Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Gene regulation Positive vs. negative control Positive control: A protein binds to DNA and transcription increases mRNA 5’ 3’ CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 Activator Negative control: A protein binds to DNA and transcription decreases 5’ 3’ X mRNA CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 Repressor The lac operon What is an operon? A collection of genes that are transcribed together and often have a related function (in this case lactose metabolism). Lactose The lac operon: negative regulation Promoter DNA covered by RNA polymerase 5’ 3’ LacI X mRNA CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 DNA covered by repressor Operator Without lactose, LacI binds to the operator, which prevents RNA polymerase from binding to the promoter The lac operon: negative regulation Promoter DNA covered by RNA polymerase 5’ 3’ LacI X mRNA CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 DNA covered by repressor LacI Operator + Lactose If lactose is added, it binds LacI and stabilizes the LacI conformation that doesn’t bind to the operator. The lac operon: negative regulation Promoter DNA covered by RNA polymerase mRNA 5’ 3’ CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 DNA covered by repressor LacI Operator When LacI is not bound to the operator, the promoter binding site is not occluded. Keq of DNA binding The graph to the right shows two curves that represent binding of LacI to the operator with and without lactose. 100 % DNA bound Which curve has a higher Keq for binding to DNA? 50 0 [LacI] The red curve Operator DNA + LacI [O] [O − R] Keq = O [R] = 1 R [R] Keq LacI/Operator Complex [O-R] Keq for binding is inversely related to the concentration of LacI at which 50% of the DNA is bound Keq of DNA binding The graph to the right shows two curves that represent binding of LacI to the operator with and without lactose. Which curve represents binding of LacI without lactose? Higher Keq 100 % DNA bound Lower Keq 50 0 [LacI] The red curve – LacI has a higher affinity for DNA when lactose is absent. The lac operon: positive regulation Dissociation of LacI from the operator is not sufficient to activate transcription of the lac operon, it also requires positive regulation. CAP Binding Site Promoter mRNA 5’ 3’ CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 Why is positive regulation necessary? The lac promoter -10 and -35 regions poorly match the consensus sequence, and RNA polymerase binds poorly to them. Operator The lac operon: positive regulation CAP, the activator, can only bind to the DNA when cAMP levels are high. This only occurs when glucose levels are low. CAP Binding Site 5’ 3’ Promoter mRNA CAP CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 Operator CAP + cAMP The lac operon: positive regulation CAP, the activator, can only bind to the DNA when cAMP levels are high. cAMP levels are high when glucose levels are low. CAP Binding Site 5’ 3’ Promoter mRNA CAP CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT GTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGA | | | -35 -10 +1 Operator CAP binding to the CAP binding site helps recruit RNA polymerase, allowing it to bind to the -35 and -10 sites that poorly match the consensus sequence. Electrophoretic mobility shift assays (EMSA) The affinity of a certain repressor for binding to its operator site is affected by the presence of molecule “A.” Given these EMSA data, would the addition of molecule A increase or decrease transcription of the gene controlled by this repressor? Without molecule A: Keq = 109 With molecule A: Keq = 1011 The affinity of the repressor for DNA is higher for higher when molecule A is present. The addition of molecule A would increase repressor binding to DNA, decreasing transcription. [repressor] 10-12 10-11 10-10 10-9 10-8 [DNA] Constant without molecule A [repressor] 10-12 10-11 10-10 10-9 10-8 [DNA] with molecule A Constant The lac operon Glucose -10 Region CAP-Binding Site LacZ RNA Polymerase Operon LacI cAMP -35 Region Consensus Sequence Lactose Repressor CAP Activator Promoter Operator The lac operon: a concept map prevents LacI binding to the operator Lactose encodes the genes needed to use Is a Repressor LacI binds to a site in the DNA called the lac Operon negatively regulates Operator positively regulates Binds to a site in the DNA called the Glucose Promoter comprise CAP CAP Binding Site encodes LacZ DNA that promotes transcription of is an Activator used to metabolize binds -10 Region -35 Region RNA Polymerase binds binds Mediates CAP binding to DNA cAMP cAMP is produced when glucose is depleted Consensus Sequence Ideal -10/-35 sequences to which RNA polymerase binds best