Download Sapo gigante (Rhinella marina)

Sapo gigante (Rhinella marina)
N omb res comu n es: Sapo grande, Sapo lechero, Sapo común, Sapo verrugoso (Español) / Giant toad,
Cane toad, Marine toad (Inglés) / Múuch, Bezmuch, Totmuch (Maya)
Si n ón i mos: Bufo marinus, Bufo marinus subsp. horribilis, Rana marina
¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la
atenderemos.
Foto: (c) Taran Rampersad, algunos derechos reservados (CC BY-NC-SA)
Ver todas las fotos etiquetadas con Rhinella marina en Banco de Imagénes »
Descripción de EOL Ver en EOL (inglés) →
Distribution 1,2
The natural range of Rhinella marina is from the Rio Grande Valley of Texas south to the Central
Amazon and southeastern Peru. This toad has been introduced into the Caribbean Islands, South
Florida (Key West and Stock islands, Tampa Bay, Hillsborough, Dade and Broward counties), the
Hawaiian islands, and Australia's east coast (East Queensland and Coastal New South Wales). Rhinella
marina has been called one of the 100 worst invasive species worldwide by the Invasive Species
Specialist Group.
Bi ogeograp h i c R egi on s: nearctic (Introduced , Native ); neotropical (Introduced , Native ); australian
(Introduced ); oceanic islands (Introduced )
Description 3
Females of this large bodied species can attain snout-vent lengths of over 225 mm, though most adults
range from 85 to 150 mm. Adult males are yellowish-brown in color, with the yellow being most
pronounced along the sides and the throat. Females and immature males have irregular brown
blotches on their dorsal surface. The skin of both sexes is covered by irregularly scattered warts. In
sexually active males these warts bear horny spicules. The parotoids are relatively large and often
triangular and swollen in appearance. Cranial ridges are well developed. The tympanum is distinct, and
the interorbital is concave. The webbing is poorly developed. The nuptial pads in the males are dark on
the first 3 fingers (Easteal 1963).
Rick Speare has compiled a bibliography on this species up until 1991: Cane toad.
Karyotype:This species has a diploid chromosome (2n) with 5 large pairs and 6 small ones, which makes
22 chromosomes in total (Cole, Lowe, and Wright 1968).
A Spanish-language species account can be found at this website of Instituto Nacional de Biodiversidad
(INBio).
Description 4
The non-native marine toad, Bufo marinus, is the largest of Florida's frogs and toads. It has a stout body
and short legs, with the digits of the forelimbs lacking webbing and those of the hind limbs being
webbed. The skin is rough and warty. Skin ranges in color from gray to tan to red-brown, dark brown,
olive to dull green, to black above, and cream-colored and often flecked with brown or black on the
belly. The tympani (ear membranes) are one-half to two-thirds the diameter of the eyes (Ashton and
Ashton 1988)The most distinguishing feature (other than size) is the presence of two large parotid
glands, located at the shoulder behind each eye. These are venom glands capable of producing toxic
milky secretions when squeezed. Smaller venom glands ('warts') are distributed all over the surface of
the skin (Conant and Collins 1991, Gautherot 2000).Tadpoles are jet black dorsally and silvery white with
black spots ventrally (Ashton and Ashton 1988).The vocalization of B. marinus is a slow, low-pitched trill
and larger males usually have deeper calls (Somma 2004).
Morphology 1,2
Rhinella marina has a grey olive brown dorsal skin with many warts ending in dark brown caps. The
ventral skin tends to be a whitish yellow with dark brown speckles or mottles and is granular. Rhinella
marina possesses huge paratoid glands stretching from the anterior side of the tympanum to halfway
down the back. A high bony ridge meets at the snout between the nostrils. Rhinella marina, like other
nocturnal species, has horizontal pupils. Rhinella marina can reach a maximum length of 238
millimeters, although generally is approximately 150 to 175 millimeters.
R an ge l en gth : 150 to 238 mm.
Oth er Ph ysi cal Featu res: ectothermic ; heterothermic ; bilateral symmetry ; poisonous
Sexu al Di morp h i sm: sexes alike
Average mass: 106.25 g.
Average b asal metab ol i c rate: 0.0303 W.
Size 4
Bufo marinus in Florida can reach sizes of around 10-15 cm (and up to nearly 24 cm elsewhere) and
female toads can weigh up to 2.5 kg (Behler 1979, Somma 2004).
Identification 5
Adult
Species description based on Ibanez et al (1999) and Savage (2002). A very large toad (males to 145 mm,
females to 175 mm).
Dorsal
Dorsal coloration varies from yellowish brown to dark brown. The dorsum is mottled in females and
uniform in males. The paratoid glands are very large.
Eye
The iris is brown.
Extremities
The hands and feet are mostly unwebbed.
Type information 6
Hol otyp e for Rhinella marina
Catal og N u mb er: USNM 116513
Col l ecti on : Smithsonian Institution, National Museum of Natural History, Department of Vertebrate
Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Prep arati on : Ethanol
Year Col l ected : 1940
Local i ty: La Esperanza, Chiapas, Mexico
Look alikes 4
The size of the marine toad and the presence of the large parotid glands and webbed hind digits make
this species easy to distinguish from other Florida frogs and toads.
I dnature guides 7
Identification key for frogs and toads of Panama
Identification key for frogs and toads of North America
Habitat 1,2
Habitat
Rhinella marina is a tropical species that prefers forested areas with semi-permanent water nearby
(Cogger 1983).
Hab i tat R egi on s: tropical ; terrestrial
Terrestri al Bi omes: forest ; rainforest
Trophic strategy 1,2
Rhinella marina forages primarily nocturnally in mature forests and roadways. It feeds on ants, beetles,
and earwigs in southern Florida, but has been found with dragonflies, grasshoppers, truebugs,
crustaceans, gastropods, plant matter and even dog and cat food in their stomachs (Krakauer 1968).
An i mal Food s: insects; terrestrial non-insect arthropods
Pri mary Di et: carnivore (Insectivore , Eats non-insect arthropods)
Associations 4
None reported.Invasion History: Marine toads have been repeatedly introduced throughout the world
as a potential biological control agent for crop-damaging insects, primarily those that damage
sugarcane (Krakauer 1968, 1970). The most infamous introduction is the 1935 intentional release into
the canefields of Queensland, Australia in an unsuccessful attempt to control the sugar pest the
greyback cane beetle (Dermolepida albohirtum). The marine toads used in the Queensland introduction
were from Hawaii where the species had been intentionally introduced just a few years earlier
(McKeown 1996, Lever, 2001).The first attempts at intentional introduction of Bufo marinus into Florida
occurred at approximately the same time as the Hawaii and Australia introductions. Specimens
imported from Puerto Rico were released into Palm Beach County in 1936 but the species failed to
become established on this occasion and in two subsequent attempts as well (Krakauer 1968).Marine
toads finally did become established in Florida after an accidental release by an importer in 1955 from
the Miami Airport (Krakauer 1968, Ashton and Ashton 1988). Additional intentional releases into south
Florida in 1963 and 1964 facilitated establishment and subsequent explosive population growth. The
species was recognized as a nuisance species requiring control as early as 1965 (Krakauer 1968, 1970).
Potential to Compete With Natives: Marine toads likely compete with native species for food, living
space and breeding sites and may have, in some parts of the world, been a the principal cause of local
extirpation of some native amphibians (Krakauer 1968). Marine toads also eat other species of frogs and
toads and practically any other suitably-sized animal they encounter. Possible Economic Consequences
of Invasion: The defensive secretions produced by the parotids and other poison glands are highly toxic
and are capable of killing dogs, cats, and other animals that bite into or attempt to consume them
(USGS/SEARMI). Effects on native fauna are not fully known but are believed to be similar.The secretions
are also capable of making humans seriously ill, and of causing serious skin and eye irritation
Carmichael and Williams 1991, Conant and Collins 1991).Bufo marinus is listed by ISSG as as among
"100 of the Worst" global invasive organisms, and authorities consider it to be the "most introduced
amphibian in the world" (Behler 1979, Carmichael and Williams 1991).
Population biology 4
Bufo marinus is considered to be abundant in Dade and in some areas of Monroe Counties, occurring
in lesser numbers elsewhere in south Florida (USGS/SEARMI).
Ecology 5
Ecology
Rhinella marina nocturnal, and is commonly encountered on the ground in urban environments (Ibanez
et al 1999).
Behaviour 1,2
Commu n i cati on Ch an n el s: tactile ; acoustic ; chemical
Oth er Commu n i cati on M od es: choruses
Percep ti on Ch an n el s: tactile ; acoustic ; chemical
Life cycle 1,2
The eggs hatch between forty-eight hours and one week. The tadpoles tend to be small and black and
aggregate in dense numbers. Tadpoles metamorphose into small toadlets identical to the adults in
forty-five to fifty-five days (Bureau of Rural Sciences 1998).
Devel op men t - Li fe Cycl e: metamorphosis
Life expectancy 1,2
Rhinella marina is a relatively long-lived toad, reaching ages up to ten years (Cogger 1983).
R an ge l i fesp an
Statu s: wi l d : 10 (high) years.
Average l i fesp an
Sex: femal e
Statu s: cap ti vi ty : 8.0 years.
Reproduction 1,2
Males congregate in temporary or permanent still or slow moving water and call for mates. More than
one male may fertilize the eggs of a single female, and a particularly successful males may fertilize the
eggs of multiple females in a breeding season.
M ati n g System: polygynandrous (promiscuous)
Rhinella marina is able to reproduce nearly year round. The females are able to lay eggs after their
second year. Eggs are laid in long jelly-like strings on rocks, debris, or emergent vegetation; in excess of
30,000 eggs at a time. The eggs hatch in 2 to 7 days.
Breed i n g i n terval : These toads breed once yearly.
R an ge n u mb er of offsp ri n g: 30,000 (high) .
R an ge ti me to h atch i n g: 2 to 7 days.
K ey R ep rod u cti ve Featu res: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious
(sexes separate); sexual ; fertilization (External ); oviparous
Once the eggs are fertilized and arrayed in the water, there is no further parental care.
Paren tal In vestmen t: pre-fertilization (Provisioning)
Growth 4
Egg strings may be free-floating or wrapped around submerged as well as surface material (Somma
2004). Eggs hatch into tadpoles at around three days and the tadpoles metamorphose to juvenile toads
around 45-55 days later (Krakauer 1970, Ashton and Ashton 1988).
Barcode data: rhinella marina 8
The following is a representative barcode sequence, the centroid of all available sequences for this
species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member
of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other
sequences.
TTAATCTTTGGTGCCTGAGCAGGAATAGTGGGAACTGCCCTCAGTCTTCTCATCCGAGCCGAACTGAGCCAACCAGGCTCCC
-- end -Download FASTA File
Conservation status 1,2
In their native range cane toads are common, and not considered in need of special conservation
efforts. Cane toads are considered one of the world's top 100 most widely-introduced species. Where
they have been introduced they are considered pests, and targets of extermination efforts.
US Fed eral Li st: no special status
CITES: no special status
IUCN R ed Li st of Th reaten ed Sp eci es: least concern
Life history, abundance, activity, and special behaviors 3
The mating call is long and has 12 notes/sec. The dominant frequencies are .35 and .7 kHz without
frequency modulation to clear harmonics ((Cole et.al. 1968).
Potential Impacts: This toad is highly toxic, secretions from the skin serve as a natural defense against
predators. The toxin is stored in the ovum, not the jelly coat. The toxicity of cane toads shifts rapidly
during the course of their lifetime. Toad eggs are extremely toxic, while later-stage tadpoles were less
toxic. Animals that bite these toads are often seriously affected, many are killed. Domestic dogs and
cats often are killed by the toxins. Native wild animals are also affected especially in places where the
toads are introduced (especially in places like Australia and in Florida, USA). Marine toads may compete
with and prey upon native amphibians (Rabor in Krakauer, 1968).
As an invasive species, cane toads have the potential to bring harmful viral pathogens to native fauna.
Scientists found that cane toads carried three of the 14 protozoan species of neotropical origin. Cane
toads in Australia also contain nematode lungworm, a parasite endemic to the Americas. While these
pathogens and parasites could potentially infect native frog species, observations show that infection
has not spread to other native species.
In addition to the direct impacts that cane toads may have on native fauna, the cane toad may also have
indirect impacts on food webs and population dynamics. For example, predation on dung beetles by
cane toads could reduce dung breakdown rates, affecting many aspects of ecosystem function. Toad
invasion can massively reduce the population of predators such as varanid lizards, elapid snakes,
freshwater crocodiles, and northern quolls that die from consuming cane toad toxins.
Metamorphosis occurs in tadpoles between 14 and 28 days after hatching, depending on the water
temperature. Eggs hatched late in the dry season will metamorphose before the late wet season, when
food is most readily available and moisture stress is reduced (Lampo and De Leo 1998). After
metamorphosis these toads leave the water and seek diurnal refuges to avoid dehydration and
predation. B. marinus uses hollow trees for shelter during the dry season and dense vegetation during
the wet season in addition to rock crevices which are used throughout the year (Seebacher and Alford
1999). These toads show more nocturnal activity and travel greater distances per night in Australia than
in South America (Seebacher and Alford 1999).
Introduced to many localities in the first half of the 20th century as a means to control sugar cane pests,
these toads have undergone a population explosion. They have established widespread ranges in these
non-native areas and attain higher densities in Australia than they do in their native range (Lampo and
De Leo 1998). This has caused much concern about the effects of B. marinus on native anuran species.
The eggs and hatchlings of B. marinus are toxic to many native predators in Australia. The predatory
frog species Limnodynastes ornatus showed decreased survivorship where it co-occurred with B.
marinus. However Limnodynastes rutella, which is preyed upon by L. ornatus, showed increased
survival rates (Crossland 2000). Bufo marinus can inhabit open land near human habitations and
sugarcane fields.
B. marinus is an opportunistic feeder, and readily feeds upon land snails as well as centipedes,
cockroaches, beetles, grasshoppers, ants, and small field mice. Stomach samples of this species in
particular areas of the world show that terrestrial gastropod prey can comprise over 40% of the
stomach contents (Hinckley 1963; Bailey 1976; Grant 1996). In laboratory trials under wet conditions, it
was found that B. marinus readily consumes a range of camaenid snail species. This makes it unique
from other anurans that typically do not prey upon molluscs. While some scientists have proposed that
B. marinus consumes vertebrates (e.g., ground-nesting birds such as bee-eaters), this has been found to
be very rare. In follow-up studies, cane toads avoided (rather than selected) birds and their eggs as prey
(Merops ornatus: Boland 2004).
B. marinus is primarily diurnal in activity, and lacks defense against ant species that are immune to
toad toxins. Freshwater crayfish, adult dytiscid diving beetles, dragonfly larvae, and mosquitoes are
among other native invertebrates that feed upon the cane toad without ill effects. However, leeches and
aquatic snails that feed on larval or adult toads often die from the toxins that are consumed. It should
be noted that other invertebrates vary in their susceptibility to toads. Some dytiscid diving beetle larvae
can consume hatchlings and tadpoles while others die. Belastomatid giant water bugs can consume
some developmental stages of tadpoles without ill-effect, but not others.
Cane toads can serve as an additional food source to vertebrates. Snakes like the keelback
(Tropidonophis mairii ) and slatey-grey snakes (Stegonotus cucullatus) can consume the cane toads
without dying, but keelbacks do show ill-effects. When given a choice, keelback snakes prefer native
frogs to cane toads (Llewelyn et al. 2009b). Similarly, raptors consume road-killed toads, but
preferentially select native frogs when given a choice. Water rats and introduced black rats frequently
consume cane toads.
Most species of Australian freshwater fish often mouth and spit out cane toad early life stages without
apparent ill effects. For the fly-specked hardyhead (Craterocephalus stercusmuscarum), the banded
and spangled grunters (Amniataba percoides and Leiopotherapon unicolor respectively), the purplespotted gudgeon (Morgurnda adspersa), glassfish (Family Ambassidae), western rainbowfish
(Melanotaenia australis), and black catfish (Neosilurus ater), consuming cane toad eggs or tadpoles are
toxic. However, most fish avoid cane toad early life stages because they can detect their noxiousness.
For most fish, toad eggs are likely to be more lethal than toad tadpoles.
In 1975, Covacevich and Archer reported that saltwater crocodiles (Crocodylus porosus) could ingest
cane toads without ill-effect, while freshwater crocodiles (Crocodylus johnstoni ) died after mouthing or
ingesting cane toads (Begg et al. 2000). In 1990, Freeland found that C. johnstoni actively hunts and
ingests cane toads. It was later reported in 2009 that the deaths of some freshwater crocodiles in the
Daly River were due to toad ingestion. A population-level impact study found 34 dead freshwater
crocodiles in the Victoria River caused by cane toad ingestion (Letnic et al., 2008). Evidence included a
wave of crocodile deaths moving upriver and coinciding with the areas in which cane toads were
invading, as well as toad remains found in the stomachs of some of the dead crocodiles.
Turtles also vary in their tolerance for cane toad toxicity. In some cases, turtles ingest toads without ill
effect, while other predation attempts by the same species result in fatality. The long-neck turtle
(Chelodina sp.) ate a dead cane toad without ill effect, while the saw-shelled turtles (Elseya latisternum)
and Krefft's river turtles (Emydura krefftii ) consumed toad tadpoles and were also unaffected. In a study
by Kruger, long-necked turtles (Chelodina rugosa) seized and spit out toad tadpoles and survived, yet
died after consumption of toad eggs.
The area of Australia invaded by cane toads contains high densities of lizards belonging to several
phylogenetic lineages. The impact of toads across the lineages is highly nonrandom. Fatal poisoning
occurs in three lineages: the Varanidae (goannas), the Scincidae (skinks), and the Agamidae (dragons).
Varanids often grow to large body sizes and are therefore more likely to attack a large cane toad more
readily than a lizard from most other lineages. Varanids often die after ingesting or mouthing cane
toads. Most species of scincid lizards have a relatively small adult body size. Due to their small body
size, most Scincid lizards are unlikely to be at risk from consuming a cane toad large enough to kill
them. However, some species such as the bluetongue skink (Tiliqua scincoides intermedia) readily
consume small toads and die as a result.
Snake species at risk from cane toads are frog-eating species that cannot tolerate toad toxins, can
swallow toads large enough to be fatal, and whose geographic distribution overlaps with that of the
cane toad. Using this criteria, 49 snake species were found to be potentially at risk from toad invasion.
The toad invasion is a potential threat to 70% of the Australian colubrid snakes, 40% of the pythons, and
41% of the elapids. Nine of the species that were deemed "at risk" are currently recognized as
threatened species on a federal or state level. Recent work on the feeding patterns of snakes in
captivity have shown that species that were previously identified as potentially at risk species were
reluctant to take cane toads as prey, or immediately rejected the cane toad after striking it. Colubrids
and pythons appear to be less at risk than the elapid snake species, with high mortality rates in death
adders (Acanthophis praelongus), black whip snakes (Demansia papuensis), and king brown snakes
(Pseudechis australis)(M. Greenlees et al. unpubl. data in Shine 2006).
In 1975, Covacevich and Archer reported that some crows (Corvus sp.) and kookaburras (Dacelo
novaeguineae) died after mouthing cane toads, while other individuals of the same species consumed
young or road-killed toads without showing any ill effects. At least seven native bird species can eat
toads successfully. Reasons for this tolerance may be because they eat only non-toxic parts of the toad
or because they are immune to the toxins. In 1997, Dorfman predicted that 76 species in the Kakadu
National Park were potentially under threat from cane toads. However, more recent studies by
Beckmann and Shine in 2009 have concluded that cane toads appear to have minimal impact on
Australian birds. The ability to survive toad invasion may be due to a widespread physiological
tolerance of bufotoxins, perhaps reflecting close genetic ties between Australian birds and taxa in Asia,
where many bufonid species are similar in toxicity to the cane toad.
In 2004, Webb and Glanznig listed nine species of native mammals and two species of introduced
mammals as potentially at risk from cane toad ingestion. Due to previous reports of domestic dogs
dying from mouthing cane toads, dingos may also be at risk. Feral cats and pigs also may be negatively
affected by cane toads. In captivity, native rodents (Melomys burtoni, Rattus colletti, R. tunneyi ) readily
killed and consumed small toads, but did not appear to suffer any ill effects. Other rodents (Must
domesticus, Pseudomys nanus, Zyzomys argurus) did not attack cane toads as prey at all. Small
dasyurid marsupial species, like planigales (Planigale ingrami, P. maculata) and dunnarts (Sminthopsis
virginiae) initially attacked toads, became ill as a result, and were later reluctant to attack toads.
Relatively few of these dasyurids died as a result of attempting to ingest toads. The species of mammal
that is most often a victim of toad invasion is the northern quoll, Dasyurus hallucatus. Lethal ingestion
of cane toads is responsible for the local extinction of northern quoll populations in the Mary River
region of Kakadu National Park. One study showed that only four of 14 quolls that died from toad
ingestion, suggesting that perhaps other factors may be playing a role in quoll extinction. However,
more recent studies show that seven out of eight quoll deaths resulted from ingestion of cane toads. In
addition, quolls have been killed by toads in areas where very few toads were spotted, suggesting that
even in low toad density areas, quolls are still threatened.
Cane toad impacts are affected by attributes of toad biology. Cane toads have a multiphasic life history.
Eggs and tadpoles reside in waterbodies, metamorphs are only found in riparian areas, and larger
juveniles and adults occupy large areas of drier landscape. In addition, the types and amounts of toxins
present in toads vary throughout their lifetime. One specific feature of the cane toad is that their highly
toxic eggs are coated in a non-toxic jelly, fooling aquatic predators into consuming them when they
would otherwise be able to detect bufotoxins in their prey (Greenlees and Shine 2010).
There also seems to be competitive interactions between cane toads and three species of native tree
frogs around waterholes in the Gulf of Carpentaria: Litora pallida, L. rothii , and L. rubella. Evidence
suggests that cane toads are likely to have a more adverse impact on larger terrestrial frogs like
Cyclorana australis and Limnodynastes convexiusculus. These impacts may be caused by direct
behavioral interference rather than competition for food. In a study done in 2009 by Pizzatto and Shine,
nine out of ten native frog species avoided sites scented by cane toad chemical cues (all except Litoria
rubella), and in 2007, Greenlees et al. found that the presence of cane toads reduced the nocturnal
activity levels of the native frog Cyclorana australis. Sexual harassment of female frogs by male toads is
also known to occur between native and introduced taxa in other phylogenetic linages (e.g. Valero et al.
2008). In addition to competition involving native anurans, other vertebrate species may also compete
with toads for limited resources. In 2004, Boland suggested that cane toads may compete with the
nesting burrows of bee-eaters, Merops ornatus.
Cane toads were first introduced into northern Australia in 1936, and have rapidly spread across 1.3
million square kilometers of northern and eastern Australia since (Urban et al., 2007). In northern
Australia, toad population expansion has accelerated steadily, from approximately 10 to 55 kilometers
per year. On the invasion front, toads move far distances (up to 1.8 km per night), and mostly move in
straight lines, actively using cleared areas such as roads as dispersal corridors (Brown et al., 2006;
Phillips et al., 2007). This expansion behavior can be compared with toads from older populations.
Currently, invasioni front individuals move more often, travel farther per move, and tend to move in
straighter lines. However, environmental correlates do not adequately explain these changes (Urban et
al., 2008). In order to test whether these differences in behavior resulted from evolution or just
plasticity associated with new toad environments, an experiment was created. The dispersal rates of
parent populations during the cane toads invasive history was measured and compared to dispersal
rates of the offspring. Through this collection method, researchers hoped to minimize environmental
effects on on dispersal ability and estimate the heritability of dispersal. 184 toads were radiotracked
over two seasons. Toads with larger bodies consistently moved farther than toads with normal or
smaller body sizes. The breeding cohort resulted in high levels of variance in daily dispersal of the
adult toads. This suggests that differences in birth date can have large influences in dispersal.The
estimate of mean within-population genetic variance was large and suggested a narrow sense
heritability of 0.24. In addition, there was a log mean daily displacement in this species with a large 95%
interval of 0.02-0.72. Thus, there is evidence to suggest that there does seem to be a heritable variance
within toad populations for dispersal. This selection on disperse could produce evolutionary change.
Female anurans have been shown to be the choosier sex, selecting mates that show good resource
defense techniques or attractive male displays. However, the only way that females can exercise mate
choice is by approaching a male with an attractive call or mating site. When a female approaches such
sites, she may be intercepted by a "satellite" male that attempts to mate with the female by grasping
her in amplexus (Wells 2007). This is particularly common in areas of high density. In a recent study
conducted with B. marinus, it was found that perhaps females are not just passive participants in the
mating process, but rather have a mechanism of exercising control. Evolutionarily, frogs and toads are
able to protect themselves from predators by inflating their bodies. This increased girth may deter
predators who may be threatened by an anuran that is too large to ingest. Similarly, female anurans
frequently inflate their bodies when being amplexed from males. In this sense, the female cane toads
could facilitate male-male competition by reducing the ability of undesirable mates to grasp onto her. In
females who were unable to inflate their bodies, the small "satellite" male was aable to grasp onto the
female despite takeover attempts by larger rivals. Body size of mates is a factor in female mate choice
because fertilization success is highest when the males and females are close in size. Since females are
the larger size, choosing a larger male increases the fitness of their offspring. Larger males are often
able to displace smaller males, but smaller males rarely displace larger rivals. However, smaller males
can resist takeover attempts if the female does not inflate her body. Therefore, this study shows that
takeovers by larger males can show female and male tactics in sexual selection.
Life history, abundance, activity, and special behaviors 3
According to the Global Amphibian Assessment (GAA), Bufo marinus is of least concern with regards to
extinction and its population is actually increasing. There are currently no significant threats to this
species. Some animals that have been introduced to Puerto Rico carry salmonella, putting species that
consume them at risk. In Bermuda, survival and development of tadpoles are being negatively affected
due to contaminants in ponds and the transfer of accumulated contaminants (Bacon et al. 2006).
Uses 1,2
This toad is considered the most widely-introduced amphibian species in the world. People have tried
to use it to control insects such as the greybacked cane beetle, Lepidoderma albohirtum which
threatened sugar cane production. However, there is no evidence that it has controlled any pest in
Australia and it is now considered a pest species itself in its introduced range of Australia and on
Pacific and Caribbean Islands. It preys on and outcompetes native amphibians and also causes
predator declines, since these predators have no natural immunity to the bufotoxin it secretes. (Bureau
of Rural Sciences 1998, Aguirre and Poss 1999).
N egati ve Imp acts: injures humans (poisonous ); household pest
Relation to humans 3
Humans are affected by the toxic skin secretions. Symptoms include irritation of the skin and burning of
the eyes (Wright and Wright, 1949; Krakauer, 1968, 1970; Behler, 1979; Carmichael and Williams, 1991;
Conant and Collins, 1991).
Marine toads have probably been introduced more widely than any other amphibian in the world
(Behler, 1979; Carmichael and Williams, 1991). They have been introduced as a control agent for insects
that damage sugarcane (Riemer, 1959; Krakauer, 1968; King, 1970), however, since they are nocturnal
and many sugarcane pests are diurnal, they are not effective biocontrol agents. For information on
introductions into Australia, please see Cane toad-Australia.
Human perceptions of the cane toad are largely negative, with many fearing its size, appearance, and
potential invasive impact on Australian communities. Between 1986 and 1996, the state and federal
government spent more than $9,500,000 (Shine et al. 2006) and enormous efforts by volunteers to
control local toad populations by collection. However, these negative community perceptions of invasive
species impacts are often in error. In actuality, the direct impact of cane toads falls heavily on a small
number of native taxa, not a wide spectrum of native fauna. Others suggest a more direct effect on
humans by claiming that toads are poisoning waterholes with their toxins and are even leading to drug
abuse for humans that become addicted to licking the toads or smoking their dried skins (Clarke et al.
2009). However, there are no data that actually supports these claims.
Recently, humans have thought that a native predator, the meat ant (genus Iridomyrmex), could control
the invasive cane toad populations. In an experimental setting, 98% of metamorph toads encountered
at least one predator ant species in a high density ant environment, while 87% of metamorph toads
encountered at least one predator ant species in a low density ant environment. Most of these toads
were attacked, with 82.5% killed at high density and 51% killed at low density. From these data, it
appears as though high ant density is more effective at controlling cane toad populations. There are
multiple reasons to explain why this may have occurred. First, higher density inevitably leads to more
encounters. In addition, at higher ant densities, ants are more likely to swarm onto a prey item. Lastly,
higher ant densities increase the body-size threshold at which metamorph toads shift their defense
mechanism from the active escape tactic to crypsis. As a result of this higher ant density, more toads of
a wider range of body sizes are killed.
In the field, smaller metamorph deaths were most commonly observed. This may be because small
metamorphs have a less effective response to ant attack and are also more vulnerable to disease and
parasites, such as lungworm (Kelehear 2007), as well as dessication (Child et al. 2008). In addition, the
low level of toxins in metamorphs make them even more susceptible to predator attack.
However, it should be noted that meat ants alone are not entirely feasible for controlling cane toad
populations. Meat ants are only effective at killing metamorph toads, and may be less effective during
the wet-season recruitment events. Increased ant densities might even serve as a food source for adult
cane toads. Many are also cautious because using biocontrol in other instances have often vastly
negatively affected ecosystems in ways that could not have been predicted. In this instance, the
predator is already a native species and is simply being redirected to areas with high populations of
cane toads. But reduced or increased populations of ants in certain areas may still affect native fauna,
and meat ants can still competitively exclude ecologically similar ant species.
References
1. Hilgris, R. 2001. "Rhinella marina" (On-line), Animal Diversity Web. Accessed April 27, 2013 at
http://animaldiversity.ummz.umich.edu/site/accounts/information/Rhinella_marina.html
2. © The Regents of the University of Michigan and its licensors, some rights reserved
3. © AmphibiaWeb © 2000-2011 The Regents of the University of California, some rights reserved
4. © Smithsonian Marine Station at Fort Pierce, some rights reserved
5. © Myra Hughey, some rights reserved
6. © Smithsonian Institution, National Museum of Natural History, Department of Vertebrate
Zoology, Division of Amphibians & Reptiles, some rights reserved
7. © Discover Life and original sources, some rights reserved
8. © Barcode of Life Data Systems, some rights reserved