern Cone Initiative for the elimination of domestic
populations of Triatoma infestans and the interruption of transfusion Chagas disease:
historical aspects, present situation, and perspectives. Mem Inst Oswaldo Cruz.
102:11-18.
Dias JC. 2009. Elimination of Chagas disease transmission: perspectives. Mem
Inst Oswaldo Cruz.104 Suppl 1:41-45
Filardi LS, Brener Z. 1987. Susceptibility and natural resistance of Trypanosoma
cruzi strains to drugs used clinically in Chagas Disease. Trans R Soc Trop Med Hyg
81, 755-759.
Fiorelli AI, Santos RH, Oliveira JL Jr, Lourenço-Filho DD, Dias RR, Oliveira AS,
da Silva MF, Ayoub FL, Bacal F, Souza GE, Bocchi EA, Stolf NA. 2011. Heart
transplantation in 107 cases of Chagas' disease. Transplant Proc. 43(1):220-224.
Franco-Paredes C, Bottazzi ME, Hotez PJ. 2009. The unfinished public health
agenda of chagas disease in the era of globalization. PLoS Negl Trop Dis. 3(7):e470
Fusai T, Boulard Y, Durand R, Paul M, Bories C, Rivollet D, Astier A, Houin R,
Deniau M. 1997. Ultrastructural changes in parasites induced by nanoparticle-bound
pentamidine in a Leishmania major/mouse model. Parasite. 4: 133-139.
114
Referências Bibliográficas
Gutierrez FR, Guedes PM, Gazzinelli RT, Silva JS. 2009. The role of parasite
persistence in pathogenesis of Chagas heart disease. Parasite Immunol. 31(11):673685.
Hentzer B, Kobayasi T. 1977. The ultrastructural changes of Leishmania tropica
after treatment with pentamidine. Ann. Trop. Med. Parasitol. 71:157-166.
Higuchi ML, Benvenuti LA, Martins-Reis M, Metzger M. 2003. Pathophysiology
of the heart in Chagas' disease: current status and new developments. Cardiovasc.
Res. 60:96-107.
Hu L, Arafa RK, Ismail MA, Patel A, Munde M, Wilson WD, Wenzler T, Brun R,
Boykin DW. 2009. Synthesis and activity of azaterphenyl diamidines against
Trypanosoma brucei rhodesiense and Plasmodium falciparum. Bioorg Med Chem.
17(18):6651-6658.
Ismail MA, Arafa RK, Brun R, Wenzler T, Miao Y, Wilson WD, Generaux C,
Bridges A, Hall JE, Boykin DW. 2006. Synthesis, DNA affinity, and antiprotozoal
activity of linear dications: Terphenyl diamidines and analogues. J. Med. Chem.
49:5324-5332.
Ismail MA, Bialy SA, Brun R, Wenzler T, Nanjunda R, Wilson WD, Boykin DW.
2011. Dicationic phenyl-2,2'-bichalcophenes and analogues as antiprotozoal agents.
Bioorg Med Chem. 19(2):978-84
Jannin J, Villa L. 2007. An overview of Chagas disease treatment. Mem Inst
Oswaldo Cruz. 102:95-97.
Lanteri CA, Stewart ML, Brock JM, Alibu VP, Meshnick SR, Tidwell RR, Barrett
MP. 2006. Roles for the Trypanosoma brucei P2 transporter in DB75 uptake and
resistance. Mol. Pharmacol. 70:1585-1592.
Machado FS, Tanowitz HB, Teixeira MM. 2010. New drugs for neglected
infectious diseases: Chagas' disease. Br J Pharmacol.160(2):258-259
Marin-Neto JA, Rassi A Jr. 2009. Update on Chagas heart disease on the first
centenary of its discovery. Rev Esp Cardiol. 62(11):1211-1216.
115
Referências Bibliográficas
Marino AP, Silva AA, Santos PV, Pinto LM, Gazinelli RT, Teixeira MM, LannesVieira J. 2005. CC-chemokine receptors: a potential therapeutic target for
Trypanosoma cruzi-elicited myocarditis. Mem Inst Oswaldo Cruz. 1:93-96.
Mathis AM, Holman JL, Sturk LM, Ismail MA, Boykin DW, Tidwell RR, Hall JE.
2006. Accumulation and intracellular distribution of antitrypanosomal diamidine
compounds DB75 and DB820 in African trypanosomes. Antimicrobial Agents and
Chemotherapy 50:2185-2191.
Mathis AM, Bridges AS, Ismail MA, Kumar A, Francesconi I, Anbazhagan M, Hu
Q, Tanious FA, Wenzler T, Saulter J, Wilson WD, Brun R, Boykin DW, Tidwell RR,
Hall JE. 2007. Diphenyl furans and aza analogs: effects of structural modification on
in vitro activity, DNA binding, and accumulation and distribution in trypanosomes.
Antimicrob Agents Chemother 51:2801-2810.
Maya JD, Cassels BK, Iturriaga-Vásquez P, Ferreira J, Faúndez M, Galanti N,
Ferreira A, Morello A. 2007. Mode of action of natural and synthetic drugs against
Trypanosoma cruzi and their interaction with the mammalian host. Comp Biochem
Physiol A Mol Integr Physiol 146(4):601-620.
Maya JD, Orellana M, Ferreira J, Kemmerling U, López-Muñoz R, Morello A.
2010.
Chagas
disease:
Present
status
of
pathogenic
mechanisms
and
chemotherapy. Biol Res. 43(3):323-331
Moncayo A, Silveira AC. 2009. Current epidemiological trends for Chagas
disease in Latin America and future challenges in epidemiology, surveillance and
health policy. Mem Inst Oswaldo Cruz. 104: 17-30.
Moraes-Souza
H,
Ferreira-Silva
MM.
2011.
Control
of
transfusional
transmission. Rev Soc Bras Med Trop. 44 Suppl 2:64-67.
Muñoz MJ, Murcia L, Segovia M. 2011. The urgent need to develop new drugs
and tools for the treatment of Chagas disease. Expert Rev Anti Infect Ther. 9(1):5-7.
Nguyen B, Hamelberg D, Bailly C, Colson P, Stanek J, Brun R, Neidle S, Wilson
WD. 2004. Characterization of a novel DNA minor-groove complex. Biophys J.
86(2):1028-1041.
116
Referências Bibliográficas
Nwaka S, Hudson A. 2006. Innovative lead discovery strategies for tropical
diseases. Nat Rev Drug Discov 5(11): 941-955.
Oliveira Jr W. 2009. All-around care for patients with Chagas disease: a
challenge for the XXI century. Mem Inst Oswaldo Cruz. 104 Suppl 1:18118-6.
Pacheco MG, Silva CF, Souza EM, Batista MM, Silva PB, Kumar A, Stephens
CE, Boykin DW, Soeiro Mde N. 2009. Trypanosoma cruzi: Activity of heterocyclic
cationic molecules in vitro. Exp Parasitol 123(1): 73-80.
Parker ER, Sethi A. 2011. Chagas Disease: Coming to a Place Near You.
Dermatol Clin 29: 53–62
Pereira KS, Schmidt FL, Barbosa RL, Guaraldo AM, Franco RM, Dias VL,
Passos LA. 2010. Transmission of chagas disease (american trypanosomiasis) by
food. Adv Food Nutr Res. 59:63-85
Pinto Dias JC. 2006. The treatment of Chagas disease (South American
trypanosomiasis). Ann Intern Med. 144(10):772-774.
Rassi A, Luquetti AO, Rassi A Jr, Rassi GG, Rassi SG, DA Silva IG, Rassi AG.
2007. Specific treatment for Trypanosoma cruzi: lack of efficacy of allopurinol in the
human chronic phase of Chagas disease. Am J Trop Med Hyg 76(1):58-61
Rassi A Jr, Rassi A, Marin-Neto JA. 2010. Chagas disease. Lancet.
375(9723):1388-1402
Reisenman CE, Lawrence G, Guerenstein PG, Gregory T, Dotson E, Hildebrand
JG. 2010. Infection of kissing bugs with Trypanosoma cruzi, Tucson, Arizona, USA.
Emerg Infect Dis.16(3):400-405.
Remme JHF, Feenstra P, Lever PR, Medici AC, Morel CM, Noma M, Ramaiah
KD, Richards F, Seketeli A, Schminis, Van Brakel WH, Vassal A. 2006. Tropical
diseases
targeted
for
elimination:
Chagas
disease,
lymphatic
filariasis,
onchocerciasis, and leprosy. Disease Control Priorities in Developing Countries. 22:
433-447.
117
Referências Bibliográficas
Richard JV, Werbovetz KA. 2010. New antileishmanial candidates and lead
compounds. Opin Chem Biol. 14(4):447-455
Rocha MO, Teixeira MM, Ribeiro AL. 2007. An update on the management of
Chagas cardiomyopathy. Expert Rev Anti Infect Ther 5: 727-743.
Rodriques Coura J, de Castro SL. 2002. A critical review on Chagas disease
chemotherapy. Mem Inst Oswaldo Cruz. 97(1):3-24
Romanha AJ, Castro SL, Soeiro Mde N, Lannes-Vieira J, Ribeiro I, Talvani A,
Bourdin B, Blum B, Olivieri B, Zani C, Spadafora C, Chiari E, Chatelain E, Chaves G,
Calzada JE, Bustamante JM, Freitas-Junior LH, Romero LI, Bahia MT, Lotrowska M,
Soares M, Andrade SG, Armstrong T, Degrave W, Andrade Zde A. 2010. In vitro and
in vivo experimental models for drug screening and development for Chagas
disease. Mem Inst Oswaldo Cruz. 105(2):233-238
Rosypal AC, Tidwell RR, Lindsay DS. 2007. Prevalence of antibodies to
Leishmania infantum and Trypanosoma cruzi in wild canids from South Carolina. J
Parasitol. 93(4):955-957.
Rosypal AC, Werbovetz KA, Salem M, Stephens CE, Kumar A, Hall JE, Tidwell
RR. 2008. Inhibition by Dications of in vitro growth of Leishmania major and
Leishmania tropica: causative agents of old world cutaneous leishmaniasis. J
Parasitol 94(3):743-749.
Santa-Rita RM, Barbosa HS, Meirelles MN, De Castro SL. 2000. Effect of the
alkyl-lysophospholipids on the proliferation and differentiation of Trypanosoma cruzi.
Acta. Trop 75(2):219-228.
Santa-Rita RM, Barbosa HS, de Castro S. 2006. Ultrastructural analysis of
edelfosine-treated
trypomastigotes
and
amastigotes
of
Trypanosoma
cruzi.
Parasitology Research 100:187-200.
Schmunis GA. 2007. Epidemiology of Chagas disease in non endemic
countries: the role of international migration. Mem Inst Oswaldo Cruz 102 (Suppl 1):
75-85.
118
Referências Bibliográficas
Silva CF, Batista MM, Mota RA, de Souza EM, Stephens CE, Som P, Boykin
DW, Soeiro MdeN 2007a. Activity of "reversed" diamidines against Trypanosoma
cruzi in vitro. Biochem. Pharmacol 73: 1939-1946
Silva CF, Meuser MB, De Souza EM, Meirelles MN, Stephens CE, Som P,
Boykin DW, Soeiro MN. 2007b. Cellular effects of reversed amidines on
Trypanosoma cruzi. Antimicrob. Agents Chemother 51: 3803-3809.
Singh G, Dey CS. 2007. Induction of apoptosis-like cell death by pentamidine
and doxorubicin through differential inhibition of topoisomerase II in arsenite-resistant
L. donovani. Acta Trop. 103(3):172-185.
Soeiro Mde N, Dantas AP, Daliry A, Silva CF, Batista DG, de Souza EM,
Oliveira GM, Salomão K, Batista MM, Pacheco MG, Silva PB, Santa-Rita RM,
Barreto RF, Boykin DW, Castro SL. 2009. Experimental chemotherapy for Chagas
disease: 15 years of research contributions from in vivo and in vitro studies. Mem Inst
Oswaldo Cruz. 104 :301-10.
Soeiro MN, De Castro SL. 2009. Trypanosoma cruzi targets for new
chemotherapeutic approaches. Expert Opin Ther Targets 13 Suppl 1:105-121
Soeiro MNC, De Castro SL, De Souza EM, Batista DGJ, Silva CF, Boykin DW.
2008. Diamidine activity against trypanosomes: The state of the art. Curr, Mol,
Pharmacology. 1, 151-161.
Soeiro MN, De Souza EM, Stephens CE, Boykin DW. 2005. Aromatic
diamidines as antiparasitic agents. Expert Opin. Investig. Drugs 14, 957-972.
Stephens CE, Tanious F, Kim S, Wilson WD, Schell WA, Perfect JR, Franzblau
SG, Boykin DW. 2001. Diguanidino and “Reversed” Diamidino 2,5-Diarylfurans as
Antimicrobial Agents. J. Med. Chem, 44: 1741-1748.
Stephens CE, Brun R, Salem MM, Werbovetz KA, Tanious F, Wilson WD,
Boykin DW. 2003. The activity of diguanidino and 'reversed' diamidino 2,5diarylfurans versus Trypanosoma cruzi and Leishmania donovani. Bioorg Med Chem
Lett. 13(12):2065-2069.
119
Referências Bibliográficas
Steverding D, Tyler KM. 2005. Novel antitrypanosomal agents. Expert Opin
Investig Drugs 14:939-955.
Stoppani AO. 1999. The chemotherapy of Chagas disease. Medicina (B Aires)
59: 147-65.
Stuart K, Brun R, Croft S, Fairlamb A, Gürtler RE, McKerrow J, Reed S,
Tarleton R. 2008. Kinetoplastids: related protozoan pathogens, different diseases. J
Clin Invest 118(4): 1301-1310.
Secretaria
de
Vigilância
Sanitária
do
Brasil,
http://portal.saude.gov.br/portal/arquivos/pdf/apresentacaochagas.pdf.
2010.
acesso
em
maio 2011
Tidwell RR, Boykin DW. 2003. Minor groove binders as antimicrobial agents. In
Small molecule DNA and RNA binder: Synthesis to nucleic acid complexes. Ed.;
Wiley-VCH: New York, pp. 416-460.
Urbina JA, Docampo R. 2003. Specific chemotherapy of Chagas disease:
Controversies and advances. Trends Parasitol 19: 495-501.
Urbina JA. 2009. Ergosterol biosynthesis and drug development for Chagas
disease. Mem Inst Oswaldo Cruz 104: 311-318.
Villa L, Morote S, Bernal O, Bulla D, Albajar-Vinas P. 2007. Access to diagnosis
and treatment of Chagas disease/infection in endemic and non-endemic countries in
the XXI century. Mem Inst Oswaldo Cruz. 102:87-94.
Viotti R, Vigliano C, Lococo B, Alvarez MG, Petti M, Bertocchi G, Armenti A.
2009. Side effects of benznidazole as treatment in chronic Chagas disease: fears
and realities. Expert Rev Anti Infect Ther 7(2):157-163.
120
Referências Bibliográficas
Wang MZ, Zhu X, Srivastava A, Liu Q, Sweat JM, Pandharkar T, Stephens CE,
Riccio E, Parman T, Munde M, Mandal S, Madhubala R, Tidwell RR, Wilson WD,
Boykin DW, Hall JE, Kyle DE, Werbovetz KA. 2010. Novel arylimidamides for
treatment of visceral leishmaniasis. Antimicrob Agents Chemother. 54(6):2507-2516
Wegner DH, Rohwedder RW. 1972. The effect of nifurtimox in acute Chagas'
infection. Arzneimittelforschung 22:1624-1635.
Werbovetz K. 2006. Diamidines as antitrypanosomal, antileishmanial and
antimalarial agents. Curr. Opin. Investig. Drugs. 7: 147-157.
WHO. 2002. Control of Chagas disease. World Health Organ. Tech. Rep. Ser.
905, i-109.
WHO. 2007. Report of the Scintific Working Group on Chagas disease.
WHO. 2009. http://www.who.int/neglected_diseases/diseases/en/ acesso em
julho de 2009.
Wilson WD, Nguyen B, Tanious FA, Mathis A, Hall JE, Stephens CE, Boykin
DW 2005. Dications that target the DNA minor groove: compound design and
preparation, DNA interactions, cellular distribution and biological activity. Curr. Med.
Chem. Anticancer Agents 5:389-408.
Wilson WD, Tanious FA, Mathis A, Tevis D, Hall JE, Boykin DW. 2008.
Antiparasitic compounds that target DNA. Biochimie. 90:999-1014.
Wilkinson SR, Taylor MC, Horn D, Kelly JM, Cheeseman I. 2008. A mechanism
for cross-resistance to nifurtimox and benznidazole in trypanosomes. Proc Natl Acad
Sci U S A. 105(13):5022-5027
Yun O, Lima MA, Ellman T, Chambi W, Castillo S, Flevaud L, Roddy P, Parreño
F, Albajar Viñas P, Palma PP. 2009. Feasibility, drug safety, and effectiveness of
etiological treatment programs for chagas disease in honduras, guatemala, and
bolivia: 10-year experience of médecins sans frontières. PLoS Negl Trop Dis.
3(7):e488.
121