Download The Fas-Fas ligand system and other modulators of

The Fas-Fas Ligand System and Other Modulators of
Apoptosis in the Cornea
Steven E. Wilson *"\ Qian Li,\ Jian Weng,\ Patricia A. Barry-Lane,^ James V. Jester,f
Qianwa Liang,* and Robert J. WordingerX
Purpose. Previous studies have suggested that the disappearance of anterior keratocytes after
injury to the overlying epithelium is mediated by apoptosis. The authors examined the expression of the apoptosis-related modulators, Fas (receptor), Fas ligand, Bax, Bcl-2, Bcl-XL, and
interleukin-1 beta converting enzyme (ICE) in corneal cells as candidate mediators of this
response and tested the effect of Fas receptor-stimulating antibody on corneal stromal fibroblast cells in vitro.
Methods. Reverse-transcription-polymerase chain reaction was used to detect FAS, FAS ligand,
Bax, Bcl-2, Bcl-XL, and ICE mRNA expression in primary cultures of human corneal epithelial,
stromal fibroblast, and endothelial cells. Immunohistochemistry was applied to detect Fas and
Fas ligand proteins in fresh-frozen sections of normal human cornea. The effect of FASstimulating monoclonal antibody on first-passage stromalfibroblastswas studied using a DNA
fragmentation assay, the live-dead assay with fluorescent microscopy, toluidene blue staining
with light microscopy, and electron microscopy.
Results. FAS, Fas ligand, Bax, Bcl-2, Bcl-XL, and ICE mRNAs are expressed in all three major
cell types of the cornea. Fas protein is expressed in corneal epithelial, keratocyte, and endothelial cells in fresh-frozen human cornea. Fas ligand protein, however, was detected in corneal
epithelial and endothelial, but not keratocyte, cells. Fas-stimulating antibody induced firstpassage stromal fibroblast cell death with morphologic changes and DNA fragmentation
consistent with apoptosis.
Conclusions. The Fas system (Fas and Fas ligand) modulators and final common pathway
mediators of apoptosis are expressed in corneal cells. The distribution of Fas (epithelial,
keratocyte, and endothelial cells) and Fas ligand (epithelial and endothelial cells) protein
expression in fresh-frozen corneal tissue suggests that Fas ligand expressed in corneal epithelial and endothelial cells modulates functions in keratocyte cells and, possibly, autocrinejuxtacrine functions in epithelium and endothelium. The Fas-Fas ligand system is expressed
in the cornea and could have important functions in normal corneal physiology and in
the pathophysiology of corneal disease, including modulation of keratocyte apoptosis after
epithelial injury. Invest Ophthalmol Vis Sci. 1996;37:1582-1592.
Apoptosis (programmed cell death) is a fundamental
process that occurs during development, homeostasis,
and wound healing in the tissues of essentially all
multicellular organisms.1'2 We recently demonstrated
From the *Eye Institute and the Department of Cell Biology, The Cleveland Clinic
Foundation, Cleveland, Ohio; the f Department of Ophthalmology, University of
Texas Southiuestern Medical Center at DalUis; and the %North Texas Eye Research
Institute, University of North Texas Health Sciences Center, Fort Worth, Texas.
Presented in part at the Ocular Cell and Molecular Biology Symposium, San Diego,
California, August 1995, and the Association for Research in Vision and
Ophthalmology, Fort Lauderdale, Florida, April 1996.
Supported by US Public Health Service grant EY10056 from the National Institutes
of Health.
Submitted for publication January 17, 1996; revised March 21, 1996; accepted
March 22, 1996.
Proprietary interest calegoiy: N.
Reprint requests: Steven E. Wilson, Eye Institute and Department of Cell Biology/
A31, The Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH
44195.
1582
apoptosis of keratocytes mediated through epithelial stromal interactions after wounding of the corneal
epithelium, 3 providing a mechanism for the disappearance of keratocytes in the anterior stroma after
corneal wounding initially described by Nakayasu4 in
the rat and Crosson5 in the rabbit and recently confirmed in primates. 6 We hypothesized a fundamental
role for this system in the maintenance of corneal
tissue organization, the response to injury, and the
pathophysiology of corneal diseases.3 For example,
apoptosis of the anterior stromal keratocytes that occurs after excimer laser photorefractive keratectomy
probably is an initiating event in the subsequent
wound healing response. 3
The molecular mechanisms underlying the initiaInvestigative Ophthalmology & Visual Science, July 1996, Vol. 37, No. 8
Copyright © Association for Research in Vision and Ophthalmology
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
Apoptosis-Related Modulators
1583
,,.
CORTICOtion and regulation of apoptosis are topics of intense
I
STEROIDS
0
;>*
i,
x
investigation throughout the scientific community.
Numerous mutations affecting mediators of specific
stages of apoptosis have been identified in the nematode Caenorhabditis elegans7 and analogous modulators
have been identified in higher organisms (Fig. I). 8
For example, the C. elegans death gene, ced-S, is analogous to interleukin-1 beta converting enzyme (ICE)like protease, and the ced-9 apoptosis inhibitory gene
is analogous to Bcl-2.8 Specific cell types have been
CENTRAL
shown to have multiple, alternative, extracellular and
DEATH SIGNAL MODULATOR
"REAPER-DROSPHILA"
intracellular apoptosis signaling pathways that converge on a single common death pathway (Fig. I). 8
For example, our recent studies have demonstrated
that interleukin (IL)-l alpha and ILrl beta can induce
apoptosis in corneal stromal fibroblasts in vitro and
ICE-LIKE I
PROTEASE;
keratocytes in vivo.3 Because IL-1 alpha is expressed
by corneal epithelial cells14'15 and ILrl receptor is expressed by keratocytes, 1617 we hypothesized that injury- or death-induced release of IL-1 alpha from corneal epithelial cells activates the final common apoptotic pathway in keratocytes, inducing cell death. We
CELL
could not inhibit the in vivo apoptotic response of
DEATH
keratocytes to epithelial wounding, however, by prior
FIGURE l. Cell-specific and common pathways of apoptosis.
injection of IL-1 receptor antagonist into the stroma. 3
Examples of cell-specific signaling pathways that produce
One possible explanation for the ineffectiveness of ILapoptosis in cells are diagrammed above the broken hori1 receptor antagonist at inhibiting this response is
zontal line. A particular cell type may undergo apoptosis
expression of multiple systems activating the death of
in response to several different signals. All the cell-specific
the keratocyte cells in response to epithelial cell inpathways shown in the diagram are dependent on extracellujury. An important lesson learned from transgenic anilar signals. Cell-specific signals also may be intracellular.
Each of the cell-specific pathways is thought to trigger a
mal models is that such duplication of regulatory syscommon apoptotic pathway (diagrammed schematically betems is the norm for many cytokine- and growth factorlow the broken line) by a central death signal. The macromediated processes.18 In the current study, we have
molecule serving this function in higher organisms has not
examined corneal cell expression of several modulabeen identified. A gene called reaper that appears to serve
tors known to be involved in apoptosis. These include
such a function has been identified in Drosophila melanogasmodulators that are likely to regulate intercellular
ter.9 The reaper gene product has been shown to integrate
communication leading to apoptosis, such as Fas
information from alternative signaling pathways. Deletions
(APO-1) and Fas ligand, as well as members of the
of reaperhave been found to suppress the apoptotic response
final common apoptotic pathway (ICE, Bcl-2, Bcl-XL,
to every stimulus evaluated to date. The subsequent steps
and Bax). We also examined the effect of a Fas-stimu(arrows) leading to apoptotic cell death are likely ordered
in a pathway. Many participants in the pathway have yet to
lating antibody on corneal stromal fibroblasts.
be identified in higher organisms. Interleukin-1 beta converting enzyme (ICE) or an ICE-like protein that is a mammalian homologue of the Caenorhabditis elegans cell death
METHODS AND MATERIALS
gene ced-S is one of the modulators in the common pathwav
- T h e Bcl - 2 protein is able to suppress many apoptotic
Immunohistochemistry for Fas and Fas Ligand
death programs in higher organisms (dash indicates inhibiCorneoscleral rims were excised from eyes of patients
tion)." Bcl-2 is the mammalian homologue to ced-9, the
with conjunctival melanoma not involving the cornea
gene product that suppresses apoptosis in cells of C. elegans.
or choroidal melanoma within 5 minutes of evisceraAnother member of the Bcl family that appears to suppress
tion or enucleation, respectively, embedded in Histo
apoptosis Bcl-XL.12 Both Bcl-2 and Bcl-XL heterodimerize
with a product of another gene called Bax.13 Overexpression
Prep (Fisher, Fairlong, NJ), snap frozen in liquid nitrogen, and stored at — 85°C. The research followed of Bax accelerates apoptosis. The exact relationship of Bcl2, Bcl-X^, and Bax to cell survival versus apoptosis is unthe tenets of the Declaration of Helsinki, and inclear.""13 It appears, however, that the equilibrium between
formed consent was obtained from each patient behomodimers and heterodimers of these proteins may have
fore surgery after the nature and the possible consea
role in regulating the common apoptotic pathway. Expresquences of the study were explained. This study was
sion in corneal cells of modulators within hatched boxes is
approved by the Institutional Review Boards at the
investigated in this study.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
1584
TABLE
Investigative Ophthalmology & Visual Science, July 1996, Vol. 37, No. 8
l. Polymerase Chain Reaction Primers
Modulator
BCL^2 alpha
BCL^X,.
BAX alpha
Beta actin
ICE
FAS
FAS LIGAND
Reference Size
11
12
13
20
21
22, 23
24, 25
332/>332
379/unknown
482/=>482
321/772
424/=>424
413/>4000
177/177
750/^750
Upstream Primer
Downstream Primer
TTGTGGCCTTCTTTGAGTTCG (exon 1)
GGAGCTGGTGGTTGACTTTCT
AGACAGGGGCCCTTTTGCTTC (exon 2)
AGGCCAACCGCGAGAAGATGACC (exon 3)
AGCTTTGATTGACTCCGTTAT (exon 2)
AGACTGCGTGCCCTGCCAAGA (exon 3)
TTCTTCCCTGTCCAACCTCTG (exon 1)
TACTGCTTTAGTGAACCTTTT (exon 2)
CCGGAAGAGTTCATTCACTAC
GAGCACTCCCGCCACAAAGAT (exon 6)
GAAGTCCAGGGCGACGTAGCAC (exon 4)
CAGATTTTGTAGCAGCATTGT (exon 5)
CAGGATTTAAGGTTGGAGATT (exon 7)
AAAACATCACAAGGAGACACA (exon 1)
TCTTCCCCTCCATCATCACCA (exon 4)
Cleveland Clinic Foundation, (Cleveland, OH) and
the University of Texas Southwestern Medical Center
(Dallas, TX).
Seven-micrometer sections were prepared with a
Reichert-Jung (Leica, Deerfield, IL) cryostat. Tissue
sections were fixed in acetone at — 20°C for 10 minutes. Immunohistochemistry for Fas or Fas ligand was
performed using standard methods involving biotinylated secondary antibodies and streptavidin-conjugated peroxidase (Universal LSAB + Kit, peroxidase;
DAKO, Carpinteria, CA) according to the manufacturer's instructions, except that sections were incubated
overnight at 37°C with Fas, Fas ligand, or control primary antibody. Fas immunohistochemistry was performed with an anti-human Fas mouse IgM monoclonal antibody (Upstate Biotechnology, Lake Placid,
NY). Control immunohistochemistry was performed
with a nonimmune mouse IgM (RD Systems, Minneapolis, MN). Both Fas and control antibodies were used
at a concentration of 10 /ig/ml. An anti-Fas ligand
rabbit polyclonal antibody (Fas-L N-20; Santa Cruz
Biotechnology, Santa Cruz, CA) was used at a concentration of 2 /Ltg/ml. Control preabsorption was performed for Fas ligand by preincubating the antibody
with sc-834P control Fas ligand peptide (Santa Cruz
Biotechnology) at a concentration of 20 fxg/ml for 30
minutes before incubating with tissue sections overnight at 37°C.
Reverse-Transcription-Polymerase Chain
Reaction Method for the Detection of
Messenger RNA
Total cellular ribonucleic acid (RNA) was isolated,
and cDNA was synthesized from human primary cultures of corneal epithelial, stromal fibroblast, and endothelial cells, as previously described.19 The quality
of cDNA synthesis was monitored through the amplification of beta actin. Only cDNA yielding beta actin
amplifications of the expected size for beta actin
mRNA, without contamination with genomic beta actin amplification product of a larger size, was used for
experimental amplification.19 Polymerase chain reaction primers for ICE, Fas, Fas ligand, Bcl-2, Bcl-XL,
and Bax were designed from the previously reported
sequences (Table 1)-"-13-iJ()-25 Polymerase chain reac-
tion reactions were performed with a temperature cycler (MJ Research, Watertown, MA) according to a
previously described method.19 A modified hot-start
method was used in which anti-TAQ polymerase antibody (Clontech, Palo Alto, CA) was added to the reactions, according to the manufacturer's instructions,
to prevent initiation of amplification until after the
reactions initially were raised to the antibody denaturing temperature of 70°C. Polymerase chain reaction
amplification products were run on agarose gels as
previously described.19 Polymerase chain reaction
products were cut from agarose gels, cloned into the
PCR II Cloning Vector (Invitrogen, San Diego, CA),
and sequenced (Sequenase 2.0, United States Biochemical, Cleveland, OH) according to the manufacturer's protocols.
Effect of Fas-Stimulating Antibody on Stromal
Fibroblasts
Primary human stromal fibroblast cells were cultured
as previously described.19 First-passage stromal fibroblast cells were plated at densities from 5 X 102 to 1
X 105 cells/cm2 in standard six-well plates (Corning,
Corning, NY) in Eagle's modified essential medium
with 10% fetal bovine serum. Twenty-four hours after
plating, the medium was changed to Eagle's modified
essential medium with 0.5% fetal bovine serum before
either 100 ng/ml of anti-human Fas mouse monoclonal IgM antibody (Upstate Biotechnology) or 100
ng/ml control mouse IgM (RD Systems) was added.
After 24 hours, the percent of dead cells per field
was determined in 10 randomly selected 100X inverted microscope fields (model TMF; Nikon, Melville, NY) for both the anti-Fas and control antibody
groups. Statistical comparisons were made using the
Mann-Whitney Test. P < 0.05 was considered statistically significant. Photographs also were obtained with
the inverted microscope.
First-passage human stromal fibroblasts exposed
to anti-Fas or control antibody for 24 hours were tested
for viability with the Live/Dead Eukolight Viability/
Cytotoxicity Assay (Molecular Probes, Eugene, OR)
according to the manufacturer's instructions. Live
cells have ubiquitous intracellular esterase activity that
converts nonfluorescent, cell-permeant, calcein acet-
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
1585
Apoptosis-Relatcd Modulators
BP
EPI
M 1 2
SF
1 2 3
600 • • • • • • • »
400-^^^^^^El
HCN
1 2 C
— y —a
a
413
FIGURE 2.
Fas mRNA expression in human corneal cells. Primary cultures of human corneal epithelial {EPI), stromal
fibroblast (SF), and endothelial (HCN) cells were evaluated
for the production of Fas mRNA by reverse-transcription polymerase chain reaction. Each corneal cell type yielded
amplification bands of the expected size of 413 bp for Fas
mRNA. M = 100 bp marker with sizes in bp (BP) indicated
to the left. C = simultaneous control reaction without added
cDNA target.
oxymethyl ester to calcein resulting in green fluorescence with a fluorescein isothiocyanate filter. The
level of green fluorescence diminishes as cells die.
Concurrently, ethidium homodimer enters dead cells
because of increased permeability from membrane
damage and binds nucleic acids. Chromatin within
dead cells fluoresces red with a rhodamine filter.
Chromatin condensation frequently can be detected
in cells undergoing apoptosis. Computer-generated
composites that allow both colors to be displayed simultaneously were obtained using cells plated onto
60 mm Petriperm tissue culture dishes (Bachofer,
Reutlingen, Germany) and were viewed using a Leitz
Fluovert FU microscope (Leica, Deerfield, IL)
equipped with a Thermal Liquid Coupled Micro Incubator (Adams and List Associates, Westbury, NY) and
constant 5% CO^ in an air perfusion system. Fluorescent images were captured digitally using a high-performance CCD camera (COHU, San Diego, CA) and
integrator-frame storer (Colorado Video, Boulder,
CO). Images were digitized using a 486 personal computer with a Data Translation DT3852 image acquisition card (Marlboro, MA) and 8 Mbytes of on-board
memory. Individual images were transferred to a Silicon Graphics (Mountain View, CA) workstation (Personal Iris 4D-35G) and processed using the ANALYZE image processing software program (Mayo Medical Ventures, Rochester, MN). Final images were
photographed using an AGFA-Matrix film recorder
(model 6564; Orangeburg, NY) and 4X5 Ektachrome
64T (Eastman Kodak, Rochester, NY).
First-passage human stromal fibroblasts were exposed to anti-Fas or control antibody for 24 hours.
Dead cells were combined with living cells that had
been removed from the culture flask by trypsinization.
DNA was isolated, and ethidium bromide-stained gels
were used to detect internucleosomal DNA fragmentation as previously described.20 The experiment was
repeated three times.
First-passage stromal fibroblasts exposed to antiFas monoclonal or control antibody were trypsinized,
washed with medium containing 10% fetal bovine serum, pelleted in a 1.5 ml Eppendorf tube, and fixed in
3% gluteraldehyde and 1% paraformaldehyde. Onemicron sections were stained with toluidine blue 1%
in borate buffer and photographed with a light microscope (Optiphot-2, Nikon). Electron microscopy was
performed as previously described27 on the fixed cell
pellets. Electron microscopy sections were cut at 70
nm and stained with 3% uranyl acetate for 15 minutes,
followed by 3 minutes in Reynold's lead citrate.
RESULTS
Fas mRNA was detected by reverse-transcription-polymerase chain reaction (RT-PCR) in corneal epithelial, stromal fibroblast, and endothelial cells (Fig. 2)
in primary culture. Nucleic acid sequencing demonstrated that the amplification product of the expected
size was identical to the known sequence for Fas. Fas
protein was detected by immunohistochemistry in corneal epithelial, keratocyte, and endothelial cells (Fig.
3). Although each cell type stained diffusely, perinuclear staining was prominent.
Fas ligand mRNA was detected by RT-PCR in all
0
0
o
c>
\
A
i
B
I
0
C
0
D
FIGURE 3. Immunohistochemical detection of Fas in human
corneal cells. Fas protein was detected in human corneal
epithelial (A, between hollow arroios), keratocyte (A,C, arrows),
and endothelial (C, holloxv arrow) cells. The morphology of
the human endothelial cells was distorted by cryostat sectioning, but this did not influence immunohistologic staining. Each cell type appeared to stain diffusely, although
perinuclear staining seemed most prominent. No staining
of cells was noted in adjacent sections when a nonimmune
IgG was used as a control (B,D). Magnification, X200.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
1586
Investigative Ophthalmology & Visual Science, July 1996, Vol. 37, No. 8
FIGURE 4. Fas ligand mRNA expression in human corneal
cells. Primary cultures of human corneal epithelial (EPI),
stromalfibroblast(SF), and endothelial (HCN) cells were
evaluated for the production of Fas mRNA by reverse-transcription-polymerase chain reaction. Each corneal cell type
yielded amplification bands of the expected size of 177 bp
for Fas ligand mRNA. M = a 100 bp marker with sizes in
bp (BP) indicated to the left. C = a simultaneous control
reaction without added cDNA target.
three major cell types of the cornea in primary culture
(Fig. 4). Nucleic acid sequencing demonstrated that
the amplification product of the expected size was
identical to the known sequence for Fas ligand. After
the genomic organization of the Fas ligand was reported,25 we also tested a second downstream PCR
primer that gave a different-sized PCR product for
mRNA and genomic amplifications (Table 1). Amplification product of the expected size for mRNA (750
bp), but not genomic, amplification was detected (not
shown) with the second primer set. Fas ligand protein
was detected by immunohistochemistry in corneal epithelial and endothelial, but not keratocyte, cells (Fig.
5). Thus, although Fas ligand mRNA was detected in
primary cultures of corneal stromal fibroblasts, Fas
ligand protein was not detected in keratocytes in freshfrozen human cornea.
After 12 to 24 hours of exposure to anti-Fas antibody and depending on the donor, a large proportion
of first-passage stromal fibroblast cells had rounded
up and dissociated from the culture plate (Fig. 6A).
Few stromal fibroblasts rounded up and dissociated
in flasks treated with control IgM (Fig. 6B). In a representative experiment with cells plated at 1 X 104 cells/
cm2, 75% ± 8% (SD) of stromal fibroblast cells exposed to anti-Fas antibody had dissociated and 1 % ±
1% exposed to control antibody had dissociated at 24
hours. The difference was statistically significant (P
— 0.0002). Results were similar in five experiments
performed with stromal fibroblasts from different donors. There appeared to be no difference in the response of stromal fibroblasts to die anti-Fas antibody
with varying plating densities between 5 X 102 to 1
X 105 cells/cm8. The Live/Dead Eukolight Viability/
Cytotoxicity Assay (Molecular Probes) demonstrated
that cells rounding up and dissociating from the plate
in response to the anti-Fas antibody were dead or dying (Fig. 6C). In addition, fluorescence microscopy
with this assay showed that many cells exposed to Fasstimulating antibody had chromatin condensation
and fragmentation consistent with apoptosis.
Internucleosomal DNA fragmentation was detected when human stromal fibroblasts were exposed
to Fas-stimulating antibody, but not to control antibody (Fig. 7). DNA fragments less than approximately
1500 bp could not be detected in three separate experiments.
Toluidine blue-stained stromal fibroblast cells exposed to anti-Fas antibody had cell shrinkage, blebbing with formation of membrane-bound bodies, and
condensation and fragmentation of the chromatin
consistent with apoptosis (Figs. 8A to 8D). Control
antibody-treated stromal fibroblast cells maintained
normal cellular morphology with few cells showing
changes consistent with apoptosis (Figs. 8E, 8F).
Electron microscopy of pelleted stromal fibroblasts that had been exposed to anti-Fas antibody revealed large numbers of cells with chromatin condensation and nucleosomal fragmentation (Figs. 9A to
9C). There were also numerous membrane-bound cell
fragments, many of which contained cell organelles
(Figs. 9A to 9D). Many cells in the anti-Fas-treated
cultures were observed not only to have chromatin
A
FIGURE 5. Immunohistochemical detection of Fas ligand in
human corneal cells. Fas ligand protein was detected in
human corneal epithelial (A, between arrows) and endothelial
(C, arrow) cells but not in keratocyte cells (A,C). Note that
in both epithelial and endothelial cells, a staining pattern
consistent with Fas ligand association with the cell membrane was noted. The morphology of the human endothelial
cells was distorted by cryostat sectioning, but this did not
influence immunohistologic staining. Staining was reduced
markedly when antibody was preincubated with Fas ligand
antigen (B,D), demonstrating the specificity of the detection
in human corneal cells. Magnification, X200.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
1587
Apoptosis-Related Modulators
FIGURE 6. Effect of Fas-stimulating antibody on first-passage
stromal fibroblast cells from human cornea. (A) After 24
hours of exposure to Fas-stimulating antibody, a large proportion of stromal fibroblasts had rounded up and dissociated from the culture plate. Note the large numbers of small
membrane-bound cell fragments that are visible (see Fig.
6D). (B) Almost all cells exposed to control IgM remained
attached to the plate. (C) Stromal fibroblasts exposed to
anti-Fas antibody for 24 hours were stained with the Live/
Dead Eukolight Viability/Cytotoxicity Assay and photographed under a fluorescent microscope. A composite of
identical fields generated with fluorescein isothiocyanate
and rhodamine filters is shown. Cells at different stages of
cell death after exposure to the anti-Fas antibody are illustrated. One cell at an early stage of death (a) had residual
calcein green fluorescence and homogeneous red ethidium
staining of the nucleus. Another cell (b) has progressed to
have little green staining with heterogeneous staining of the
chromatin associated with chromatin condensation. A cell
(c) with almost no green staining had two areas of red fluorescence (arrows) caused by chromatin fragmentation. Two
other cells (d) remained viable without evidence of ethidium staining. More than 99% of cells in control antibodytreated cultures have staining identical to the cells labeled
d, with no cells showing patterns consistent wiui apoptosis
like cells labeled b and c (not shown).
condensation but to be disintegrating, and the formation of large numbers of membrane-bound cell fragments was consistent with apoptotic bodies (Figs. 9A
to 9D). The majority of stromal fibroblast cells treated
with control antibody appeared to have normal morphology (Figs. 9E, 9F), although, even in control cultures, a few cells were seen that appeared to have
morphologic changes suggestive of apoptosis.
Bax and Bcl-2 mRNAs were detected by RT-PCR
in corneal epithelial, stromal fibroblast, and endothelial cells in primary culture (Figs. 10A, 10B). Bcl-X^
mRNA was detected by RT-PCR in corneal epithelial,
stromal fibroblast, and endothelial cells in primary
culture (Fig. 11). Nucleic acid sequencing demonstrated that the amplification products of the expected
size were the known sequences for Bax, Bcl-2, and
Bcl-XL.
ICE mRNA was amplified by RT-PCR in corneal
epithelial, stromal fibroblast, and endodielial cells in
primary culture (Fig. 12A), although the expected
product was not detected in one corneal epithelial
cell culture. Nucleic acid sequencing demonstrated
that the amplification product of the expected size
(424 bp) was die known sequence for ICE. A smaller
alternative amplification product was present in the
RT-PCR reactions from each corneal cell type. Nucleic acid sequencing revealed diat die expected and
alternative amplification products were identical, except the smaller product had an internal 63 bp deletion corresponding to amino acids 92 to 112 of die
ICE precursor protein (Fig. 12B). These residues do
not contribute to die mature ICE protein, which is
composed of residues 120 to 297 and 317-404 of the
precursor.21 The relative levels of the expected and
alternative amplification products (essentially an internal quantitative PCR amplification within each reaction) varied between individual cell cultures. The
ratio of the levels of the ICE amplifications with a
particular cDNA target did not appear to be cell specific (Fig. 12A).
DISCUSSION
Apoptosis has been shown to be as critical to development, homeostasis, and wound healing as prolifera-
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
1590
Investigative Ophthalmology & Visual Science, July 1996, Vol. 37, No. 8
BAX
BCL-2
HSF
BP
HCE
HCN
M
.424 BP
S361 BP
B
BAX
-CTC TCA GCA GM
GAT C M ACATCTGSA AAT TAC CTT AAT ATC CAA
Leu Ser Ala Asp Gin Thr Ser Gy Asn Tyr Leu Asn Met Gin
BCL-2
GAC TCT CAA GSA GTACTTTCT TCC TTT CCA GCT CCT CAG GCA Asp Ser Qn Gly Val Leu Ser Ser Phe Pro Ala Pro Gin Ala
12. Interleukin-1 beta converting enzyme (ICE) production in corneal cells. (A) Primary cultures of human
stromal fibroblast (HSF), corneal epithelial (HCE), and corneal endothelial (HCN) cells were evaluated for the production of ICE mRNA by reverse-transcription-polymerase
chain reaction (RT-PCR). Each corneal cell type yielded
PCR product of the expected size for ICE (424 bp). The
expected product was not, however, detected in one epithelial culture (donor 1). An alternative band (361 bp) was
detected in each cell. Note the variability of the relative
levels of the expected and alternative products within individual cell cultures. (B) Partial sequences of the previously
reported and alternative ICE mRNAs and expected translation products. The 63-nucleotide sequence deleted within
die alternative 361 bp ICE mRNA amplification is underlined. Note that this deletion will not produce a frame shift
in the sequence beyond the deletion and, therefore, the
amino acid residues before and after the deletion should
be identical to the previously reported ICE precursor.21
FIGURE
B
FIGURE 10. Bax and Bcl-2 mRNA expression in human corneal cells. (A) Reverse-transcription-polymerase chain reaction amplification products of the expected size for Bax
(482 bp) and Bcl-2 (332 bp) mRNAs were detected in primary human stromal fibroblast cells. For each primer pair,
results are shown for cDNA prepared from cells from three
different donors (donors 1, 2 and 3). C = a simultaneous
control amplification without cDNA for each primer set. M
= a 100 bp marker with sizes in bp (BP) indicated to the
left. (B) Bax and Bcl-2 mRNAs were detected by RT-PCR
in primary cultures of human corneal epithelial (EPI) and
endothelial (HCN) cells.
late corneal tissue organization.3 The distribution of
expression of Fas-Fas ligand in the cornea suggests
that such signaling could occur from the epithelial
and endothelial cells to keratocyte cells by this system.
The IL-1 -ILrl receptor system has been shown to have
a similar pattern of cell expression in vivo and to induce comparable effects on corneal cells.3 Whether
the Fas-Fas ligand and 1L-1-IL-1 receptor systems
function independently or are interrelated cannot be
determined from the current study. If soluble Fas ligand is released from epithelial cells after injury, it
• - * - 379 BP
200
FIGURE U. Bcl-XL mRNA expression in human corneal cells.
Primary cultures of human corneal epithelial (EPI), stromal
fibroblast (SF), and endodielial (HCN) cells were evaluated
for the production of Bcl-X|. mRNA by reverse-transcription-polymerase chain reaction. Each corneal cell type
yielded amplification bands of the expected size of 379 bp
for Bcl-XL ligand mRNA. M = a 100 bp marker with sizes
in bp (BP) indicated to the left. C = a simultaneous control
reaction without added cDNA target.
could have a role in mediating apoptosis of underlying
keratocytes in response to such injury.3 Autocrine
function within the epithelium and endothelium also
is possible because these cells express both Fas and
Fas ligand. Recent experiments have demonstrated
that the Fas-stimulating antibody will trigger death of
primary human corneal epithelial or endothelial cells,
and the death of these cells is accompanied by electron microscopic morphologic changes consistent
with apoptosis (Mohan R, Wilson SE, unpublished
data, 1996). Brunner et al37 demonstrated simultaneous expression of Fas and Fas ligand on T-cell hybridoma cells. These investigators showed that Fas and Fas
ligand interaction, resulting in apoptosis, could occur
on a single cell. It is, however, unclear how these interactions occur on a single cell.37
Griffith and coworkersM also recently reported
the expression of Fas ligand protein in corneal epithelial and endothelial cells, as well as many other cells
of the eye. Similar to our results, these investigators
did not detect Fas ligand production in keratocyte
cells. They suggested that Fas ligand produced by ocular cells could stimulate apoptosis of inflammatory
cells expressing Fas and that these interactions had a
role in maintaining immune privilege within the cornea and other areas of the eye.38 Although their data
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
Apoptosis-Related Modulators
convincingly demonstrate that these types of interactions may occur between corneal and immune cells,
our demonstration of Fas mRNA and protein expression in each corneal cell type and stimulation of
apoptosis in stromal fibroblasts by anti-Fas-stimulating
antibody suggests that the Fas-Fas ligand system could
be involved in regulation of corneal cells.
The current study also demonstrated that mRNA
coding for several mediators (Bax, BCL-2, BCL-XL,
and ICE) of the common final pathway of apoptosis
(Fig. 1) are expressed in corneal epithelial, stromal
fibroblast, and endothelial cells in primary culture.
We have discovered a smaller alternative PCR amplification product for ICE that also is expressed in each
corneal cell type. Nucleic acid sequencing revealed
that the expected and alternative ICE amplification
products were identical, except that the latter had an
internal 63 bp deletion corresponding to amino acids
92 to 112 of the precursor protein (Fig. 11B). These
residues do not contribute to the mature ICE protein,
which is composed of two subunits containing residues
120 to 297 and 317 to 404 of the precursor. 21 It is
unknown whether the corresponding 21-amino acid
deletion from the ICE precursor protein contains signaling or other information that might have functional relevance to the corresponding alternative protein. If the Bax, Bcl-2, Bcl-XL, and ICE proteins are
expressed in each corneal cell type, each cell is likely
to be competent to undergo apoptosis in response to
appropriate signals. Studies that identify cell-specific
signals activating the final common pathway of
apoptosis are likely to provide important insights into
the normal physiology and pathophysiology of corneal
cells.
Key Words
apoptosis, Bax, Bcl-2, cornea, Fas, Fas ligand, interleukin-1
converting enzyme
Acknowledgments
The authors thank Alisdar McDowell and John Gabrovsek
for their expert assistance with electron microscopy.
References
1. Cohen JJ. Apoptosis: Physiologic cell death. J Lab Clin
Med. 1994;124:761-765.
2. Hoffman B, Liebermann DA. Molecular controls of
apoptosis: Differentiation/growth arrest primary response genes, proto-oncogenes, and tumor suppresser
genes as positive and negative modulators. Oncogene.
1994;9:1807-1812.
3. Wilson SE, He Y-G, Weng J, Li Q, Vital M, Chwang
EL. Epithelial injury induces keratocyte apoptosis: Hypothesized role for the interleukin-1 system in the
modulation of corneal tissue organization. Exp Eye Res.
1996;62:325-338.
4. Nakayasu K. Stromal changes following removal of
1591
epithelium in rat cornea. Jpn J Ophthalmol. 1988;
32:113-125.
5. Crosson CE. Cellular changes following epithelial
abrasion. In: Beuerman RW, Crosson CE, Kaufman
HE, eds. Healing Processes in the Cornea. Houston: Gulf
Publishing; 1989:3-14.
6. Campos M, Szerenyi K, Lee M, McDonnell JM,
McDonnell PJ. Keratocyte loss after corneal deepithelialization in primates and rabbits. Arch Ophthalmol.
1994; 112:254-260.
7. Hengartner MO, Horvitz HR. Programmed cell death
in Caenorhabditis elegans. Curr Opin Genet Dev. 1994;
4:581-586.
8. Steller H. Mechanisms and genes of cellular suicide.
Science. 1995; 267:1445-1449.
9. White K, Grether ME, Abrams JM, Young L, Farrell
K, Steller H. Genetic control of programmed cell
death in Drosophila. Science. 1994;264:677-683.
10. Miura M, Zhu H, Rotello R, Hartwieg E, YuanJ. Induction of apoptosis infibroblastsby IL-1 beta-converting
enzyme, a mammalian homolog of the C. elegans cell
death gene ced-3. Cell. 1993; 75:653-660.
11. Tsujimoto Y, Croce CM. Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc Natl Acad
Sci USA. 1986; 83:5214-5218.
12. Boise LH, Gonzalez-Garcia M, Postema CE, et al. BclX, a bcl-2-related gene that functions as a dominant
regulator of apoptotic cell death. Cell 1993; 74:597608.
13. Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that
accelerates programed cell death. Cell. 1993; 74:609619.
14. Wilson SE, He Y-G, Lloyd SA. EGF, EGF receptor,
basic FGF, TGF beta-1, and interleukin-1 alpha mRNA
in human corneal epithelial cells and stromal fibroblasts. Invest Ophthalmol Vis Sci. 1992; 33:1756-1765.
15. Wilson SE, Schultz GS, Chegini N, WengJ, He Y-G.
Epidermal growth factor, transforming growth factor
alpha, transforming growth factor beta, acidic fibroblast growth factor, basic fibroblast growth factor, and
interleukin-1 proteins in the cornea. Exp Eye Res.
1994; 59:63-70.
16. Wilson SE, Lloyd SA, He Y-G. Glucocorticoid receptor
and interleukin-1 receptor messenger RNA expression
in corneal cells. Cornea. 1994; 13:4-8.
17. Fabre EJ, Bureau J, Pouliquen Y, Lorans G. Binding
sites for human interleukin 1 alpha, gamma interferon and tumor necrosis factor on cultured fibroblasts of normal cornea and keratoconus. Curr Eye Res.
1991; 10:585-592.
18. Taverne J. Transgenic mice in the study of cytokine
function. Int J Exp Pathol. 1993; 74:525-546.
19. Wilson SE, Walker JW, Chwang EL, He Y-G. Hepatocyte growth factor (HGF), keratinocyte growth factor
(KGF), their receptors, FGF receptor-2, and the cells
of the cornea. Invest Ophthalmol Vis Sci. 1993; 34:25442561.
20. Ng S-Y, Gunning P, Eddy R, et al. Evolution of the
functional neta-actin gene and its multi-pseudogene
family: Conservation of noncoding regions and chro-
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017
1592
21.
22.
23.
24.
25.
26.
27.
28.
29.
Investigative Ophthalmology & Visual Science, July 1996, Vol. 37, No. 8
mosomal dispersion of pseudogenes. Mol Cell Biol.
1985; 5:2720-2732.
Cerretti DP, Hollingsworth LT, Kozlosky CJ, et al. Molecular characterization of the gene for human interleukin-1 beta converting enzyme (IL1BC). Genomics. 1994; 20:468-473.
Itoh N, Yonehara S, Ishli A, et al. The polypeptide
encoded by the cDNA for human cell surface antigen
Fas can mediate apoptosis. Cell. 1991;66:233-243.
Cheng J, Liu C, Koopman WJ, Mountz JD. Characterization of human Fas gene: Exon/intron organization and
promoter region. J Immunol. 1995; 154:1239-1245.
Alderson M. Fas ligand mediates activation induced
cell death in human T lymphocytes. / Exp Med.
1995;181:7l-77.
Takahashi T, Tanaka M, Inazawa J, Abe T, Suda T,
Nagata S. Human Fas ligand: Gene structure, chromosomal location and species specificity. Int Immunol.
1994;6:1567-1574.
Zhivotovsky B, Cedervall B, Jiang S, Nicotera P, Orrenius S. Involvement of Ca2+ in the formation of high
molecular weight DNA fragments in thymocyte
apoptosis. Biochem Biophys Res Commun. 1994; 202:120127.
Michel-Salmin LA, Tosi-Couture E, Gautier A,
McDowall AW, Dubochet J. Electron microscopy of
the chromosomes of dinoflagellate Porocentrum viicans:
Confirmation of bouligands liquid crystal hypothesis.
/ Ultrastruct Moke Struct Res. 1986; 97:10-30.
Zakeri ZF, Quaglino D, Latham T, Lockshin RA. Delayed internucleosomal DNA fragmentation in programmed cell death. FASEBJ. 1993; 7:470-478.
Fini ME, Strissel KJ, Girard MT, Mays JW, Rinehart
WB. Interleukin 1 alpha mediates collagenase synthe-
30.
31.
32.
33.
34.
35.
36.
sis stimulated by phorbol 12-myristate 13-acetate.
Chem. 1994; 269:11291-11298.
Girard MT, Matsubara M, Fini ME. Transforming
growth factor-beta and interleukin-1 modulate metalloproteinase expression by corneal stromal cells. Invest
Ophthalmol Vis Sci. 1991; 32:2441-2454.
Nagata S, Golstein P. The Fas death factor. Science.
1995;267:1449-1456.
Ni R, Tomita Y, Matsuda K, et al. Fas-mediated
apoptosis in primary cultured mouse hepatocytes. Exp
Cell Res. 1994; 215:332-337.
Oishi M, Maeda K, Sugiyama S. Distribution of
apoptosis-mediating Fas antigen in human skin and
effects of anti-Fas monoclonal antibody on human epidermal keratinocyte and squamous cell carcinoma cell
lines. Arch Dermatol Res. 1994;286:396-407.
Sayama K, Yonehara S, Watanabe Y, Miki Y. Expression
of Fas antigen on keratinocytes in vivo and induction
of apoptosis in cultured keratinocytes. / Invest Dermatol. 1994; 103:330-334.
Tanaka M, Suda T, Takahashi T, Nagata S. Expression
of the functional soluble form of human fas ligand in
activated lymphocytes. EMBOJ. 1995; 14:1129-1135.
Kimura K, Wakatsuki T, Yamamoto M. A variant
mRNA species encoding a truncated form of Fas antigen in the rat liver. Biochem Biophys Res Commun.
1994; 198:666-674.
37. Brunner T, Mogil RJ, LaFace D, et al. Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature. 1995; 373:441-444.
38. Griffith TS, Brunner T, Fletcher SM, Green DR, Ferguson TA. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science. 1995; 270:11891192.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933193/ on 05/10/2017