Download Induced Differential Expression of Tumor Markers in Neuroblastoma

Induced Differential Expression of Tumor Markers in
Neuroblastoma Variants
Torsten Hartwig
Biology Department, Fordham University, Bronx, NY 10458
[email protected]
Abstract
Human neuroblastoma (HN) is one of the most common solid cancers in infants and children. Tumors
contain three distinct cell types: N-type (neuroblastic), S-type (schwannian) and I-type
(intermediate phenotype) cells, which can differentiate predictably in response to certain
morphogens. The differentiated subtypes possess characteristic tumorigenicities and vary in
frequency in different stages of tumor progression. In our current study we investigate the
differential expression of two known tumor markers: hTERT (human telomerase reverse
transcriptase) and S100P, in RA (retinoic acid), BuDR (5-bromo-2-deoxyuridine) and untreated
neuroblastoma BE(2)-C cells. HTERT is the catalytic component of telomerase involved in
stabilizing the protective caps of chromosomes. It has an important role in cellular
immortalization and tumorigenisis, and is over-expressed in 90% of cancerous cells. HTERT is
highly expressed in HN, but the high hTERT expression levels have, as yet, not been linked to
the three neuroblastoma cell types. Our studies have shown that hTERT is a marker for the
tumorigenic N-type and I-type cells and can possibly indicate the presence of tumorigenic cells
in neuroblastoma tissues. S100P is a calcium binding protein that has recently been correlated
with tumor proliferation. It is over-expressed in lung, breast, colon and pancreatic cancer and
has been implicated with metastasis. It is considered a potential tumor marker and a target for
tumor diagnostics and therapy. We demonstrate that S100P may not be a tumor marker in
neuroblastoma tissues. Keywords: neuroblastoma, tumorigenic, telomerase, S100P
Introduction
Neuroblastoma is one of the most common solid cancers in infants and children under the age of
four (Ross et al. 2003). It originates from the developing neural crest of the peripheral nervous
system as well as in proximity to the adrenal gland. Each neuroblastoma is characterized by
cellular heterogeneity containing three cell types with distinctive morphologies, growth patterns,
and tumorigenicities. The most common cell type is the small, neuroblastic/neurite like N-type
cell which loosely attaches to the substrate. In contrast, the larger S-type cells are strongly
substrate adherent; resembling non-neuronal precursor cells. I-type (intermediate) cells express
features of both N-type and S-type cells. The I-type cells possess neuritic extensions and attach
well to the substrate or other cells. I-type cells are multi-potent stem cells which can be induced
to differentiate into N-type or S-type cells upon treatment with RA (retinoic acid) or BuDR (5bromo-2-deoxuridine) respectively (Ross et al. 2003). I-type cells express markers also found in
the other two cell types. However, no distinctive I-cell markers have yet been identified (Ross et
al. 2003). Colony-forming assays in soft agar and in vivo tumor assays have shown distinct
tumorigenicities between the three cell types. I-type cells are highly tumorigenic, N-type cells
are less tumorigenic, and S-type cells lack tumorigenicity. Correspondingly, I-type cells are
more frequent in tumors that progress and are correlated with a poor patient prognosis (Ross et
al. 2003). The exact cell type distribution, in different tumor stages, is currently being
investigated.
Human telomerase is a highly conserved ribonucleoprotein involved in the maintenance of
telomeres (protective caps at the ends of chromosomes) and consists of two components: a
catalytic 127kDa protein, hTERT (human telomerase reverse transcriptase), and its own RNA
template (hTR) (Shay et al. 2000). These components allow it to hybridize and progressively
extend the 3’ ends of telomeres; generating DNA of telomeric tandem repeats (TTAGGG)n
(Cong et al. 2002). Telomerase activity (TA) compensates for the “end-replication problem”
(shortening of chromosome ends during each cell division) (Cong et al. 2002). Cells lacking TA
iteratively lose 50-200 nucleotides of genomic DNA during each cell division and ultimately
enter senescence. Therefore, telomeres serve as molecular clocks that determine a cells
replicative ability (Shay et al. 1994). TA induced telomere stabilization thus allows cellular
immortalization and has been implicated as a rate limiting step in cancer development (Shay et
al. 2002). In humans, TA is restricted to germ cells and other highly proliferative tissues (Shay
et al. 2001). However, TA is found in 85% to 90% of human cancer specimens. The expression
of hTERT mRNA has been viewed as rate limiting for TA (Cong et al. 2002). Therefore, TA
and specifically hTERT are potential tumor markers and are considered for the development of
anticancer drugs.
S100P is a 95 amino acid member of the S100 family of calcium binding proteins. S100 proteins
function in calcium dependent signal transduction pathways and control the cell’s growth,
differentiation, metabolism and cell cycle (Parkkila et al. 2008). Recent studies have shown that
S100P is over-expressed in breast, colon, prostate, pancreatic and lung tumors (Parkkila et al.
2008). Although S100P appears to play different roles in the various cancer types, it ultimately
contributes to the tumorigenic potential (Parkkila et al. 2008). The protein is especially
pronounced in pancreatic cancer, where experiments with nude mice have shown a five fold
increase of tumor volume in its presence (Logsdon et al. 2005). In these studies S100P’s tumor
proliferating effect has been correlated to the activation of RAGE (Receptor for advanced
glycation end products). The activation of this receptor is suggested to be important for the
survival of RA treated neuroblastoma cells; via activation of anti-apoptotic protein Bcl-2
(Muench et al. 2002). In the current study, we investigate the role of hTERT and S100P as
potential tumor markers for neuroblastoma variants.
METHODS
Cell Lines
We analyzed BE(2)-C cell lines that were untreated (intermediate I-type phenotype), RA treated
(N-type), and BuDR treated (S-type). The cell lines were kindly provided by Dr. Ross. The
general culture medium consisted of a mixture of 45% Eagle’s Minimum Essential Medium with
non-essential amino acids, 45% Ham’s Nutrient Mix F12 (Invitrogen, Carlsbad, CA), and 10%
fetal bovine serum without antibiotics. The treatments were added to give a final concentration
of 8-10M in the mixture under the following conditions: Cells were treated for approximately
three months, RA treatment was consecutive, while BuDR treated cells were exposed to the
morphogen in two week intervals.
RNA Isolation
RNA was purified using the Promega kit according to the manufacturer’s protocol.
RT-PCR Amplification
Primers were created to amplify a 159bp product of hTERT cDNA or a 2639bp product from the
genomic DNA. The forward primer (5’-CTCTTCGACGTCTTCCTACG-3’) was designed to
hybridize to exon 8 from nucleotide #2468-2488, while the reverse primer
(5’-AATCCCCGCAAACAGCTTG-3’) spanned exon 9 from nucleotide #2608-2626 (Fig. 1A).
The S100P primers were designed to amplify a 240bp product of S100P cDNA or a 3062bp
product from genomic DNA. The forward primer (5’-TCAAGGTGCTGATGGAGAA-3’)
spanned exon 1 from nucleotide #114-134 and the reverse primer
(5’-ACACGATGAACTCACTGAA-3’) spanned exon 2 from nucleotide #3210-3062 (Figure
1B). A primer set for the housekeeping gene, GAPDH, was designed to amplify a 228bp
product. Reverse transcriptase PCR (RT-PCR) was run using 25 ng of RNA, 0.5 µl of each
primer (10 pmol/µl), 1 µl dNTPs, 1 µl enzyme mix, 5 µl 5X reaction buffer and 12 µl dH2O.
The RT-PCR was run under the following conditions: one cycle of 50˚C for 30 minutes and 95˚C
for 15 minutes, followed by 45 cycles of 94˚C for 30 seconds, 55˚C for 30 seconds, 72˚C for 30
seconds, and a final extension at 72˚C for 10 minutes. GAPDH was amplified using 30 and 28
cycles while maintaining the aforementioned conditions. The negative control was carried out in
the absence of an RNA template. RT-PCR products were separated on a 2% agarose gel and
purified with a Promega kit. Fragment sizes were determined using 5µl of a 100bp marker.
Data Analysis
The observed bands for S100P and hTERT were analyzed using the Sigma Gel analysis program.
The band intensity was examined by scanning each band and normalizing it to the respective
GAPDH band, to control for the added amount of PCR product. To evaluate the treatments
effect, normalized values were used to determine the fold change in expression level between
treated and untreated cells.
Results
Expression of hTERT in three Neuroblastoma Cell Lines
Using RT-PCR analysis, the hTERT mRNA expression was studied in RA treated (N-type),
BuDR treated (S-type), and untreated (I-type) BE(2)-C cells. Equal amounts of the PCR
products were loaded on a 2% gel. The reaction was repeated three times for each cell line under
the same conditions (see methods). The predicted 159bp amplification product was observed in
N-type and I-type cells, but not in S-type cells (Fig. 2a). The gene products were blasted against
NCBI’s nucleotide database (Fig. 3a). The BLAST results confirmed that the amplified product
(labeled hTERT) corresponded to hTERT sequences on file (labeled NM 198233.2) with 99%
accuracy. Data analysis of the band intensity (Sigma Gel analysis program) revealed a 1.7 fold
decrease (standard error of 0.02) in N-type as compared to the I-type hTERT mRNA expression.
In S-type cells, no significant hTERT mRNA expression was observed (Fig. 4).
A
B
Gene
Orientation
Sequence 5'->3'
Position
HTERT
Forward
CTCTTCGACGTCTTCCTACG
2468-2488
HTERT
Reverse
AATCCCCGCAAACAGCTTG
2608-2626
S100P
Forward
TCAAGGTGCTGATGGAGAA
114-134
S100P
Reverse
ACACGATGAACTCACTGAA
F
B.) S100P
Genomic DNA
159 bp
2639bp
240bp
3062bp
3210-3230
2480bp
EXON 8
A.) hTERT
Size of mRNA
EXON 9
R
F
EXON 1
2822bp
EXON 2
R
Figure 1. Primer sequences and position on genomic DNA for hTERT (A) and S100P (B).
Primer set (A) spanned exons 8 and 9 of the cDNA for hTERT. In between these two exons there
is a 2480bp intron in the genomic DNA. The primer set amplifies a 159bp product. Primer set
(B) spanned regions of exons 1 and 2 in S100P cDNA, flanking a 2822bp intron in the genomic
DNA. The primer amplifies a 240bp product.
Treatment induced fold change in hTERT mRNA expression of BE (2)-C cells
Treated/Untreated
1.20
I-type
1.00
0.80
0.60
0.40
N-type
1
0.59
0.20
S-type
0
0.00
RA
BuDR
Untreated
Treatment
Treatment induced fold change in S100P mRNA expression of BE (2)-C cells
120.00
S-type
Treated/Untreated
100.00
80.00
60.00
N-type
40.00
20.00
92
35
1
0.00
RA
BuDR
Treatment
Untreated
Figure 4. Treatment induced fold changes in expression of hTERT and S100P.
Sigma Gel scanning analysis was used to compare the band intensities. The values were
standardized to the GAPDH control and are presented relative to expression levels in
untreated cells.
Expression of S100P in Three Neuroblastoma Cell Lines
The RT-PCR products were loaded on a 2% agarose gel. The reaction was repeated three times
under the same conditions (refer to methods). The predicted 240bp product (Fig. 1) was
observed in BuDR treated (N-type) and RA treated (S-type cells), while very low amounts were
present in the untreated (I-type cells) (Fig. 2b). The products were sequenced and blasted against
NCBI’s nucleotide database. The blast results confirmed that the RT-PCR product (labeled
S100P) matched S100P sequences on file (labeled NM_005980.2) with 99% accuracy.
Evaluation of the band intensities (Sigma Gel analysis program) revealed a 35 fold expression
increase in N-type cells (standard error of 12) and a 92 fold increase in S-type cells (standard
error of 17) (Fig. 4).
Discussion
Neuroblastoma tumors commonly contain three phenotypically and tumorigenically distinct cell
lines which can be predictably differentiated upon treatment with certain morphogens. These cell
lines include the weakly tumorigenic, immortal, neuroblastic (N-type) cells; schwann cell like,
non-tumorigenic (S-type) cells and highly tumorigenic intermediate phenotype (I-type) cells
(Ross et al. 2004). Corresponding to their distinct characteristics these cell lines show different
gene expression patterns.
hTERT
Our results for the expression of hTERT mRNA revealed a treatment induced down regulation of
hTERT (fig. 2a). While untreated I-type cells showed the highest expression level, a 1.7 fold
decrease was observed upon treatment with RA (N-type), whereas BuDR treatment (S-type)
appeared to cease hTERT expression.
These findings are consistent with previous results in regard to telomerase’s role in cellular
immortalization and tumorigenisis. Telomerases’ telomere stabilizing ability allows cells to
escape senescence and gain unlimited proliferative potential (Cong et al. 2002). Furthermore
telomere maintenance has been considered essential for attainment of immortality in cancer cells
and is generally thought of as a critical step in cancer progression (Shay et al. 2001). Since the
S-type cells used in our study did not express telomerase, they are expected to undergo
replicative senescence after multiple rounds of cell division. The S-type cells’ mortal status was
confirmed in correspondence with Dr. Ross. The expression of telomerase in N-type and I-type
cells possibly enables their tumor characteristic unlimited proliferative potential. Thus, presence
of telomerase appears to be an indicator of proliferative status in BE(2)-C neuroblastoma cell
lines.
The expression levels of hTERT mRNA appear to be positively correlated to the investigated cell
types’ tumorigenic potential. Highly tumorigenic I-type cells show high expression levels,
intermediately tumorigenic cells have lowered expression levels, and non-tumorigenic S-type
cells lack hTERT expression. The relationship between hTERT expression and tumorigenicity
corresponds to studies indicating a pro-tumorigenic effect of telomerase (Chang et al. 2002).
Telomerase has been suggested to cooperate with oncogenes, inactivate tumor suppressor genes.
(Chang et al. 2002) The elevated levels of telomerase in N-type and I-type cells thus potentially
contribute to the cells high tumorigenicities.
Taken together these results suggest that hTERT can function as a tumor marker in
neuroblastoma BE(2)-C cells. In addition hTERT can possibly distinguish between different
degrees of tumorigenicity, as well as indicate a cells proliferative status. Further studies should
directly investigate the telomerase activity via the TRAP assay (Telomerase repeat amplification
protocol assay) and determine if other neuroblastoma cell lines show similar results.
S100P
In addition to the observance of hTERT expression the current study also investigated the effects
of the mentioned treatments on S100P expression. Other than in the case of hTERT, the
treatments appear to up regulate the S100P mRNA expression. While untreated I-cells showed
very low expression levels, RA treatment (N-type) caused a 35 fold increase in S100P expression
and BuDR treatment (S-type) resulted in a 92 fold increase. These observations were
unexpected and did not correspond to previous studies. It has been shown that S100P can
possibly function as a potential tumor marker given its over-expression in several cancers and
highly stable structure (Higgins et al. 2007). Our results seem to suggest the opposite, as the
mRNA expression level appears to be negatively related to the respective cell lines’
tumorigenicity. The most tumorigenic I-type cells show the lowest expression levels, the nontumorigenic S-type cells show the highest, and intermediately tumorigenic cells show
intermediate expression levels. Thus, S100P can not be considered as a tumor marker in
neuroblastoma cell lines. The up regulated expression of S100P in N-type cells can possibly be
related to its suggested role as an activator of RAGE (receptor for advanced glycation end
products). Studies on the involvement of S100P in the proliferation of pancreatic cancers have
shown that blocking of the S100P interaction with RAGE stopped the S100P induced effects
( Logsdon 2005). In relation to neuroblastoma, RAGE has been implicated with RA induced
differentiation (N-type) of neuroblastoma cells. The activation of RAGE has been suggested to
play an important role in N-type cell survival (Muench 2002). Thus the observed up regulation
of S100P in RA treated cells is possibly linked to an autocrine function. Moreover, S100P could
possibly be secreted and activate RAGE on the cell membrane of N-type cells. However, our
studies are based on just one experiment and we cannot, therefore, verify these claims. Further
studies need to be conducted regarding S100P functional mechanism to understand reasons for
its suggested up regulation in RA and BuDR treated I-type cells of the BE(2)-C cell line.
In sum, S100P is not a potential tumor marker in neuroblastoma tissues but may be related to the
differentiation of N-type cells.
Acknowledgements
I thank Leleesha Samarawera and Bo Liu for their continuous help and patience and Jinsong Qiu
for his positive mentality and late hours. Additional thanks to Dr. Robert A. Ross for providing
me with the cell lines and helpful advice. Sincere thanks to Dr. Berish Rubin for pushing me to
do my best and providing me with the opportunity to pursue this project.
References
Biedler J.L., Spengler B.A., Ross R.A. 1997. Human Neuroblastoma Cell Differentiation.
Principles and Practice of Genitourinary Oncology. Philadelphia:
Lippincott-Raven Publishers.
Chang S., DePinho A. 2002. Telomerase extracurricular activities. PNAS 20: 12520-12522
Cong Y., Wright W.E., Shay J.W. 2002. Human Telomerase and Its Regulation. Microbiol. Mol.
Biol. Rev. 66: 407-425.
Herbert M., Shea B, Wright W.E., Shay J.W. 2001. Telomerase and Breast Cancer. Breast
Cancer Research 3: 146-149.
Higgins J.P., Kaygusuz G., Wang L., Montgomery K., Mason V., Zhu S.X., Marinelli R.J., Presti
J.C., van de Rijn M., Brooks J.D. 2007. Placental S100(S100P) and GATA3: markers for
transitional epithelium and urothelial carcinoma discovered by complementary microarray. Am J
Surg Pathol 31:673-680
Hiyama E., Hiyama K., Yokoyama T., Shay J.W. 2000. Immunohistochemical Detection of
Telomerase in Human Cancer Tissues and a Subset of Cells in Normal Tissues. Nature 3: 17-26
Logsdon C.D., Arumugam T., Simeone D.M., Van Golen K. 2005. S100P Promotes Pancreatic
Cancer Growth, Survival, and Invasion. Human Cancer Biology
Muench G., Rauvala H., Huttunen H., Sajithlal G. 2002. Receptor for Advanced Glycation End
Products Plays a More Important Role in Cellular Survival than in Neurite Outgrowth during
Retinoic Acid-induced Differentiation of Neuroblastoma Cells. J.Biol.Chem., 9:6888-6897
Parkkila S., Pan P., Ward A., Gibadulinova A., Oveckova I., Pastorekova S., Pastorek J.,
Martinez A.R., Helin H., Isola J. 2008. The Calcium-Binding Protein S100P in Normal and
Malignant Human Tissues. BMC clinical Pathology 8:2
Ross R.A., Biedler J.L., Spengler B.A. 2003. A role for distinct cell types in determining
malignancy in human neuroblastoma cell lines and tumors. Cancer Letters, 197(1-2),
35-9.