Download Identification of an Apical Cl-/HCO3

Articles in PresS. Am J Physiol Gastrointest Liver Physiol (July 31, 2003).10.1152/ajpgi.00236.2003
Identification of an Apical Cl-/HCO3- Exchanger in Gastric
Surface Mucous and Duodenal Villus Cells
Jie Xu*, Sharon Barone*, Snezana Petrovic*#, Zhaohui Wang*, Ursula Seidler%,
Brigitte Riederer%, Krishnamurthy Ramaswamy$@, Pradeep K. Dudeja$@,
Gary E. Shull& and Manoocher Soleimani*#,
Departments of *Medicine and &Molecular Genetics, Biochemistry, and Microbiology,
University of Cincinnati, Cincinnati OH;
$
%University
of Tubingen, Germany;
Department of Medicine, University of Illinois at Chicago, Chicago, IL; and Veterans
Affairs Medical Centers at @West Side, Chicago, IL and #Cincinnati, OH
Running title: A bicarbonate transporter in surface epithelial cells
Address correspondence to M. Soleimani, M.D., Division of Nephrology and
Hypertension, Department of Medicine, University of Cincinnati, 231 Albert
Sabin Way, MSB G259, Cincinnati, Ohio 45267-0585
Phone: 513-558-5463 ; Fax: 513-558-4309; E-mail: [email protected]
Copyright (c) 2003 by the American Physiological Society.
Abstract
The molecular identity of the apical bicarbonate-secreting transporter in
gastric mucous cells remains unknown despite its essential role in preventing
injury and ulcer by gastric acid. Here we report the identification of a Cl-/HCO3exchanger that is located on apical membranes of gastric surface epithelial cells.
RT-PCR studies of mouse gastrointestinal tract mRNAs demonstrated that this
transporter, known as anion exchanger isoform 4 (AE4), is expressed in both
stomach and duodenum. Northern blot analysis of RNA from purified stomach
epithelial cells indicated that AE4 is expressed at higher levels in mucous cells
than in parietal cells. Immunoblotting experiments identified AE4 as a ~110-120
kDa protein in membranes from stomach epithelium and apical membranes from
duodenum. Immunocytochemical staining demonstrated that AE4 is expressed
in apical membranes of surface cells in both mouse and rabbit stomach and
duodenum. Functional studies in oocytes indicated that AE4 functions as a Cl/HCO3- exchanger. These data show that AE4 is an apical Cl-/HCO3- exchanger
in gastric mucous cells and duodenal villus cells. Based on its function and
location we propose that AE4 may play an important role in mucosal protection.
Key words: AE4, Cl-/HCO3- exchange, parietal cells, mucous cells, acid injury
2
Introduction
One of the major mechanisms for protection of the surface epithelium of the
stomach from injury by gastric acid is the presence of a layer of mucus
containing HCO3- (1-3), both of which are secreted by mucous cells. As acid
diffuses into the mucus gel it is neutralized by the secreted HCO3-, resulting in
the formation of a gradient in which the pH at the luminal surface of the
epithelium is relatively neutral (1). It has been suggested that the HCO3- secreted
from surface cells during gastric acid secretion may originate in part from
parietal cells (4, 5). Intracellular HCO3-, generated during acid secretion, exits the
basolateral membrane of the parietal cell via electroneutral Cl-/HCO3- exchange
(6, 7) and alkalinizes the blood, which perfuses the basal aspect of surface
epithelial cells (4, 5). The available evidence suggests that the HCO3- is taken up
by mucous cells, most likely via Na+/HCO3- cotransport (8, 9), and is then
secreted across the luminal membrane of surface mucous cells, thereby providing
protection from gastric acid.
The mechanism of HCO3- secretion by surface epithelial cells has been
studied by several groups, but remains controversial. In frog fundic mucosa,
HCO3- secretion was reported to have no effect on the transepithelial electrical
potential and to be dependent on luminal Cl-, suggesting that electroneutral Cl/HCO3- exchange was involved (10). These results have been disputed (11),
however, and there is evidence for a HCO3- conductance pathway (8).
Nevertheless,
electroneutral
Cl-/HCO3-
exchange
remains
an
attractive
3
possibility because the diffusion of H+ and Cl- into the mucus layer would both
neutralize outwardly transported HCO3- and provide Cl- for inward transport,
thereby maintaining a strong driving force for Cl-/HCO3- exchange. This
hypothesis has received support by the recent finding of a HCO3- secretory
mechanism in rat gastric mucosa that is sensitive to DIDS (12), an inhibitor of
some of the electroneutral Cl-/HCO3- exchangers and related transporters.
The identity of the apical anion transporter that mediates HCO3- secretion by
surface mucous cells is unclear, but members of either the SLC4 (Cl-/HCO3exchangers and Na+/HCO3- cotransporters) or SLC26 (anion exchangers,
including Cl-/HCO3- exchangers) families are potential candidates. Recently a Cl/HCO3- exchanger of the SLC4 family, termed anion exchanger (AE)1 isoform 4,
was cloned from rabbit kidney cortical collecting duct (13). It exhibits 48% amino
acid identity to the NBC1 Na+/HCO3- cotransporter and 32% identity to the AE2
Cl-/HCO3- exchanger (13). Functional studies in oocytes and cultured
mammalian cells indicated that AE4 mediates electroneutral Cl-/HCO3- exchange
and does not transport Na+ (13). Because of this functional property and despite
its greater similarity to the NBC subfamily it was named AE4. Based on its
localization on the apical membrane of β-intercalated cells in the cortical
collecting duct, it was postulated that AE4 mediates HCO3- secretion (13).
In the current studies, we investigated the gastrointestinal distribution of
AE4, as little is known about the expression of this transporter outside the
kidney. Our results indicate that AE4 mRNA is expressed in both stomach and
4
duodenum, and that it functions as Cl-/HCO3- exchanger when expressed in
oocytes. Immunocytochemical studies demonstrate that AE4 is localized on the
apical membranes of gastric surface epithelial cells and villi of the duodenum.
We propose that AE4 mediates apical HCO3- secretion in gastric surface
epithelium and duodenum, thereby protecting these tissues against acid injury.
5
Experimental Procedures
RT-PCR of AE4 in mouse and rabbit GI tract. A blast search of mouse EST
database against the rabbit AE4 sequence (GenBank Accession No. AB038263)
identified a mouse EST (Genbank Accession No. AW018362) with high degree of
sequence similarity. Based on the cDNA sequence of the mouse EST, the
following primers were designed (sense: CAT GCC TGG TGC TCA AGA AAG
CTA G and antisense: CAC TCA TGT TAC TGG GCC TGG TGG) and utilized for
RT-PCR experiments. RT-PCR was performed on RNA isolated from stomach,
duodenum and kidney using the above primers, which amplified a 412-base pair
fragment corresponding to nucleotides 66 to 482 of the EST.
For rabbit AE4, the following primers : GAAATGGGCCACTTGCACC (sense)
and AATTGACAGAGGCAGCCATAGG (antisense) were designed based on
rabbit AE4 cDNA sequence (GenBank Accession No. AB038263). The primers
were used for RT-PCR in various tissues and a PCR fragment corresponding to
nucleotides 992 to 1595 of the rabbit AE4 cDNA was isolated. The reason for
using different sets of primers for mouse and rabbit was due to DNA sequence
differences in these two species.
RNA isolation and Northern blot hybridization. Total cellular RNA was
extracted from mouse duodenum, stomach, and kidney and rabbit gastric
parietal and mucous cells using Tri Reagent. Hybridization was performed
according to the method of Church and Gilbert (14). The membranes were
washed, blotted dry and exposed to a PhosphorImager screen (Molecular
6
Dynamics, Sunnyvale, CA). 32P-labeled mouse or rabbit AE4 PCR fragments (see
above) were used as hybridization probes.
Immunocytochemistry of AE4 in stomach and kidney.
Antibodies. For AE4, a synthetic peptide corresponding to amino acids
residues CLMYQPKAPEINISVN of mouse AE4 (using a mouse AE4 EST with
Gene Bank accession number: AW018362) was used to generate polyclonal
antibodies in two rabbits. This sequence is identical in mouse, rabbit, and human
AE4. Antibodies were purified using a cysteine affinity column. A human AE4
polyclonal antibody was purchased from Alpha diagnostics, San Antonio, TX
(see below). Gastric H-K-ATPase β-subunit antibody was a generous gift from
Dr. John Forte (University of California at Berkeley).
Immunoblotting of AE4 in stomach and duodenum- Mouse microsomal
membranes from the scrapings of gastric epithelium and apical membrane
vesicles from the duodenum were isolated according to established methods and
as described (15, 16). For mouse, immunoblotting experiments were carried out
as previously described (16). Briefly, the solubilized membrane proteins were
size fractionated on 8% SDS polyacrylamide minigels (Novex, San Diego, CA)
under denaturing conditions, electrophoretically transferred to nitrocellulose
membranes, blocked with 5% milk proteins, and then probed with the affinity
purified anti-AE4 immune serum at an IgG concentration of 0.6 µg/ml. The
secondary antibody was donkey anti-rabbit IgG conjugated to horseradish
peroxidase (Pierce). The antigen-antibody complexes on the nitrocellulose
7
membranes were visualized by chemiluminescence (SuperSignal Substrate,
Pierce) and the image captured on light sensitive imaging film (Kodak).
For human duodenum, apical and basolateral membrane vesicles were
isolated from two organ donors utilizing established methods (17) and in
accordance with the institutional protocols approved by the University of Illinois
at Chicago. Seventy-five (75) µg each of purified brush-border and basolateral
membranes were solubilized in Laemmli sample buffer, separated on 7% SDSPAGE, transferred to Hybond nitrocellulose membranes (Amersham Biosciences,
Piscataway, NJ) and visualized with Ponceau stain to ensure the efficiency of the
transfer. After blocking with 5% non-fat dry milk in phosphate-buffered saline
(1X PBS)/0.1%Tween-20, blots were incubated with affinity purified rabbit antihuman-AE4 antibody (Alpha diagnostics, San Antonio, TX) diluted (1:150) in 1X
PBS/ 0.1%Tween-20/ 1%milk overnight at 4°C. After four washes with 1X PBS/
0.1%Tween-20, blots were then incubated with horse-radish peroxidase goat antirabbit IgG secondary antibody (Santacruz Biotech, Santacruz, CA) diluted in 1X
PBS/ 0.1%Tween-20/ 1%milk for 1h at room temperature. After five washes with
1X PBS/ 0.1%Tween-20/, the bands were visualized using an enhanced
chemiluminescence system (Amersham Biosciences, Piscataway, NJ). To
determine antigen specificity, in a separate experiment AE4 control peptide
(30µg/ml, sequence near the cytoplasmic C-terminus of human AE4, Alpha
diagnostics, San Antonio, TX) was pre-incubated with the antibody solution
(5µg/ml) at 37 °C for 2 h before adding to the blot.
8
Immunofluorescense labeling studies. Mice were euthanized with an
overdose of sodium pentobarbital and perfused through the left ventricle with
0.9% saline followed by cold 4% paraformaldehyde in 0.1 M sodium phosphate
buffer (pH 7.4). Rabbits were euthanized with an overdose of sodium
pentobarbital via ear lobe vein and perfused through the left ventricle similar to
mice . Stomachs and duodena were removed, cut in tissue blocks, and left in the
fixative solution overnight at 4 0C. For cryosections, tissue blocks were removed
from the fixative solution and soaked in 30 % sucrose overnight. The tissue was
frozen on dry ice, and 5 µm sections were cut with a cryostat and stored at –80 °C
until used.
Single and double immunofluorescence labeling were performed as described
recently (15).
For double labeling with H-K-ATPase, gastric H-K-ATPase β-
subunit antibody was diluted at 1:250. Goat-anti-rabbit IgG conjugated with
Oregon Green 488 and goat anti-mouse IgG conjugated with Alexa Fluor 568 Dye
(Molecular Probes, Eugene, OR) were used at 1:150 dilution for AE4 and H-KATPase, respectively. Sections were examined and images were acquired on a
Nikon PCM 2000 laser confocal scanning microscope as 0.5 µm optical sections of
the stained cells.
Cloning of AE4 cDNA. Full-length human AE4 cDNA was cloned from a human
kidney cDNA library by PCR using the following primers: 5'-GAC TGT ACT
GGT TCT GAG ATT CTG TGC AAG and 5'-CTG CGG GCT TAC TGG AGA
TAT TAT TTA GGG, which were designed based on sequences from the human
9
genome data base. PCR amplification of the human AE4 cDNA was performed
using the CLONTECHTM Advantage 2 PCR kit protocal. Each PCR reaction
contained 5 µl cDNA, 5 µl 10X PCR buffer, 1 µl 10 mM dNTPs, 10 pmoles of each
primer, and 1 µl Advantage 2 Polymerase mix in a final volume of 50 µl. Cycling
parameters were: 95o C, 1 min; 95o C, 30 s; and 68o C, 4 min. A~3.2 kb PCR
fragment was obtained which contained the full-length coding region of the
exchanger. The product was gel-purified and subcloned into the pGEM-T easy
vector for expression studies.
Expression of AE4 cRNA in Xenopus oocytes. The capped AE4 cRNA was
generated using mMESSAGE mMACHINETM Kit (Ambion, Inc.) according to
manufacturer’s instruction. Xenopus oocytes were injected with 50 nl of the
human AE4 cRNA (0.2 – 1.3 µg/µl) using a Drummond 510 microdispenser via a
sterile glass pipette.
pHi studies. Intracellular pH (pHi) in oocytes was measured with the pH
sensitive
fluorescent
probe
2’,7’-bis-(2-carboxyethyl)-5-(and-6)-
carboxyfluorescein (BCECF) (Molecular Probes, Eugene, OR) as described (16).
Briefly, oocytes were loaded with 10µM BCECF-acetoxymethyl ester for 20
minutes at room temperature in the same medium in which they were kept after
cRNA injection. Oocytes were than transferred to the 1 ml perfusion chamber,
placed on the nylon mesh with vegetable pole facing the fluorescent beam and
perfused at rate of
3 ml/min with the following solution (mM): NaCl 63,
NaHCO3 33, KCl 2, CaCl2 1.8, MgCl2 1, and HEPES 5. Another 20 to 30 minutes
10
were allowed for the equilibration and dye ester hydrolysis, which yields the
fluorescent probe. Ratiometric fluorescence measurements were performed using
Attofluor digital imaging system (Attofluor Inc., Rockwell MD). Excitation
wavelengths were 450nm and 490nm and fluorescence emission intensity was
recorded at 520 nm. Ratios were calculated and stored. Data analyses were
performed using Attograph and Attoview software packages provided with the
imaging system. Background signal (always less than 1%) was recorded and
automatically subtracted from the subsequent fluorescence measurements. The
ratios were obtained from the submembrane region of the oocytes that were
visualized with a 10x objective. Measured excitation ratios were converted to pHi
by using a calibration curve that was constructed with high K+/nigericin method
at the end of each experiment (16).
To test for Cl-/HCO3- exchange activity, the chamber was first perfused with
solution containing 63 mM NaCl and 33 mM NaHCO3. The oocytes were then
switched to Cl--free medium (63 mM Na-gluconate and 33 mM NaHCO3-). All
other Cl--containing chemicals (KCl, etc.) were replaced with gluconate salts.
This maneuver results in cell alkalinization due to reversal of Cl-/HCO3exchange (16). Upon pHi stabilization in Cl--free medium, oocytes were switched
back to the Cl--containing solution. This should result in cell acidification back to
baseline due to activation of Cl-/HCO3- exchange. The initial rate of cell pHi
11
recovery was used as the rate of Cl-/HCO3- exchange activity (16). In additional
studies, experiments were repeated with Na+-free solutions, with tetramethyl
ammonium Cl replacing NaCl and choline HCO3 replacing NaHCO3.
Rabbit gastric cell purification. Rabbit gastric mucous and parietal cells were isolated
as described (7) and processed for total RNA isolation. The use of rabbit in these studies
was for the purpose of determination of the gastric epithelial cell origin of AE4, as
reasonably purified mucous and parietal cells have been successfully isolated from rabbit
stomach.
Materials-
32P-dCTP
was purchased from New England Nuclear (Boston, MA).
Nitrocellulose filters and other chemicals were purchased from Sigma Chemical
Co. (St. Louis, MO). RadPrime DNA labeling kit was purchased from Gibco
BRL, USA. BCECF was from Molecular Probes Inc (Eugene, Oregon).
mMESSAGE mMACHINETM Kit was purchased from Ambion (Austin, Texas).
All the other chemicals were from Sigma Chemicals (St Louis, MI).
Statistical Analyses. Values are expressed as mean ± SEM. The significance of
differences between mean values were examined using ANOVA. P < 0.05 was
considered statistically significant.
12
Results
AE4 mRNA expression in the upper gastrointestinal tract. To examine the
distribution of AE4 mRNA in stomach, RT-PCR was performed using RNA
isolated from mouse stomach and compared to that of kidney using mouse
specific primers (Experimental Procedures). Figure 1a shows ethidium bromide
staining of an agarose gel, which revealed that the expected PCR fragment of 412
base pairs is amplified from mouse stomach and kidney. The sequence of the gelpurified PCR product from kidney and stomach was determined, verifying the
product as AE4. The above results demonstrate that in addition to the kidney,
AE4 is expressed in the stomach.
Expression of AE4 mRNA in gastric mucous and parietal cells. To
determine the cellular distribution of AE4 mRNA in the stomach, RNA was
isolated from parietal and mucous cells of rabbit stomach and analyzed by RTPCR using rabbit-specific primers. Figure 1b shows an ethidium bromide stained
agarose gel, demonstrating that the expected PCR fragment (~600 bp), which was
verified by sequence analysis, was amplified from both mucous and parietal
cells. The results of these RT-PCR experiments were verified by Northern
hybridization analysis, which demonstrated that AE4 mRNA is expressed in
both gastric mucous and parietal cells (Fig. 1c). The use of rabbit in these series of
studies was for the purpose of determination of epithelial cell origin of AE4. As is
known, rabbit is the only mammalian species that has successfully been used for the
isolation of reasonably purified mucous and parietal cells.
13
Immunoblotting and immunofluorescense labeling of AE4 in stomach and
duodenum. To determine the protein expression of AE4, microsomal membrane
proteins from scrapings of the gastric epithelium and apical membrane vesicles
from the duodenum were isolated from mouse and subjected to immunoblot
analysis. Figure 2a shows an immunoblot analysis of microsomal membranes
from mouse stomach, which demonstrates that AE4 appears as a ~120 kDa
protein. The reaction is specific as the preadsorbed immune serum failed to
detect the band (Fig. 2a). To determine the cellular distribution and subcellular
localization of AE4, immunocytochemical staining was performed on sections of
mouse stomach. As shown in Figure 2b, AE4 is expressed on the apical
membrane of surface epithelial cells (left panel). The preadsorbed immune serum
did
not
detect
any
labeling
(right panel). Figure 2c shows double
immunofluorescence labeling with AE4 and gastric H-K-ATPase β-subunit in
mouse stomach. It demonstrates that the H-K-ATPase is restricted to parietal
cells, as expected, whereas AE4 is expressed primarily in surface epithelial cells,
with lower levels of expression in gastric parietal cells. The staining in parietal
cells was variable, with intracellular labeling being more frequent than the apical
labeling. No basolateral labeling in parietal cells was observed.
In the next series of studies we examined the localization of AE4 in rabbit
stomach by immunofluorescence labeling. As shown in Fig. 3a, AE4 is located on
the apical membrane of surface epithelial cells in rabbit stomach. As a control
and in order to verify that the AE4 antibody indeed recognizes the AE4 protein,
14
double immunofluorescence labeling with AE4 and peanut lectin binding protein
was performed in rabbit kidney. As indicated in Fig. 3b, AE4 and peanut lectin
binding protein, which labels only the apical membrane of β-intercalated cells,
co-localize to the same membrane domain. These results indicate that the AE4
immune serum recognizes only the AE4 protein and does not cross-react with
other proteins. It further verifies the results of molecular studies in which AE4
was cloned from β-intercalated cells of rabbit kidney and shown to be expressed
only in those same cells (13).
The experiments shown in Figure 4 examine the expression and subcellular
localization of AE4 in mouse, rabbit and human duodenum. In human, AE4
appears as a ~110 kDa band in apical membranes of the duodenum (Fig. 4a, left
panel) but not in basolateral membranes (Fig. 4a, left panel). Preadsorbed
immune serum did not react with any proteins (Fig. 4a, right panel). In the
mouse, AE4 appears as a ~120 kD protein in apical membrane vesicles from the
duodenum (Fig. 4b, left panel). No labeling was observed with the preadsorbed
immune serum (Fig. 4b, right panel).
The results of the above experiments indicate that AE4 is localized to the
apical membrane proteins of the duodenum in both mouse and human. To
determine the cellular distribution and subcellular localization of AE4 in the
duodenum in more detail, immunofluorescence labeling was performed in
mouse and rabbit duodenum. In mouse duodenum, AE4 is expressed exclusively
on apical membranes of epithelial cells in the villi (Fig. 5a, left panel). No
15
labeling was detected with the preadsorbed immune serum (Fig. 5a, right panel).
In rabbit, the preadsorbed immune serum showed non-specific labeling in the
basolateral membrane of villi in the duodenum (Fig. 5b, right panel). Compared
to the preadsorbed serum, the AE4 immune serum specifically labeled the apical
membranes of villi in the duodenum (Fig. 5b, left panel).
Functional expression of AE4. Two recent studies indicated that AE4 is a Cl/HCO3- exchanger (13, 21). The purpose of the next series of experiments was to
examine and verify the functional identity of AE4 using the oocyte expression
system. In the first series of experiments, oocytes were injected with human AE4
cRNA, loaded with BCECF in the presence of a Cl- and HCO3--containing
solution (Experimental Procedures), and intracellular pH was monitored. The
representative pHi tracings in Fig. 6a demonstrate that switching to a Cl--free
solution resulted in a rapid intracellular alkalinization in oocytes expressing
AE4. Switching back to the Cl--containing solution caused a return of pHi to
baseline. No pHi alteration in response to exposure to the Cl--free medium was
observed in control (water-injected) oocytes (Fig. 6a). In the absence of HCO3- in
the media, the rate of cell alkalinization in response to Cl- removal was minimal.
These results are consistent with AE4 functioning as a Cl-/HCO3- exchanger. A
summary of multiple experiments is shown in Fig. 6b and demonstrates that the
rate of Cl-/HCO3- exchange activity was 0. 14 ± 0. 01 in oocytes expressing AE4
(n = 5). The baseline pHi in CO2/HCO3--containing solutions was 7.14 ± 0.03 in
water-injected oocytes and 7.17±0.03 in AE4-injected oocytes (p>0.05, n=5). The
16
Cl-/base exchange activity in control oocytes was not significantly different from
zero (Fig. 6a and b). The absence of Na+ in the media did not prevent cell
alkalinization in response to Cl- removal, indicating that AE4-mediated Cl/HCO3- exchange is independent of Na+. In the absence of HCO3-, the rate of Cl/base exchange activity (mediated by Cl-/OH- exchange) was minimal,
indicating the low affinity of AE4 for OH-. AE4 did not function in a Na+:HCO3cotransport mode (data not shown).
17
Discussion
The lumen of the stomach is exposed to an acidic solution secreted from
gastric parietal cells, which can achieve a pH as low as 1.5 (18-20). To protect
itself against the corrosive effects of luminal acid, the gastric surface epithelium
secretes a HCO3--rich fluid into the mucus gel layer (1). Despite the essential
role of HCO3- secretion in mucosal protection, the molecular identity and
functional characteristics of the transporter(s) responsible for this process has
remained unclear. The results of the present study show that in addition to its
expression in kidney, AE4 mRNA is expressed in the stomach and in the
duodenum,
which
is
also
exposed
to
gastric
acid.
Furthermore,
immunohistochemical staining demonstrated that expression of AE4 protein in
the stomach occurs predominantly in the apical membrane of surface epithelial
cells and that its expression in the duodenum is restricted to the apical
membranes of villus cells. Expression of AE4 in parietal cells was mostly
limited to the cytoplasmic region with faint and occasional apical labeling.
Functional expression of AE4 in oocytes confirmed previous studies showing
that this transporter mediates Cl-/HCO3- exchange (13). These observations
suggest that AE4 is responsible, at least in part, for HCO3- secretion into the
mucus layer of the gastric epithelium and across the apical membrane of villus
cells in the duodenum, consistent with the hypothesis that it plays an important
role in mucosal protection in both organs.
18
There are conflicting studies on the nature of HCO3- secreting transporter(s)
in gastric surface epithelial cells. While a Cl-/HCO3- exchanger has been
proposed to be the primary mechanism for HCO3- secretion in frog gastric
mucosa (10), other investigators have proposed that a HCO3- conductive
pathway is responsible for this activity (11). AE4 functions as a Cl-/HCO3exchanger in heterologous expression systems (13, 21 and current studies),
indicating that at least a portion of the HCO3- secretion in surface epithelial cells
is likely to be mediated by this transporter operating in a Cl-/HCO3- exchange
mode. A recent preliminary study2 suggested that AE4 may also function as an
electroneutral Na:HCO3- cotransporter. Our functional expression studies in
oocytes did not reveal Na:HCO3- cotransport activity by AE4, confirming recent
results indicating that AE4 only functions in a Cl-/HCO3- exchange mode (13).
These results not withstanding, either Cl-/HCO3- exchange or Na:HCO3cotransport activity via AE4 would function in a HCO3- secreting mode, as
luminal acidity precludes the functioning of AE4 (or any bicarbonate
transporter) in a net bicarbonate-absorbing mode. As an apical Cl-/HCO3exchanger AE4 can neutralize the gastric acidity according to the following
scheme. Following secretion into the gastric lumen via coordinated action of gastric HK-ATPase and apical Cl- channel in parietal cells, the resulting HCl dissociates into H+
and Cl-. The secreted Cl- will be exchanged with intracellular bicarbonate via the Cl/HCO3- exchanger AE4 located on the apical membrane of mucous cells. The net effect
of these processes is the secretion of HCl by parietal cells and the secretion of
19
bicarbonate from mucous cells for protection against injury by the acid. In the case of
proton pump inhibitors, inhibition of acid secretion is associated with decreased
generation of bicarbonate which in turn leads to reduced bicarbonate exit across the
baolsateral membrane of parietal cells, eventually reducing the uptake of bicarbonate by
mucous cells (presumably via basolateral NBC). The reason that gastric luminal pH
does not climb very high in response to PPI might be due to decreased intracellular
bicarbonate concentration in mucous cells secondary to decreased bicarbonate
generation in parietal cells.
Recent studies have identified a family of anion exchangers, referred to
SLC26A family, which include at least ten distinct genes (17, 22-34). Three wellknown members of this family are SLC26A3 (or DRA), SLC26A4 (or pendrin)
and SLC26A6 (PAT1 or CFEX) (23, 27, 29), which are located apically in a limited
and distinct number of epithelia and function as Cl-/OH-/HCO3- exchanger s (16,
31, 35). DRA is predominantly expressed in the large intestine with lower levels
in the small intestine (35) whereas PAT1 is predominantly expressed in the small
intestine with very low expression levels in the large intestine (16). Pendrin is
located on the apical membrane of thyroid follicular cells and kidney collecting
ducts (28, 31). None of these exchangers are expressed on the apical membrane of
surface epithelial cells in the stomach. In mouse stomach, immunocytochemical
staining localized PAT1 to the tubulovesicle membranes of gastric parietal cells
(15) whereas it failed to detect the expression of pendrin despite detectable
mRNA levels (data not shown).
20
In addition to the stomach, AE4 is expressed in the duodenum.
Immunoblotting or immunocytochemical staining demonstrates that AE4 is
expressed on the apical membrane of mouse, rabbit and human duodenum.
This observation is intriguing as it confirms that more than one apical Cl/HCO3- exchanger is expressed in the duodenum. Recently, PAT1 (SLC26A6)
was identified as a major Cl-/HCO3- exchanger in the apical membrane of the
duodenum (16), along with the DRA (SLC26A3) Cl-/HCO3- exchanger (35). Our
studies in the duodenum indicate that the expression levels of PAT1 are the highest
followed by DRA and AE4 (ref. 16 and unpublished data). It would be difficult to
conclude that, based on the expression level studies in the duodenum, one anion
exchanger (i.e. PAT1) might be the major transporter mediating bicarbonate secretion
(or chloride absorption) and the others are not. The presence of more than one apical
bicarbonate-transporter in the duodenum suggests possible differential
regulation of these transporters in physiologic or pathophysiologic states.
Studies are underway to examine the regulation of AE4, PAT1 and AE4 in
disease states associated with defective bicarbonate secretion, such as cystic
fibrosis or treatment with non-steroidal anti-inflamatory drugs.
In conclusion, AE4 is expressed in the upper gastrointestinal tract, with
expression in the small intestine and stomach. Immunohistochemical staining
or immunoblotting studies localized AE4 to the apical membranes of surface
epithelial cells in the stomach and to the apical domain of villus cells in the
duodenum. Functional studies demonstrated that AE4 operates in an
21
electroneutral Cl-/HCO3- exchange mode. We propose that AE4 is an apical
HCO3- transporter in surface epithelial cells of the stomach and villus cells of
the duodenum, and that it may play an important role in protecting the gastric
and duodenal epithelium against injury by the acid secreted from gastric
parietal cells.
22
References:
1. Engel E, Guth PH, Nishizaki Y, and Kaunitz JD. Barrier function of the gastric
mucus gel. Am J Physiol Gastrointest Liver Physiol 269: G994-G999, 1995.
2. Flemstrom G. Gastric and duodenal mucosal bicarbonate secretion. In: Physiology
of the Gastrointestinal Tract (3rd ed.). edited by Johnson LR, Jacobson ED,
Christensen J., Alpers D, and Walsh JH. New York:Raven, 1994, p.1285-1309.
3. Schade C, Flemstrom G, and Holm, L. Hydrogen ion concentration in the mucus
layer on top of acid-stimulated and –inhibited rat gastric mucosa. Gastroenterology
107: 180-188, 1994.
4. Gannon B, Browning J, and O’Brien P. The microvascular architecture of the
glandular mucosa of rat stomach. J Anat 135: 667-683, 1982.
5. Gannon B, Browning J, O’Brien P, and Rogers P. Mucosal microvascular
architecture of the fundus and body of human stomach. Gastroenterology 86: 866875, 1984.
6. Muallem S, Burnham C, Blissard D, Berglindh T, and Sachs G. Electrolyte
transport across the basolateral membrane of parietal cells. J Biol Chem 260:
6641-6653, 1985.
7. Rossmann H, Bachmann O, Wang Z, Shull GE, Obermaier B, Stuart-Tilley A,
Alper SL, Seidler U. Differential expression and regulation of AE2 anion
exchanger subtypes in rabbit parietal and mucous cells. J Physiol 534: 837-848,
2001.
8. Curci S, Debellis L, Caroppo R, and Fromter E. Model of bicarbonate secretion
by resting frog stomach fundus mucosa. I. Transepithelial measurements. Pfluegers
Arch 428: 648-654.
23
9. Rossmann H, Bachmann O, Vieillard-Baron D, Gregor M, and Seidler U.
Na+/HCO3- cotransport and expression of NBC1 and NBC2 in rabbit gastric parietal
and mucous cells. Gastroenterology 116: 1389-1398, 1999.
10. Flemstrom G. Cl- dependence of HCO3- transport in frog gastric mucosa. Upsala J
Med Sci 85: 303-309, 1980.
11. Takeuchi K, Merhav A, and Silen W. Mechanism of luminal alkalinization by
bullfrog fundic mucosa. Am J Physiol 243: G377-G388, 1982.
12. Phillipson M, Atuma C, Henriksnas J, and Holm L. The importance of mucus
layers and bicarbonate transport in preservation of gastric juxtamucosal pH. Am J
Physiol 282: G211-G219, 2002.
13. Tsuganezawa H, Kobayashi K, Iyori M, Araki T, Koizumi A, Watanabe S,
Kaneko A, Fukao T, Monkawa T, Yoshida T, Kim DK, Kanai Y, Endou H,
Hayashi M, Saruta T. A new member of the HCO3- transporter superfamily
is an apical anion exchanger of β-intercalated cells in the kidney. J Biol Chem
276: 8180-8189, 2001.
14. Church GM, and Gilbert W. Genomic sequencing. Proc. Nat. Acad. Sci. USA
81: 1991-1995, 1984.
15. Petrovic S, Wang Z, Ma L, Seidler U, Forte JG, Shull GE, and Soleimani
M. Co-localization of the apical Cl-/HCO3- exchanger PAT1 and gastric H-KATPase in stomach parietal cells. Am. J. Physiol Gastrointest Liver Physiol 283:
G1207-G1216.
24
16. Wang Z, Petrovic S, Mann E, Soleimani M. Identification of an apical Cl/HCO3- exchanger in the small intestine. Am J Physiol Gastrointest Liver
Physiol 282: G573-G579, 2002.
17. Rajendran, V.M., Harig J.M., Adams M.B., and Ramaswamy K. Transport of
acidic amino acids by human jejunal brush border membrane vesicles. Am. J.
Physiol. 252:G33-G39, 1987.
18. Allen A, Flemstrom G, Garner A, and Kivilaakso E. Gastroduodenal mucosal
protection. Physiol Rev 73: 823-57, 1993.
19. Feldman M. Gastric secretion: Normal and abnormal. In: Gastrointestinal and
Liver Disease: Pathophysiology/Diagnosis/Management (2nd ed.). edited by
Feldman MD, Scharschmidt BF, Sleisenger MH, Klein SWB. Saunders, 1998,
p587-603.
20. Garner A, Flemstrom G, Allen A, Heylings JR, McQueen S. Gastric mucosal
protective mechanisms: roles of epithelial bicarbonate and mucus secretions. Scand.
J Gastroenterol Suppl. 101: 79-86, 1984.
21. Ko SB, Luo X, Hager H, Rojek A, Choi JY, Licht C, Suzuki M, Muallem S,
Nielsen S, and Ishibashi K. AE4 is a DIDS-sensitive Cl-/HCO3 exchanger
in the basolateral membrane of the renal CCD and the SMG duct. Am J
Physiol Cell Physiol 283: C1206-18, 2002.
22. Bissig M, Hagenbuch B, Stieger B, Koller T, and Meier PJ. Functional
expression cloning of the canalicular sulfate transport system of rat hepatocytes. J
Biol Chem 269: 3017-3021, 1994.
25
23. Everett LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, Adawi F,
Hazani E, Nassir E, Baxevanis AD, Sheffield VC, and Green ED. Pendred
syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat
Genet 17: 411-422, 1997.
24. Hastabacka J, de la Chapelle A, Mahtani MM, Clines G, Reeve-Daly MP, Daly
M, Hamilton BA, Kusumi K, Trivedi B, Weaver A, Coloma A, Lovett M,
Buckler A, Kaitila I, and Lander ES. The diastrophic dysplasia gene encodes a
novel sulfate transporter: positional cloning by fine-structure linkage disequilibrium
mapping. Cell 78: 1073-1087, 1994.
25. Hoglund P, Haila S, Socha J, Tomaszewski L, Saarialho-Kere U, KarjalainenLindsberg, M-L, Airola K, Holmberg C, Chapelle A, and Kere, J. Mutations of
the Down-regulated in adenoma (DRA) gene cause congenital chloride diarrhea Nat
Genet 14: 316-319, 1996.
26. Lohi H, Kujala M, Makela S, Lehtonen E, Kestila M, Saarialho-Kere U,
Markovich D, Kere J. Functional characterization of three novel tissue-specific
anion exchangers: SLC26A7, A8 and A9. J Biol Chem 277: 14246-14254, 2002.
27. Lohi H, Kujala M, Kerkela E, Saarialho-Kere U, Kestila M, and Kere J.
Mapping of five new putative anion transporter genes in human and
characterization of SLC26A6, a candidate gene for pancreatic anion exchanger.
Genomics 70: 102-12, 2000.
28. Royaux IE, Wall SM, Karniski LP, Everett LA, Suzuki K, Knepper MA,
Green ED. Pendrin, encoded by the Pendred syndrome gene, resides in the apical
26
region of renal intercalated cells and mediates bicarbonate secretion. Proc Natl
Acad Sci U S A. 98: 4221-6, 2001.
29. Schweinfest CW, Henderson KW, Suster S, Kondoh N, and Papas TS.
Identification of a colon mucosa gene that is down-regulated in colon adenomas and
adenocarcinomas. Proc Natl Acad Sci U.S.A. 90: 4166-4170, 1993.
30. Knauf F, Yang CL, Thomson RB, Mentone, SA, Giebisch G, and Aronson
PS. Identification of a chloride-formate exchanger expressed on the brush
border membrane of renal proximal tubule cells. Proc Natl Acad Sci U S A.
98:9425-30, 2001.
31. Soleimani M. Molecular physiology of the renal chloride-formate
exchanger. Curr. Opin Nephrol Hypertens 10: 677-83, 2001.
32. Zheng J, Shen W, He DZ, Long KB, Madison LD, Dallos P. Prestin is the motor
protein of cochlear outer hair cells. Nature 405: 149-55, 2000.
33. Jacob P, Rossmann H, Lamprecht G, Kretz A, Neff C, Lin-Wu E, Gregor M,
Groneberg DA, Kere J, and Seidler U. Down-regulated in adenoma mediates
apical Cl-/HCO3- exchange in rabbit, rat, and human duodenum. Gastroenterology
122: 709-724, 2002.
34. Vincourt JB, Jullien D, Kossida S, Amalric F, Girard JP. Genomics. 79:249-56,
2002.
35. Melvin, JE, Park K, Richardson L, Schultheis PJ, and Shull GE. Mouse
Down-Regulated in Adenoma (DRA) is an intestinal Cl-/HCO3- exchanger
27
and is upregulated in colon of mice lacking the NHE-3 Na+/H+ exchanger.
J Biol Chem 274: 22855-22861, 1999.
28
Acknowledgments
These studies were supported by National Institutes of Health Grants DK 54430
(M.S.), DK50594 (to G.E.S.), DK54016 (P.K.D), and DK 33349 (K.R), Merit Review
grants from the Department of Veterans Affairs (M.S., P.K.D., K.R), a Cystic
Fibrosis Foundation Grant and grants from Dialysis Clinic Incorporated (to M.S).
Footnotes
1
AE, anion exchanger (the number following AE indicates the specific isoform);
RT-PCR, reverse transcriptase-polymerase chain reaction; PCR, polymerase chain
reaction.
2Parker
MD, Boron WF, and Tanner MJA. Characterization of human AE4 as an
electroneutral, sodium-dependent bicarbonate transporter. FASEB J. 16: A796,
2002.
29
Figure legends:
Fig. 1. Expression of AE4 mRNA in the gastrointestinal tract. A, Mouse kidney
and stomach RNA was analyzed by RT-PCR in the presence or absence of
reverse transcriptase (RT) using mouse AE4-specific primers, and the products
were fractionated by agarose gel electrophoresis. Ethidium bromide staining
shows amplification of the expected PCR fragment (~420 bp) in both tissues. B,
RNA from rabbit mucous and parietal cells was analyzed by RT-PCR in the
presence (+) or absence (-) of reverse transcriptase (RT) using rabbit AE4-specific
primers, and the products were fractionated by agarose gel electrophoresis.
Ethidium bromide staining shows amplification of the expected PCR fragment
(~600 bp) in both cell types. C, Northern hybridization analysis of AE4 mRNA
from rabbit mucous and parietal cells reveals AE4 expression in both cell-types.
Fig. 2. Immunoblotting and Immunocytochemical staining of AE4 in mouse
stomach. A, Immunoblot analysis of AE4 in microsomal membranes from
stomach. Left panel: AE4 immune serum identifies a ~120 kDa protein; right
panel: preadsorbed immune serum. B, Immunocytochemical staining of AE4 in
stomach indicates that AE4 is localized on the apical membrane of surface
epithelial cells (left panel). Staining with the preadsorbed immune serum failed
to detect any labeling in the stomach (right panel). C, Immunofluorescence
double labeling with AE4 (green staining, left panel) and gastric H-K-ATPase
30
(red staining, right panel). The distribution of gastric H-K-ATPase β-subunit is
distinct from AE4 when dual images were acquired (middle panel).
Fig. 3. Immunocytochemical staining of AE4 in rabbit stomach and kidney. A,
Immunofluorescence labeling with anti-AE4 antibody in rabbit stomach reveals
expression of AE4 on the apical membrane of surface epithelial cells. B,
Immunofluorescence double labeling of AE4 (left panel) and peanut lectin
binding protein (right panel) in rabbit kidney demonstrates co-localization of
both transporters to the same membrane domain (merged images in the middle).
Fig. 4. Immunoblot localization of AE4 in the duodenum. A, Immunoblot
analysis of AE4 in human duodenum from two donors reveals a ~110 kDa
protein in brush border membrane (BBM) vesicles (left panel), but no bands were
detected in basolateral membrane (BLM) vesicles. Preadsorbed immune serum
did not detect any bands (right panel). B, Immunoblot analysis of AE4 in mouse
duodenum using immune serum reveals a ~120 kDa protein in apical membrane
vesicles (left panel). The labeling of the ~120 kDa band was prevented by
preadsorbed immune serum (right panel).
Fig. 5. Immunocytochemical staining of AE4 in mouse and rabbit duodenum.
A, Immunocytochemical staining of AE4 in mouse duodenum indicates that AE4
is expressed on the apical membrane of the villi with lower expression levels on
31
the apical membrane of crypt cells (left panel). This reaction was specific, as the
labeling
was
prevented
by
immune
preadsorption
(right
panel).
B,
Immunocytochemical staining of AE4 in rabbit duodenum. The preadsorbed
immune serum shows non-specific labeling on the basolateral membrane of villi
in the duodenum (right panel). The AE4 immune serum specifically labels the
apical membrane of the villi of the duodenum (see arrows).
Fig. 6. Functional expression of AE4. A, representative tracings demonstrating
Cl-/HCO3- exchange activity in oocytes expressing human AE4 cRNA. Oocytes
were loaded with BCECF and perfused with solutions corresponding to the
figure labels (see Methods for details). Solutions were gassed with 95% O2-5%
CO2. As indicated, switching to a Cl--free solution resulted in intracellular
alkalinization in oocytes injected with AE4 cRNA. The pHi returned to baseline
upon switching back to the Cl--containing solution. The pHi in oocytes that were
injected with water (control group) remained unchanged in response to the
removal or addition of Cl-. Solutions containing bicarbonate were continuously
bubbled with 95% O2 and 5% CO2. Solutions had a pH of ~7.4 at 37°C and
osmolality of 290 ± 3 mOsm/kg H2O. Solutions without bicarbonate were gassed
with 100% O2. Solutions containing gluconate salts had 4 mM Ca-acetate to
account for complexing of Ca+2 with gluconate. B, Summary of pHi experiments.
AE4 mediates Cl-/HCO3- exchange at the rate of 0.14 pH/min (p<0.001 vs.
control).
32
Fig. 1a.
AE4 expression in mouse stomach and kidney
Kidney
Stomach
+
-
+ -
RT
DN
A la
dde
r
500
400
300
33
Fig. 1b.
AE4 expression in rabbit gastric epithelial cells
Mucous Parietal
cells
cells
1650
1000
850
600
500
400
300
200
100
RT
- + - +
34
Fig. 1c.
lls
s Ce
cou
Mu
Par
ieta
l Ce
lls
Northern hybridization of AE4 in gastric epithelial cells
AE4
28S rRNA
35
Fig. 2a.
36
Fig. 2b.
Immunofluorescence labeling of AE4 in mouse stomach
AE4 immune serum
Preadsorbed serum
37
Fig. 2c.
Double labeling of AE4 and H-K-ATPase in mouse stomach
AE4
merged image
H-K-ATPase
38
Fig. 3a. Immunofluorescence labeling of AE4 in rabbit
stomach.
39
Fig. 3b.
Double immunofluorescent labeling of AE4 and peanut lectin
in rabbit kidney
AE4
Dual image
Peanut lectin
40
Fig. 4a. Immunolocalization of AE4 in human duodenum.
41
Fig. 4b.
42
Fig. 5a
Immunofluorescence labeling of AE4 in mouse duodenum
43
Fig. 5b
Immunofluorescence labeling of AE4 in rabbit duodenum
AE4 Immune serum
Preadsorbed serum
44
Fig. 6a.
Functional expression of AE4 in oocytes
33 mM HCO370.6 mM Cl-
0 mM Cl-
70.6 mM Cl-
7.5
7.4
7.3
7.2
7.1
7
0
500
1000
1500
Time (sec)
45
Fig. 6b.
Cl- /HCO3- exchange activity (pHi /min)
0.2
P<0.0001
0.15
0.1
0.05
0
AE4
control
46
47