Download Expression and characterization of RNA-dependent

BMB
reports
Expression and characterization of RNA-dependent RNA
polymerase of Ectropis obliqua virus
Meijuan Lin, Shan Ye, Yi Xiong, Dawei Cai, Jiamin Zhang & Yuanyang Hu*
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei Province 430072, China
Replication of positive-strand RNA virus is mediated by a virus-encoded RNA-dependent RNA polymerase (RdRp). To
study the replication of Ectropis obliqua virus (EoV), a newly
identified insect virus belonging to the family Iflaviradae, we
expressed the RNA polymerase domain in Escherichia coli and
purified it on a Ni-chelating HisTrap affinity column. It is demonstrated that EoV RdRp initiated RNA synthesis in a primerand poly (A)-dependent manner in vitro. Furthermore, the ef2+
fect of primer concentration, temperature, metal ions (Mg ,
2+
+
Mn , and K ) on enzymatic activity were determined. Our
study represented a first step towards understanding the mechanism of EoV replication. [BMB reports 2010; 43(4): 284-290]
INTRODUCTION
Ectropis obliqua virus (EoV) is an insect RNA virus that causes
a lethal granulose infection in larvae of the tea loopers
(Ectropis oblique) that spread widely in China and severely
damage the tea output. EoV is a positive-strand RNA virus with
the genome size of 9,394nt and contains a large open reading
frame (ORF) encoding a precursor polyprotein of about 3,000
amino acids (1). To date, 5 insect RNA viruses with a genome
organization similar to that of EoV have been reported, including Infectious flacherie virus (IFV), Perina nuda virus (PnV),
Sacbrood virus (SBV), Deformed wing virus (DWV) and Varroa
destructor virus-1 (VDV-1) (2-6). They have been assigned to
the genus Iflavirus (7) and have many characteristics in common with viruses in the families Picornaviridae and Dicistroviridae.
The replication of the plus-strand RNA viral genome consists
of two steps: synthesis of complementary minus-strand RNA
with the plus-strand genomic RNA as a template; and subsequent synthesis of the progeny RNA with the minus-strand
RNA as a template. RNA-dependent RNA polymerases (RdRps)
are central components in the life cycle of RNA viruses and
*Corresponding author. Tel: 86-27-68756654; Fax: 86-27-68754921;
E-mail: [email protected]
Received 16 October 2009, Accepted 16 November 2009
Keywords: Ectropis obliqua virus, Iflavirus, Primer-dependent, RNAdependent RNA polymerase, RNA synthesis
284 BMB reports
have been confirmed to be capable to initiate RNA synthesis
pol
(8), such as 3D of poliovirus (PV) (9)，NS3 of Dendrolimus
punctatus tetravirus (DpTV) (10), among this investigations the
focal point has been NS5B. NS5B has been expressed and
demonstrated to have the RdRp activity in hepatitis C virus
(HCV), BVDV (bovine viral diarrhea virus), CSFV (classical
swine fever virus) (11-14).
Although several insect picorna-like viruses have been reported these years, the study on their genomic replication
mechanism remains limited. To explore the initiation of EoV
RNA replication, we expressed and purified EoV recombinant
RNA polymerase domain from Escherichia coli BL21 (DE3).
The protein was demonstrated to have the ability to initiate
RNA synthesis in a primer- and poly (A)-dependent manner.
Furthermore, optimal conditions of temperature and metal ions
for the RdRp activity were explored. Our study not only represented the first step towards understanding the mechanism of
EoV replication, but also provided important clues for investigating the replication mechanism of other members of the
family Iflaviradae.
RESULTS
Sequence analysis
EoV RdRp domain was analyzed by using BLAST. The conserved sequences were aligned by using DNAMAN Version
4.0 software. EoV RdRp domain consisted of 591 amino acids
(aa) and was located at the 3'end of genome, adjacent to 3’
UTR, similar to the NS5B gene location of BVDV and HCV.
Analysis of the domain showed it had conserved motifs shared
by all the RdRps of positive-strand RNA viruses (15): an acid
motif V (SGX3TX3N), core motif VI (YGDD) for nucleotide
binding, and motif VII (FLKR) for catalytic function, were located at aa 2766-2775, 2805-2808 and 2842-2845, respectively (Fig. 1A). Prediction of its three dimensional structure revealed that it contained the classical finger, palm, and thumb
subdomains of RdRps (data not show).
Phylogenetic analysis based on RdRps indicated that EoV
was most closely related to PnV, followed by Cricket paralysis
virus (CrPV) and Black queen-cell virus (BQCV). These four viruses belonged to one cluster, whereas another cluster that
contained Kakugo virus (KV), DWV, VDV-1 was shown to be
more distantly related (Fig. 1B).
http://bmbreports.org
Expression and characterization of RNA-dependent RNA polymerase of Ectropis obliqua virus
Meijuan Lin, et al.
Fig. 1. Sequence alignment of putative
RdRp of EoV. Expression and purification of EoV 3Dpol and 3DpolGAA proteins from E. coli. (A) Multiple sequence alignment of putative RdRp of
EoV with other insect picorna-like viruses. Conserved regions are labeled I
to VIII. (B) Phylogenetic analysis based
on RdRp. (C) Proteins were expressed
and purified. Lane M, molecular mass
marker; lane 1, pET-His vector as a
control; lane 2, induced E. coli BL21
pol
(DE3) expressing 3D ; lanes 3-7, fractions eluted with 150-250 mM imidazole. (D) Western blot analysis of the
pol
purified proteins. Lane 1, 3D protein;
pol
lane 2, 3D GAA protein; lane 3, pETHis vector as a negative control; lane
M, prestained protein marker.
pol
Expression and purification of recombinant proteins
EoV RdRp domain contained 591aa with an expected molecular mass of 66 KDa. A major protein band of about 68 KDa
was observed from the cell lysate of the overnight induction of
E. coli that harbored pHIS-3D in SDS-PAGE. (Fig. 1C, lane 3).
pol
The molecular mass of 3D was in the range of that was expected for N-tagging 6×His recombinant protein. The protein
was purified from the soluble fraction of the lysate using a single Ni-NTA column. The fractions eluted from the column in
the presence of 150-250 mM imidazole (Fig. 1C, 2-7) were
collected and used for polymerase activity assays. The mutant
pol
protein 3D GAA was expressed and purified in parallel. The
two purified proteins were further identified by Western-blot
analysis using anti-His antibody (Fig. 1C) and used in the further study.
In vitro RNA synthesis
To investigate the polymerase activity, we established an in vitro assay system as described by Sanker (16). EoV 3' genomic
RNA and oligo(U)20 were used as template and primer in the
assay. The 378-pA template contained the 3' end of the EoV
genome with a poly(A) stretch, and 378-dA template contained
the same sequence but without poly(A) (Fig. 2D). The polymerase activity was detected by the incorporation of Dig-labeled UTP using Nortern-blot. The results showed that EoV
pol
3D activity was dependent on the presence of both 378-pA
template and oligo(U)20 in the reaction mixture (Fig. 2A, lane
5), and deletion of either one resulted in almost loss of activity
http://bmbreports.org
(Fig. 2A, lanes 1-3, lanes 4 and 6). The mutant protein 3D
GAA abolished activity even in the presence of 378-pA template and oligo(U)20, which demonstrated that the RNA synpol
thesis activity of 3D required the GDD motif (Fig. 2B).
Furthermore, the result obtained from RT-PCR using primers
3'UTRfor and 3'UTRrev was consistent to those obtained by
northern blotting (Fig. 2C).
pol
We also examined the 3D activity in the presence of various molar ratios of poly(A) and oligo(U)20. As shown in Fig.
2E, the synthesis of RNA products increased with increasing
amounts of oligo(U)20. However, a higher concentration of oligo(U)20 did not contribute to improve the 3Dpol activity.
Characterization of RdRp products
S1 nuclease catalyzes the specific degradation of single-stranded
RNA to mononucleotides, so we used the S1 nuclease assay to
pol
determine whether the products synthesized by 3D were single- or double-stranded. As shown in Fig. 2G, the RNA product was resistant to S1 nuclease digestion detected by northern
blotting. However, denaturation of RdRp products by heating
o
at 95 C, followed by incubation with S1 nuclease, allowed almost completely degradation of the RNA. These results indicated that the product from the RdRp reaction was double-stranded RNA.
Several picornaviruses like HCV, BVDV and PV RdRp have
been found to possess Terminal transferase (TNTase) activity
(17-19). TNTase adds nucleotides to 3' end of newly synthesized RNA, and plays an important role in maintaining the integrity of RNA virus genome. Here, we examined the TNTase
BMB reports
285
Expression and characterization of RNA-dependent RNA polymerase of Ectropis obliqua virus
Meijuan Lin, et al.
Fig. 2. Activity and characterization of EoV 3Dpol. RNA products were separated by 1% formaldehyde agarose gel electrophoresis and detected by northern blotting. (A) RdRp reactions were performed with template RNA 378-pA (lanes 1-3) and 378-dA (lanes 4-6), with or
pol
pol
without oligo(U)20. Lanes 1, 2, 4 and 5, presence of 3D protein; lanes 3 and 6, absence of 3D protein. (B) RdRp reactions were performed with template RNA 378-pA, with or without oligo(U)20. Lanes 1 and 2, presence of 3DpolGAA protein; lane3, absence of 3DpolGAA
protein. (C) Detection of synthesized negative-strand RNA by RT-PCR. Lane M, 100 bp DNA ladder; lanes 1-6 correspond to the reaction
conditions described in Fig. 2A, respectively. (D) RNA templates used for RdRp assays are represented by black bars. (E) RdRp reactions
were performed with 378-pA RNA as a template, with 25 ng, 100 ng, 200 ng, 300 ng, 500 ng oligo(U)20 (lanes 2-6) or no oligo(U)20
o
(lane 1). (F) For the S1 nuclease assay, RdRp products were denatured at 95 C for 3 min (lanes 1 and 4) before treatment without (lane
1) or with (lanes 2-4) S1 nuclease for the indicated times. (G) TNTase assay was performed in the absence of ATP, GTP and CTP, with
(lane 1) or without (lane 2) DIG-UTP, or in the presence of ATP, GTP or CTP, with (lane 4) or without (lane 3) DIG-UTP.
of EoV 3Dpol. In the presence of UTP alone or UTP and
DIG-UTP without any other NTPs, there was no RNA products
pol
detected (Fig. 2F, lanes 1 and 2), which indicated that 3D
did not add UTP to the 3' end of the template RNA and had no
TNTase activity.
2+
was more sensitive to Mn . Maximum activity was observed
2+
2+
at 5.0 mM Mg (Fig. 3B) and 1.0-2.0 mM Mn (Fig. 3C). The
2+
2+
high concentrations of Mn and Mg had negative impacts
+
on RNA synthesis. The optimum K concentration for the replicase reaction was between 100-200 mM, but higher concentrations were inhibitory to RdRp activity (Fig. 3D).
Effects of temperature and metal ions on RdRp activity
We first examined the effect of temperature on RNA synthesis.
The incubation temperature was varied between 22 and 45oC.
As shown in Fig. 3A, the preferred temperature for the RdRp
o
assay was approximately 30 C. There was a sharp decrease in
activity at temperature above 35oC. Next, we determined the
optimal concentrations of monovalent and divalent cations for
+
2+
2+
RdRp assay, including K , Mg and Mn . Our results showed
that both Mg2+ and Mn2+ ions were required for 3Dpol activity.
2+
The protein had a broad optimum concentration on Mg but
286 BMB reports
DISCUSSION
EoV is an invertebrate picorna-like virus, which has similarities
to mammalian picornaviruses in genome organization and
physicochemical characteristics of the polyprotein. Sequence
alignment has indicated that the C terminus of EoV contains
motifs that are conserved among the RdRps of various plusstrand RNA viruses. In our study, we purified the protein and
developed an in vitro assay system for measuring the activity.
http://bmbreports.org
Expression and characterization of RNA-dependent RNA polymerase of Ectropis obliqua virus
Meijuan Lin, et al.
Fig. 3. Temperature and metal-ions dependpol
ence of EoV 3D activity. (A) Effects of increasing temperature on 3Dpol activity. (B-D)
2+
Effects of increasing concentration of Mg ,
2+
+
pol
Mn and K on 3D activity. RNA products
were analyzed by methods similar to those
described for Fig. 2.
Our results indicated that EoV 3Dpol initiated RNA synthesis in
vitro in a primer- and poly (A)-dependent manner, in contrast
to its active-site mutated analogue.
pol
Our first attempt to purify active 3D from E. coli was hampered because of its high insolubility. By removal of the C-terminal 18 hydrophobic residues, the solubility of protein was
improved significantly. Furthermore, our subsequent in vitro
assay demonstrated that these residues were not required for
RdRp activity. We speculated that the C-terminal hydrophobic
domain might be related to cellular localization and protein
folding. This result was consistent to previous observation of
NS5B of HCV, CSFV and BVDV that suitable removal of C-terminal hydrophobic residues could significantly increase protein solubility without interference with their polymerase activity (20, 21).
To date, one of the picornaviral replicases well studied is
that of poliovirus. With poliovirus RNA polymerase, oligo(U)
primes RNA synthesis by binding to the poly(A) tract at the 3'
end of the viral RNA, resulting in the synthesized product of
template size or twice (22, 23). Our results indicated that EoV
pol
had common properties that resembled RdRp of
3D
poliovirus. Both required an oligo(U) for initiation of RNA synthesis in vitro. However, there was no synthesis of minusstrand RNA when we used 5'UTR as a template, which implied that there existed other signals participating in RNA synthesis and needed further exploration. Furthermore, we do not
know whether other viral or cellular proteins might interact
with RNA templates or RdRp to form a replication complex for
initiating RNA synthesis. In fact, the binding of cellular proteins to the 3' end of RNA templates has been described for
some viruses (24, 25).
For the positive strand RNA viruses, the mechanisms of initiating viral RNA synthesis are rather different. Poliovirus has
been shown to use an uridylylated protein as primer (proteinprimed) to initiate RNA synthesis (9), Dengue virus RdRp inihttp://bmbreports.org
tiated RNA synthesis by using a template-primed copy-back
mechanism and was also demonstrated to be capable of de novo
initiation of RNA synthesis (26). In our study, EoV RdRp was
shown to initiate RNA synthesis in a primer- and poly (A)-dependent manner.
Terminal transferase (TNTase) activity may be a common
property of RNA polymerases, and is regarded as one of the
prerequisit for initiation of RNA synthesis by back-priming.
Several viral replicase have been shown to have TNTase activity, but inconsistently results were reported by independent
groups. Recombinant HCV NS5B was reported to possess
TNTase activity (27), but others showed that this activity was
due to a celluar protein copurifying with NS5B. In our study,
pol
EoV 3D did not have TNTase activity, which was consistent
with other observation that TNTase activity and RNA synthesis
activity had different requirements (17).
2+
2+
The divalent cations Mg and/or Mn are known to be required for RdRp activity. Our results showed that the activity
of EoV 3Dpol was dependent on both Mg2+ and Mn2+ but had
2+
2+
2+
a stricter requirement for Mn than Mg . Mn has been reported to affect the activity of several polymerases. In poliovirus, it has been suggested to influence polymerase activity
through an indirect effect on enzyme folding (28). In our study,
pol
EoV 3D was sensitive to salt. The highest activity was obtained at a concentration of 100-200 mM K+, but RNA syn+
thesis was dramatically inhibited by 300 mM K . For poliovirus replicase, however, 100 mM KCl could inhibit 80-90%
of RNA synthesis activity.
pol
Here, we found that EoV 3D was unique, though it had
properties that resembled the RdRps of plus-strand RNA virus.
It possessed RNA polymerase activity in vitro and it initiated
RNA synthesis using a primer- and poly(A)-dependent mechanism.
In conclusion, our study represents a first step towards understanding the mechanism of the virus replication.
BMB reports
287
Expression and characterization of RNA-dependent RNA polymerase of Ectropis obliqua virus
Meijuan Lin, et al.
Table 1. Primers used in this study. Underlined regions indicate the restriction enzyme used
Primers
Sequence (5'–3')
3Dfor
3Drev
3Dm1
3Dm2
3' UTR for
3' UTR rev
3' UTR rev2
CCG GAATTC CTCATCATGAGTAATAATTTAC
CCCCTCGAG CACAACTTGTCCGCTGGTTACC
CTCCTCGTGGCGGCTCCATACA
GTGTATGGAGCCGCCACGAGG
CCG GAATTCCGAGGCTGGGGAGTGCTG
CCCAAGCTTGTATAACTATAATAAAAATTTG
CCCAAGCTT(T)25 GTATAACTATAATAAAAATTTG
Preparation of RNA template and RNA labeling
The oligo(U)20 RNA primer was synthesized by Invitrogen.
378-pA and 378-dA were transcribed in vitro using T7 Polymerase (Promega) from the templates EcoRI-digested pGEMT378pA and EcoRI-digested pGEMT-378dA, respectively. For
preparation of DIG-labeled RNA probes, the same DNA fragments were used as templates for in vitro transcription. RNA
labeling was performed according to the instructions supplied
with the DIG RNA labeling kit (Roche).
In vitro RdRp assay
MATERIALS AND METHODS
Expression and purification of RdRp proteins in E. coli
The cDNA fragments complementary to EoV RNA were synthesized using Superscript II reverse transcriptase (Invitrogen).
The fragment was amplified with the primer pair 3Dfor and
3Drev (Table 1). The PCR product was cloned into the pET-His
vector (Novagen) using the restriction sites EcoRI and XhoI
pol
pol
yielding clone pHIS-3D . The 3D active-site mutant bearing
substitutions in the GDD motif of both aspartates with alanines
was generated by overlapping PCR. The N-terminal fragment
was amplified by 3Dfor and 3Dm1, and the C-terminal fragment was amplified by 3Dm2 and 3Drev. The two fragments
were purified and combined to generate the mutant pHISpol
3D GAA using the primers 3Dfor and 3Drev.
The resulting plasmids were introduced into the E. coli BL21
(DE3) for expression driven by the T7 RNA polymerase. Expression was induced by addition of 0.8 mM isopropyltiogalactoside (IPTG). Cell pellets obtained from 500 ml cultures
were resuspended in binding buffer [50 mM sodium phosphate (pH 8.0), 500 mM NaCl, and 20 mM Imidazole, 10%
glycerol (v/v), 1% TritonX-100]. Cells were treated with DNase
o
(10 U) for 20 min at 37 C and sonicated on ice. After centrifugation at 12,000 r.p.m. for 30 min, cleared lysate was obtained and applied to a Ni-chelating HisTrap affinity column
(Novagen), which was pre-equilibrated with binding buffer.
The bound protein was washed with the binding buffer that
contained 30 mM imidazole and eluted with buffer that contained 100-350 mM imidazole. The eluted protein was then
collected and dialyzed against buffer [20 mM Tris/HCl (pH
8.0), 50 mM NaCl, 10% glycerol (v/v), 1% TritonX-100] and
o
stored at -80 C in aliquots.
SDS-PAGE and Western blotting
Protein fractions were separated by 12% denaturing polyacrylamide gels and elecrotransferred to a PVDF membrane
(Millipore). The membrane was blocked and treated with rabbit anti-His antibody. Alkaline phosphatase (ALP)-conjugated
goat anti-rabbit IgG was used as the secondary antibody. After
washing three times with TBS buffer, membrane-bound antibodies were detected with Nitro Blue tetrazolium / 5 - bromo 4 - chloroindol - 2 - ylphosphate (NBT/BCIP).
288 BMB reports
Standard assay mixtures that consisted of 0.5 μg template RNA
with 0.25 μg purified protein in 50 μl that contained 20 mM
Tris/HCl (pH 8.0), 5 mM MgCl2, 5 mM MnCl2, 2 mM dithiothreitol, 50 mM NaCl, 0.25 mM of each NTP, 2 U Rnasin, and
200 ng synthetic oligo(U)20. The reaction mixtures were ino
cubated at 30 C for 90 min, and were stopped by addition of
20 mM EDTA. The products were extracted with phenol chloroform followed by ethanol precipitation.
Northern blot analysis
The products synthesized by 3Dpol were separated by formaldehyde agarose gel electrophoresis. The gel was transferred
onto positively charged nylon membranes. After blotting, the
o
membrane was dried for 20 min at 80 C and hybridization
o
was done at 42 C for 16 h in the presence of DIG-labeled
RNA transcripts. After hybridization, the membranes were
washed at 55oC, from low stringency (1 × SSC, 0.1% SDS) to
high stringency (0.2 × SSC, 0.1% SDS). Bound RNA was treated with ALP-conjugated anti-DIG Ig (1：5,000) in dilution buffer (1 × blocking reagent in 0.1 M maleic acid buffer, pH 7.5)
for 60 min. The products were visualized using NBT/BCIP according to the manufacturer of the DIG RNA detection kit
(Roche).
RT-PCR detection
The synthetic RNAs were extracted with TRIzolTM reagent (Invitrogen) and subjected to reverse transcription with ThermoTM
script RT. PCR was performed with 3'UTRfor and 3'UTRrev
primers, which were complementary to the synthesized minus-strand RNAs, for detection of synthesized minus-strand
RNA.
Assessing terminal transferase activity of EoV 3Dpol
The same conditions described for assessment of EoV 3Dpol activity were used with 378-pA as a template, except that instead
of an NTP mixture, only DIG-labeled UTP was added to the
reaction.
pol
Nuclease treatment of EoV 3D
reaction product
S1 nuclease digestion was performed in 20 μl reaction mixture that contained 30 mmol/L sodium acetate buffer (pH 4.6),
280 mmol/L NaCl, 1 mmol/L ZnSO4, 1U S1 nuclease and 1
mg RNA products of the RdRp reaction assay. After incubation
http://bmbreports.org
Expression and characterization of RNA-dependent RNA polymerase of Ectropis obliqua virus
Meijuan Lin, et al.
at 23oC for 20 min, the reaction products were analyzed by
northern blotting.
Acknowledgements
This work was supported by the National Natural Science
Foundation of China (No. 30670084).
REFERENCES
1. Wang, X., Zhang, J., Lu, J., Yi, F., Liu, C. and Hu, Y.
(2004) Sequence analysis and genomic organization of a
new insect picorna-like virus, Ectropis obliqua picornalike virus, isolated from Ectropis obliqua. J. Gen. Virol. 85,
1145-1151.
2. Isawa, H., Asano, S., Sahara, K., Iizuka, T. and Bando, H.
(1998) Analysis of genetic information of an insect picorna-like virus, infectious flacherie virus of silkworm: evidence for evolutionary relationships among insect, mammalian and plant picorna(-like) viruses. Arch. Virol. 143,
127-143.
3. Wu, C. Y., Lo, C. F., Huang, C. J., Yu, H. T. and Wang, C.
H. (2002) The complete sequence of Perina nuda picorna-like virus, an insect infecting RNA virus with a genome organization similar to that of the mammalian picornaviruses. Virology 294, 312-323.
4. Ghosh, R. C., Ball, B. V., Willcocks, M. M. and Carter, M.
J. (1999) The nucleotide sequence of sacbrood virus of the
honey bee: an insect picorna-like virus. J. Gen. Virol. 80,
1541-1549.
5. Ongus, J. R., Peters, D., Bonmatin, J. M., Bengsch, E.,
Vlak, J. M. and van Oers, M. M. (2004) Complete sequence of a picorna-like virus of the genus Iflavirus replicating in the mite Varroa destructor. J. Gen. Virol. 85,
3747-3755.
6. Lanzi, G., de Miranda, J. R., Boniotti, M. B., Cameron, C.
E., Lavazza, A., Capucci, L., Camazine, S. M. and Rossi,
C. (2006) Molecular and biological characterization of deformed wing virus of honeybees (Apis mellifera L.). J.
Virol. 80, 4998-5009.
7. Christian, P., Carstens, E., Domier, L., Johnson, K., Nakashima, N., Scotti, P. and van der Wilk, F. (2005) Iflavirus;
in Virus Taxonomy: Eighth Report of the International
Committee on the Taxonomy of Viruses, Fauquet, C. M.,
Mayo, M. A., Maniloff, J., Desselberger, U. and Ball., L. A.
(eds.), pp. 779-782. Academic Press, San Diego, USA.
8. Kok, C. C. and McMinn, P. C. (2009) Picornavirus RNAdependent RNA polymerase. Int. J. Biochem. Cell B. 41,
498-502.
9. Paul, A.V., van Boom, J. H., Filippov, D. and Wimmer, E.
(1998) Protein-primed RNA synthesis by purified poliovirus RNA polymerase. Nature 393, 280-284.
10. Zhou, L., Zhang, J., Wang, X., Jiang, H., Yi, F. and Hu, Y.
(2006) Expression and characterization of RNA-dependent
RNA polymerase of Dendrolimus punctatus tetravirus. J.
Biochem. Mol. Biol. 39, 571-577.
11. Lohmann V., Korner F., Herian U. and Bartenschlager R.
(1997) Biochemical properties of hepatitis C virus NS5B
RNA-dependent RNA polymerase and identification of
amino acid sequence motifs essential for enzymatic
http://bmbreports.org
activity. J. Virol. 71, 8416-8428.
12. Ishii K., Tanaka, Y., Aizaki, H., Matsuura,Y. and Miyamura,
T. (2003) Expression of hepatitis C virus NS5B protein:
Characterization of its RNA polymerase activity and RNA
binding. Hepatology 29, 227-1235.
13. Choi, K. H., Groarke, J. M., Young, D. C., Kuhn, R. J.,
Smith, J. L., Pevear, D. C. and Rossmann, M. G. (2004)
The structure of the RNA-dependent RNA polymerase
from bovine viral diarrhea viruse stablishes the role of
GTP in de novo initiation. Proc. Natl. Acad. Sci. U.S.A.
101, 4425-4430.
14. Xiao, M., Wang, Y., Chen, J. and Li, B. (2003) Characterization of RNA-dependent RNA Polymerase Activity of
CSFV NS5B proteins Expressed in Escherichia coli. Virus
Genes 27, 67-74.
15. Koonin, E. V. (1991) The phylogeny of RNA-dependent
polymerase of positive-strand RNA viruses. J. Gen. Virol.
72, 2197-2206.
16. Sankar, S., and Porter, A. G. (1991) Expression, purification, and properties of recombinant encephalomyocarditis
virus RNA-dependent RNA polymerase. J. Virol. 65,
2993-3000.
17. Neufeld, K. L., Galarza, J. M., Richards, O. C., Summers,
D. F. and Ehrenfeld, E. (1994) Identification of terminal
pol
adenylyl transferase activity of the poliovirus 3D . J.
Virol. 68, 5811-5818.
18. Ranjith-Kumar, C. T., Gajewski, L., Gutshall, D., Maley, R.
T. and Kao, C. C. (2001) Terminal nucleotidyl transferase
activity of recombinant Flaviviridae RNA-dependent RNA
polymerases: implication for viral RNA synthesis. J. Virol.
75, 8615-8623.
19. Guan, H. C. and Anne, E. S. (2000) Polymerization of
nontemplate bases before transcription initiation at the 3'
ends of templates by an RNA-dependent RNA polymerase: An activity involved in 3' end repair of viral RNAs.
Proc. Natl. Acad. Sci. U.S.A. 97, 12451-12456.
20. Tomei. L., Vitale, R. L., Incitti, L., Serafini, S., Altamura,
S., Vitelli, A. and Francesco, R. D. (2000) Biochemical
characterization of a hepatitis C virus RNA-dependent
RNA polymerase mutant lacking the C-terminal hydrophobic sequence. J. Gen. Virol. 81, 759-767.
21. Yi, G., Zhang, C. and Wu, H. (2003) De novo RNA synthesis by a recombinant classical swine fever virus RNAdependent RNA polymerase. Eur. J. Bioehem. 270,
4952-4961.
22. Hey, T. D., Richards, O. C. and Ehrenfeld, E. (1986)
Synthesis of Plus- and Minus-Strand RNA from Poliovirion
RNA template in vitro. J. Virol. 58, 790-796.
23. Lubinski, J. M., Ransone, L. J. and Dasgupta, A. (1987)
Primer-dependent synthesis of covalently linked dimeric
RNA molecules by poliovirus replicase. J. Virol. 61,
2997-3003.
24. Yocupicio-Monroy, R. M., Medina, F., Reyes-del Valle, J.
and del Angel, R. M. (2003) Cellular proteins from human
monocytes bind to dengue 4 virus minus-strand 3'untranslated region RNA. J. Virol. 77, 3067-3076.
25. Piccininni, S., Varaklioti, A., Nardelli, M., Dave, B.,
Raney, K. D. and McCarthy, J. E. (2002) Modulation of the
hepatitis C virus RNA-dependent RNA polymerase activity
by the non-structural (NS)3 helicase and the NS4B memBMB reports
289
Expression and characterization of RNA-dependent RNA polymerase of Ectropis obliqua virus
Meijuan Lin, et al.
brane protein. J. Biol. Chem. 277, 45670-45679.
26. Ackermann, M. and Padmanabhan, R. (2001) De novo
synthesis of RNA by the Dengue virus RNA-dependent
RNA polymerase exhibits temperature dependence at the
initiation but not elongation phase. J. Biol. Chem. 276,
39926-39937.
27. Behrens, S. E., Tomei, L. and Francesco, R. D. (1996)
290 BMB reports
Identification and properties of the RNA-dependent RNA
polymerase of hepatitis C virus. EMBO J. 15, 12-22.
28. Crotty, S., Gohara, D., Gilligan, D. K., Karelsky, S.,
Cameron, C. E. and Andino, R. (2003) Manganese-dependent polioviruses caused by mutations within the viral
polymerase. J. Virol. 77, 5378-5388.
http://bmbreports.org