Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Articles in PresS. Am J Physiol Gastrointest Liver Physiol (July 31, 2003).10.1152/ajpgi.00236.2003 Identification of an Apical Cl-/HCO3- Exchanger in Gastric Surface Mucous and Duodenal Villus Cells Jie Xu*, Sharon Barone*, Snezana Petrovic*#, Zhaohui Wang*, Ursula Seidler%, Brigitte Riederer%, Krishnamurthy Ramaswamy$@, Pradeep K. Dudeja$@, Gary E. Shull& and Manoocher Soleimani*#, Departments of *Medicine and &Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati, Cincinnati OH; $ %University of Tubingen, Germany; Department of Medicine, University of Illinois at Chicago, Chicago, IL; and Veterans Affairs Medical Centers at @West Side, Chicago, IL and #Cincinnati, OH Running title: A bicarbonate transporter in surface epithelial cells Address correspondence to M. Soleimani, M.D., Division of Nephrology and Hypertension, Department of Medicine, University of Cincinnati, 231 Albert Sabin Way, MSB G259, Cincinnati, Ohio 45267-0585 Phone: 513-558-5463 ; Fax: 513-558-4309; E-mail: [email protected] Copyright (c) 2003 by the American Physiological Society. Abstract The molecular identity of the apical bicarbonate-secreting transporter in gastric mucous cells remains unknown despite its essential role in preventing injury and ulcer by gastric acid. Here we report the identification of a Cl-/HCO3exchanger that is located on apical membranes of gastric surface epithelial cells. RT-PCR studies of mouse gastrointestinal tract mRNAs demonstrated that this transporter, known as anion exchanger isoform 4 (AE4), is expressed in both stomach and duodenum. Northern blot analysis of RNA from purified stomach epithelial cells indicated that AE4 is expressed at higher levels in mucous cells than in parietal cells. Immunoblotting experiments identified AE4 as a ~110-120 kDa protein in membranes from stomach epithelium and apical membranes from duodenum. Immunocytochemical staining demonstrated that AE4 is expressed in apical membranes of surface cells in both mouse and rabbit stomach and duodenum. Functional studies in oocytes indicated that AE4 functions as a Cl/HCO3- exchanger. These data show that AE4 is an apical Cl-/HCO3- exchanger in gastric mucous cells and duodenal villus cells. Based on its function and location we propose that AE4 may play an important role in mucosal protection. Key words: AE4, Cl-/HCO3- exchange, parietal cells, mucous cells, acid injury 2 Introduction One of the major mechanisms for protection of the surface epithelium of the stomach from injury by gastric acid is the presence of a layer of mucus containing HCO3- (1-3), both of which are secreted by mucous cells. As acid diffuses into the mucus gel it is neutralized by the secreted HCO3-, resulting in the formation of a gradient in which the pH at the luminal surface of the epithelium is relatively neutral (1). It has been suggested that the HCO3- secreted from surface cells during gastric acid secretion may originate in part from parietal cells (4, 5). Intracellular HCO3-, generated during acid secretion, exits the basolateral membrane of the parietal cell via electroneutral Cl-/HCO3- exchange (6, 7) and alkalinizes the blood, which perfuses the basal aspect of surface epithelial cells (4, 5). The available evidence suggests that the HCO3- is taken up by mucous cells, most likely via Na+/HCO3- cotransport (8, 9), and is then secreted across the luminal membrane of surface mucous cells, thereby providing protection from gastric acid. The mechanism of HCO3- secretion by surface epithelial cells has been studied by several groups, but remains controversial. In frog fundic mucosa, HCO3- secretion was reported to have no effect on the transepithelial electrical potential and to be dependent on luminal Cl-, suggesting that electroneutral Cl/HCO3- exchange was involved (10). These results have been disputed (11), however, and there is evidence for a HCO3- conductance pathway (8). Nevertheless, electroneutral Cl-/HCO3- exchange remains an attractive 3 possibility because the diffusion of H+ and Cl- into the mucus layer would both neutralize outwardly transported HCO3- and provide Cl- for inward transport, thereby maintaining a strong driving force for Cl-/HCO3- exchange. This hypothesis has received support by the recent finding of a HCO3- secretory mechanism in rat gastric mucosa that is sensitive to DIDS (12), an inhibitor of some of the electroneutral Cl-/HCO3- exchangers and related transporters. The identity of the apical anion transporter that mediates HCO3- secretion by surface mucous cells is unclear, but members of either the SLC4 (Cl-/HCO3exchangers and Na+/HCO3- cotransporters) or SLC26 (anion exchangers, including Cl-/HCO3- exchangers) families are potential candidates. Recently a Cl/HCO3- exchanger of the SLC4 family, termed anion exchanger (AE)1 isoform 4, was cloned from rabbit kidney cortical collecting duct (13). It exhibits 48% amino acid identity to the NBC1 Na+/HCO3- cotransporter and 32% identity to the AE2 Cl-/HCO3- exchanger (13). Functional studies in oocytes and cultured mammalian cells indicated that AE4 mediates electroneutral Cl-/HCO3- exchange and does not transport Na+ (13). Because of this functional property and despite its greater similarity to the NBC subfamily it was named AE4. Based on its localization on the apical membrane of β-intercalated cells in the cortical collecting duct, it was postulated that AE4 mediates HCO3- secretion (13). In the current studies, we investigated the gastrointestinal distribution of AE4, as little is known about the expression of this transporter outside the kidney. Our results indicate that AE4 mRNA is expressed in both stomach and 4 duodenum, and that it functions as Cl-/HCO3- exchanger when expressed in oocytes. Immunocytochemical studies demonstrate that AE4 is localized on the apical membranes of gastric surface epithelial cells and villi of the duodenum. We propose that AE4 mediates apical HCO3- secretion in gastric surface epithelium and duodenum, thereby protecting these tissues against acid injury. 5 Experimental Procedures RT-PCR of AE4 in mouse and rabbit GI tract. A blast search of mouse EST database against the rabbit AE4 sequence (GenBank Accession No. AB038263) identified a mouse EST (Genbank Accession No. AW018362) with high degree of sequence similarity. Based on the cDNA sequence of the mouse EST, the following primers were designed (sense: CAT GCC TGG TGC TCA AGA AAG CTA G and antisense: CAC TCA TGT TAC TGG GCC TGG TGG) and utilized for RT-PCR experiments. RT-PCR was performed on RNA isolated from stomach, duodenum and kidney using the above primers, which amplified a 412-base pair fragment corresponding to nucleotides 66 to 482 of the EST. For rabbit AE4, the following primers : GAAATGGGCCACTTGCACC (sense) and AATTGACAGAGGCAGCCATAGG (antisense) were designed based on rabbit AE4 cDNA sequence (GenBank Accession No. AB038263). The primers were used for RT-PCR in various tissues and a PCR fragment corresponding to nucleotides 992 to 1595 of the rabbit AE4 cDNA was isolated. The reason for using different sets of primers for mouse and rabbit was due to DNA sequence differences in these two species. RNA isolation and Northern blot hybridization. Total cellular RNA was extracted from mouse duodenum, stomach, and kidney and rabbit gastric parietal and mucous cells using Tri Reagent. Hybridization was performed according to the method of Church and Gilbert (14). The membranes were washed, blotted dry and exposed to a PhosphorImager screen (Molecular 6 Dynamics, Sunnyvale, CA). 32P-labeled mouse or rabbit AE4 PCR fragments (see above) were used as hybridization probes. Immunocytochemistry of AE4 in stomach and kidney. Antibodies. For AE4, a synthetic peptide corresponding to amino acids residues CLMYQPKAPEINISVN of mouse AE4 (using a mouse AE4 EST with Gene Bank accession number: AW018362) was used to generate polyclonal antibodies in two rabbits. This sequence is identical in mouse, rabbit, and human AE4. Antibodies were purified using a cysteine affinity column. A human AE4 polyclonal antibody was purchased from Alpha diagnostics, San Antonio, TX (see below). Gastric H-K-ATPase β-subunit antibody was a generous gift from Dr. John Forte (University of California at Berkeley). Immunoblotting of AE4 in stomach and duodenum- Mouse microsomal membranes from the scrapings of gastric epithelium and apical membrane vesicles from the duodenum were isolated according to established methods and as described (15, 16). For mouse, immunoblotting experiments were carried out as previously described (16). Briefly, the solubilized membrane proteins were size fractionated on 8% SDS polyacrylamide minigels (Novex, San Diego, CA) under denaturing conditions, electrophoretically transferred to nitrocellulose membranes, blocked with 5% milk proteins, and then probed with the affinity purified anti-AE4 immune serum at an IgG concentration of 0.6 µg/ml. The secondary antibody was donkey anti-rabbit IgG conjugated to horseradish peroxidase (Pierce). The antigen-antibody complexes on the nitrocellulose 7 membranes were visualized by chemiluminescence (SuperSignal Substrate, Pierce) and the image captured on light sensitive imaging film (Kodak). For human duodenum, apical and basolateral membrane vesicles were isolated from two organ donors utilizing established methods (17) and in accordance with the institutional protocols approved by the University of Illinois at Chicago. Seventy-five (75) µg each of purified brush-border and basolateral membranes were solubilized in Laemmli sample buffer, separated on 7% SDSPAGE, transferred to Hybond nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ) and visualized with Ponceau stain to ensure the efficiency of the transfer. After blocking with 5% non-fat dry milk in phosphate-buffered saline (1X PBS)/0.1%Tween-20, blots were incubated with affinity purified rabbit antihuman-AE4 antibody (Alpha diagnostics, San Antonio, TX) diluted (1:150) in 1X PBS/ 0.1%Tween-20/ 1%milk overnight at 4°C. After four washes with 1X PBS/ 0.1%Tween-20, blots were then incubated with horse-radish peroxidase goat antirabbit IgG secondary antibody (Santacruz Biotech, Santacruz, CA) diluted in 1X PBS/ 0.1%Tween-20/ 1%milk for 1h at room temperature. After five washes with 1X PBS/ 0.1%Tween-20/, the bands were visualized using an enhanced chemiluminescence system (Amersham Biosciences, Piscataway, NJ). To determine antigen specificity, in a separate experiment AE4 control peptide (30µg/ml, sequence near the cytoplasmic C-terminus of human AE4, Alpha diagnostics, San Antonio, TX) was pre-incubated with the antibody solution (5µg/ml) at 37 °C for 2 h before adding to the blot. 8 Immunofluorescense labeling studies. Mice were euthanized with an overdose of sodium pentobarbital and perfused through the left ventricle with 0.9% saline followed by cold 4% paraformaldehyde in 0.1 M sodium phosphate buffer (pH 7.4). Rabbits were euthanized with an overdose of sodium pentobarbital via ear lobe vein and perfused through the left ventricle similar to mice . Stomachs and duodena were removed, cut in tissue blocks, and left in the fixative solution overnight at 4 0C. For cryosections, tissue blocks were removed from the fixative solution and soaked in 30 % sucrose overnight. The tissue was frozen on dry ice, and 5 µm sections were cut with a cryostat and stored at –80 °C until used. Single and double immunofluorescence labeling were performed as described recently (15). For double labeling with H-K-ATPase, gastric H-K-ATPase β- subunit antibody was diluted at 1:250. Goat-anti-rabbit IgG conjugated with Oregon Green 488 and goat anti-mouse IgG conjugated with Alexa Fluor 568 Dye (Molecular Probes, Eugene, OR) were used at 1:150 dilution for AE4 and H-KATPase, respectively. Sections were examined and images were acquired on a Nikon PCM 2000 laser confocal scanning microscope as 0.5 µm optical sections of the stained cells. Cloning of AE4 cDNA. Full-length human AE4 cDNA was cloned from a human kidney cDNA library by PCR using the following primers: 5'-GAC TGT ACT GGT TCT GAG ATT CTG TGC AAG and 5'-CTG CGG GCT TAC TGG AGA TAT TAT TTA GGG, which were designed based on sequences from the human 9 genome data base. PCR amplification of the human AE4 cDNA was performed using the CLONTECHTM Advantage 2 PCR kit protocal. Each PCR reaction contained 5 µl cDNA, 5 µl 10X PCR buffer, 1 µl 10 mM dNTPs, 10 pmoles of each primer, and 1 µl Advantage 2 Polymerase mix in a final volume of 50 µl. Cycling parameters were: 95o C, 1 min; 95o C, 30 s; and 68o C, 4 min. A~3.2 kb PCR fragment was obtained which contained the full-length coding region of the exchanger. The product was gel-purified and subcloned into the pGEM-T easy vector for expression studies. Expression of AE4 cRNA in Xenopus oocytes. The capped AE4 cRNA was generated using mMESSAGE mMACHINETM Kit (Ambion, Inc.) according to manufacturer’s instruction. Xenopus oocytes were injected with 50 nl of the human AE4 cRNA (0.2 – 1.3 µg/µl) using a Drummond 510 microdispenser via a sterile glass pipette. pHi studies. Intracellular pH (pHi) in oocytes was measured with the pH sensitive fluorescent probe 2’,7’-bis-(2-carboxyethyl)-5-(and-6)- carboxyfluorescein (BCECF) (Molecular Probes, Eugene, OR) as described (16). Briefly, oocytes were loaded with 10µM BCECF-acetoxymethyl ester for 20 minutes at room temperature in the same medium in which they were kept after cRNA injection. Oocytes were than transferred to the 1 ml perfusion chamber, placed on the nylon mesh with vegetable pole facing the fluorescent beam and perfused at rate of 3 ml/min with the following solution (mM): NaCl 63, NaHCO3 33, KCl 2, CaCl2 1.8, MgCl2 1, and HEPES 5. Another 20 to 30 minutes 10 were allowed for the equilibration and dye ester hydrolysis, which yields the fluorescent probe. Ratiometric fluorescence measurements were performed using Attofluor digital imaging system (Attofluor Inc., Rockwell MD). Excitation wavelengths were 450nm and 490nm and fluorescence emission intensity was recorded at 520 nm. Ratios were calculated and stored. Data analyses were performed using Attograph and Attoview software packages provided with the imaging system. Background signal (always less than 1%) was recorded and automatically subtracted from the subsequent fluorescence measurements. The ratios were obtained from the submembrane region of the oocytes that were visualized with a 10x objective. Measured excitation ratios were converted to pHi by using a calibration curve that was constructed with high K+/nigericin method at the end of each experiment (16). To test for Cl-/HCO3- exchange activity, the chamber was first perfused with solution containing 63 mM NaCl and 33 mM NaHCO3. The oocytes were then switched to Cl--free medium (63 mM Na-gluconate and 33 mM NaHCO3-). All other Cl--containing chemicals (KCl, etc.) were replaced with gluconate salts. This maneuver results in cell alkalinization due to reversal of Cl-/HCO3exchange (16). Upon pHi stabilization in Cl--free medium, oocytes were switched back to the Cl--containing solution. This should result in cell acidification back to baseline due to activation of Cl-/HCO3- exchange. The initial rate of cell pHi 11 recovery was used as the rate of Cl-/HCO3- exchange activity (16). In additional studies, experiments were repeated with Na+-free solutions, with tetramethyl ammonium Cl replacing NaCl and choline HCO3 replacing NaHCO3. Rabbit gastric cell purification. Rabbit gastric mucous and parietal cells were isolated as described (7) and processed for total RNA isolation. The use of rabbit in these studies was for the purpose of determination of the gastric epithelial cell origin of AE4, as reasonably purified mucous and parietal cells have been successfully isolated from rabbit stomach. Materials- 32P-dCTP was purchased from New England Nuclear (Boston, MA). Nitrocellulose filters and other chemicals were purchased from Sigma Chemical Co. (St. Louis, MO). RadPrime DNA labeling kit was purchased from Gibco BRL, USA. BCECF was from Molecular Probes Inc (Eugene, Oregon). mMESSAGE mMACHINETM Kit was purchased from Ambion (Austin, Texas). All the other chemicals were from Sigma Chemicals (St Louis, MI). Statistical Analyses. Values are expressed as mean ± SEM. The significance of differences between mean values were examined using ANOVA. P < 0.05 was considered statistically significant. 12 Results AE4 mRNA expression in the upper gastrointestinal tract. To examine the distribution of AE4 mRNA in stomach, RT-PCR was performed using RNA isolated from mouse stomach and compared to that of kidney using mouse specific primers (Experimental Procedures). Figure 1a shows ethidium bromide staining of an agarose gel, which revealed that the expected PCR fragment of 412 base pairs is amplified from mouse stomach and kidney. The sequence of the gelpurified PCR product from kidney and stomach was determined, verifying the product as AE4. The above results demonstrate that in addition to the kidney, AE4 is expressed in the stomach. Expression of AE4 mRNA in gastric mucous and parietal cells. To determine the cellular distribution of AE4 mRNA in the stomach, RNA was isolated from parietal and mucous cells of rabbit stomach and analyzed by RTPCR using rabbit-specific primers. Figure 1b shows an ethidium bromide stained agarose gel, demonstrating that the expected PCR fragment (~600 bp), which was verified by sequence analysis, was amplified from both mucous and parietal cells. The results of these RT-PCR experiments were verified by Northern hybridization analysis, which demonstrated that AE4 mRNA is expressed in both gastric mucous and parietal cells (Fig. 1c). The use of rabbit in these series of studies was for the purpose of determination of epithelial cell origin of AE4. As is known, rabbit is the only mammalian species that has successfully been used for the isolation of reasonably purified mucous and parietal cells. 13 Immunoblotting and immunofluorescense labeling of AE4 in stomach and duodenum. To determine the protein expression of AE4, microsomal membrane proteins from scrapings of the gastric epithelium and apical membrane vesicles from the duodenum were isolated from mouse and subjected to immunoblot analysis. Figure 2a shows an immunoblot analysis of microsomal membranes from mouse stomach, which demonstrates that AE4 appears as a ~120 kDa protein. The reaction is specific as the preadsorbed immune serum failed to detect the band (Fig. 2a). To determine the cellular distribution and subcellular localization of AE4, immunocytochemical staining was performed on sections of mouse stomach. As shown in Figure 2b, AE4 is expressed on the apical membrane of surface epithelial cells (left panel). The preadsorbed immune serum did not detect any labeling (right panel). Figure 2c shows double immunofluorescence labeling with AE4 and gastric H-K-ATPase β-subunit in mouse stomach. It demonstrates that the H-K-ATPase is restricted to parietal cells, as expected, whereas AE4 is expressed primarily in surface epithelial cells, with lower levels of expression in gastric parietal cells. The staining in parietal cells was variable, with intracellular labeling being more frequent than the apical labeling. No basolateral labeling in parietal cells was observed. In the next series of studies we examined the localization of AE4 in rabbit stomach by immunofluorescence labeling. As shown in Fig. 3a, AE4 is located on the apical membrane of surface epithelial cells in rabbit stomach. As a control and in order to verify that the AE4 antibody indeed recognizes the AE4 protein, 14 double immunofluorescence labeling with AE4 and peanut lectin binding protein was performed in rabbit kidney. As indicated in Fig. 3b, AE4 and peanut lectin binding protein, which labels only the apical membrane of β-intercalated cells, co-localize to the same membrane domain. These results indicate that the AE4 immune serum recognizes only the AE4 protein and does not cross-react with other proteins. It further verifies the results of molecular studies in which AE4 was cloned from β-intercalated cells of rabbit kidney and shown to be expressed only in those same cells (13). The experiments shown in Figure 4 examine the expression and subcellular localization of AE4 in mouse, rabbit and human duodenum. In human, AE4 appears as a ~110 kDa band in apical membranes of the duodenum (Fig. 4a, left panel) but not in basolateral membranes (Fig. 4a, left panel). Preadsorbed immune serum did not react with any proteins (Fig. 4a, right panel). In the mouse, AE4 appears as a ~120 kD protein in apical membrane vesicles from the duodenum (Fig. 4b, left panel). No labeling was observed with the preadsorbed immune serum (Fig. 4b, right panel). The results of the above experiments indicate that AE4 is localized to the apical membrane proteins of the duodenum in both mouse and human. To determine the cellular distribution and subcellular localization of AE4 in the duodenum in more detail, immunofluorescence labeling was performed in mouse and rabbit duodenum. In mouse duodenum, AE4 is expressed exclusively on apical membranes of epithelial cells in the villi (Fig. 5a, left panel). No 15 labeling was detected with the preadsorbed immune serum (Fig. 5a, right panel). In rabbit, the preadsorbed immune serum showed non-specific labeling in the basolateral membrane of villi in the duodenum (Fig. 5b, right panel). Compared to the preadsorbed serum, the AE4 immune serum specifically labeled the apical membranes of villi in the duodenum (Fig. 5b, left panel). Functional expression of AE4. Two recent studies indicated that AE4 is a Cl/HCO3- exchanger (13, 21). The purpose of the next series of experiments was to examine and verify the functional identity of AE4 using the oocyte expression system. In the first series of experiments, oocytes were injected with human AE4 cRNA, loaded with BCECF in the presence of a Cl- and HCO3--containing solution (Experimental Procedures), and intracellular pH was monitored. The representative pHi tracings in Fig. 6a demonstrate that switching to a Cl--free solution resulted in a rapid intracellular alkalinization in oocytes expressing AE4. Switching back to the Cl--containing solution caused a return of pHi to baseline. No pHi alteration in response to exposure to the Cl--free medium was observed in control (water-injected) oocytes (Fig. 6a). In the absence of HCO3- in the media, the rate of cell alkalinization in response to Cl- removal was minimal. These results are consistent with AE4 functioning as a Cl-/HCO3- exchanger. A summary of multiple experiments is shown in Fig. 6b and demonstrates that the rate of Cl-/HCO3- exchange activity was 0. 14 ± 0. 01 in oocytes expressing AE4 (n = 5). The baseline pHi in CO2/HCO3--containing solutions was 7.14 ± 0.03 in water-injected oocytes and 7.17±0.03 in AE4-injected oocytes (p>0.05, n=5). The 16 Cl-/base exchange activity in control oocytes was not significantly different from zero (Fig. 6a and b). The absence of Na+ in the media did not prevent cell alkalinization in response to Cl- removal, indicating that AE4-mediated Cl/HCO3- exchange is independent of Na+. In the absence of HCO3-, the rate of Cl/base exchange activity (mediated by Cl-/OH- exchange) was minimal, indicating the low affinity of AE4 for OH-. AE4 did not function in a Na+:HCO3cotransport mode (data not shown). 17 Discussion The lumen of the stomach is exposed to an acidic solution secreted from gastric parietal cells, which can achieve a pH as low as 1.5 (18-20). To protect itself against the corrosive effects of luminal acid, the gastric surface epithelium secretes a HCO3--rich fluid into the mucus gel layer (1). Despite the essential role of HCO3- secretion in mucosal protection, the molecular identity and functional characteristics of the transporter(s) responsible for this process has remained unclear. The results of the present study show that in addition to its expression in kidney, AE4 mRNA is expressed in the stomach and in the duodenum, which is also exposed to gastric acid. Furthermore, immunohistochemical staining demonstrated that expression of AE4 protein in the stomach occurs predominantly in the apical membrane of surface epithelial cells and that its expression in the duodenum is restricted to the apical membranes of villus cells. Expression of AE4 in parietal cells was mostly limited to the cytoplasmic region with faint and occasional apical labeling. Functional expression of AE4 in oocytes confirmed previous studies showing that this transporter mediates Cl-/HCO3- exchange (13). These observations suggest that AE4 is responsible, at least in part, for HCO3- secretion into the mucus layer of the gastric epithelium and across the apical membrane of villus cells in the duodenum, consistent with the hypothesis that it plays an important role in mucosal protection in both organs. 18 There are conflicting studies on the nature of HCO3- secreting transporter(s) in gastric surface epithelial cells. While a Cl-/HCO3- exchanger has been proposed to be the primary mechanism for HCO3- secretion in frog gastric mucosa (10), other investigators have proposed that a HCO3- conductive pathway is responsible for this activity (11). AE4 functions as a Cl-/HCO3exchanger in heterologous expression systems (13, 21 and current studies), indicating that at least a portion of the HCO3- secretion in surface epithelial cells is likely to be mediated by this transporter operating in a Cl-/HCO3- exchange mode. A recent preliminary study2 suggested that AE4 may also function as an electroneutral Na:HCO3- cotransporter. Our functional expression studies in oocytes did not reveal Na:HCO3- cotransport activity by AE4, confirming recent results indicating that AE4 only functions in a Cl-/HCO3- exchange mode (13). These results not withstanding, either Cl-/HCO3- exchange or Na:HCO3cotransport activity via AE4 would function in a HCO3- secreting mode, as luminal acidity precludes the functioning of AE4 (or any bicarbonate transporter) in a net bicarbonate-absorbing mode. As an apical Cl-/HCO3exchanger AE4 can neutralize the gastric acidity according to the following scheme. Following secretion into the gastric lumen via coordinated action of gastric HK-ATPase and apical Cl- channel in parietal cells, the resulting HCl dissociates into H+ and Cl-. The secreted Cl- will be exchanged with intracellular bicarbonate via the Cl/HCO3- exchanger AE4 located on the apical membrane of mucous cells. The net effect of these processes is the secretion of HCl by parietal cells and the secretion of 19 bicarbonate from mucous cells for protection against injury by the acid. In the case of proton pump inhibitors, inhibition of acid secretion is associated with decreased generation of bicarbonate which in turn leads to reduced bicarbonate exit across the baolsateral membrane of parietal cells, eventually reducing the uptake of bicarbonate by mucous cells (presumably via basolateral NBC). The reason that gastric luminal pH does not climb very high in response to PPI might be due to decreased intracellular bicarbonate concentration in mucous cells secondary to decreased bicarbonate generation in parietal cells. Recent studies have identified a family of anion exchangers, referred to SLC26A family, which include at least ten distinct genes (17, 22-34). Three wellknown members of this family are SLC26A3 (or DRA), SLC26A4 (or pendrin) and SLC26A6 (PAT1 or CFEX) (23, 27, 29), which are located apically in a limited and distinct number of epithelia and function as Cl-/OH-/HCO3- exchanger s (16, 31, 35). DRA is predominantly expressed in the large intestine with lower levels in the small intestine (35) whereas PAT1 is predominantly expressed in the small intestine with very low expression levels in the large intestine (16). Pendrin is located on the apical membrane of thyroid follicular cells and kidney collecting ducts (28, 31). None of these exchangers are expressed on the apical membrane of surface epithelial cells in the stomach. In mouse stomach, immunocytochemical staining localized PAT1 to the tubulovesicle membranes of gastric parietal cells (15) whereas it failed to detect the expression of pendrin despite detectable mRNA levels (data not shown). 20 In addition to the stomach, AE4 is expressed in the duodenum. Immunoblotting or immunocytochemical staining demonstrates that AE4 is expressed on the apical membrane of mouse, rabbit and human duodenum. This observation is intriguing as it confirms that more than one apical Cl/HCO3- exchanger is expressed in the duodenum. Recently, PAT1 (SLC26A6) was identified as a major Cl-/HCO3- exchanger in the apical membrane of the duodenum (16), along with the DRA (SLC26A3) Cl-/HCO3- exchanger (35). Our studies in the duodenum indicate that the expression levels of PAT1 are the highest followed by DRA and AE4 (ref. 16 and unpublished data). It would be difficult to conclude that, based on the expression level studies in the duodenum, one anion exchanger (i.e. PAT1) might be the major transporter mediating bicarbonate secretion (or chloride absorption) and the others are not. The presence of more than one apical bicarbonate-transporter in the duodenum suggests possible differential regulation of these transporters in physiologic or pathophysiologic states. Studies are underway to examine the regulation of AE4, PAT1 and AE4 in disease states associated with defective bicarbonate secretion, such as cystic fibrosis or treatment with non-steroidal anti-inflamatory drugs. In conclusion, AE4 is expressed in the upper gastrointestinal tract, with expression in the small intestine and stomach. Immunohistochemical staining or immunoblotting studies localized AE4 to the apical membranes of surface epithelial cells in the stomach and to the apical domain of villus cells in the duodenum. Functional studies demonstrated that AE4 operates in an 21 electroneutral Cl-/HCO3- exchange mode. We propose that AE4 is an apical HCO3- transporter in surface epithelial cells of the stomach and villus cells of the duodenum, and that it may play an important role in protecting the gastric and duodenal epithelium against injury by the acid secreted from gastric parietal cells. 22 References: 1. Engel E, Guth PH, Nishizaki Y, and Kaunitz JD. Barrier function of the gastric mucus gel. Am J Physiol Gastrointest Liver Physiol 269: G994-G999, 1995. 2. Flemstrom G. Gastric and duodenal mucosal bicarbonate secretion. In: Physiology of the Gastrointestinal Tract (3rd ed.). edited by Johnson LR, Jacobson ED, Christensen J., Alpers D, and Walsh JH. New York:Raven, 1994, p.1285-1309. 3. Schade C, Flemstrom G, and Holm, L. Hydrogen ion concentration in the mucus layer on top of acid-stimulated and –inhibited rat gastric mucosa. Gastroenterology 107: 180-188, 1994. 4. Gannon B, Browning J, and O’Brien P. The microvascular architecture of the glandular mucosa of rat stomach. J Anat 135: 667-683, 1982. 5. Gannon B, Browning J, O’Brien P, and Rogers P. Mucosal microvascular architecture of the fundus and body of human stomach. Gastroenterology 86: 866875, 1984. 6. Muallem S, Burnham C, Blissard D, Berglindh T, and Sachs G. Electrolyte transport across the basolateral membrane of parietal cells. J Biol Chem 260: 6641-6653, 1985. 7. Rossmann H, Bachmann O, Wang Z, Shull GE, Obermaier B, Stuart-Tilley A, Alper SL, Seidler U. Differential expression and regulation of AE2 anion exchanger subtypes in rabbit parietal and mucous cells. J Physiol 534: 837-848, 2001. 8. Curci S, Debellis L, Caroppo R, and Fromter E. Model of bicarbonate secretion by resting frog stomach fundus mucosa. I. Transepithelial measurements. Pfluegers Arch 428: 648-654. 23 9. Rossmann H, Bachmann O, Vieillard-Baron D, Gregor M, and Seidler U. Na+/HCO3- cotransport and expression of NBC1 and NBC2 in rabbit gastric parietal and mucous cells. Gastroenterology 116: 1389-1398, 1999. 10. Flemstrom G. Cl- dependence of HCO3- transport in frog gastric mucosa. Upsala J Med Sci 85: 303-309, 1980. 11. Takeuchi K, Merhav A, and Silen W. Mechanism of luminal alkalinization by bullfrog fundic mucosa. Am J Physiol 243: G377-G388, 1982. 12. Phillipson M, Atuma C, Henriksnas J, and Holm L. The importance of mucus layers and bicarbonate transport in preservation of gastric juxtamucosal pH. Am J Physiol 282: G211-G219, 2002. 13. Tsuganezawa H, Kobayashi K, Iyori M, Araki T, Koizumi A, Watanabe S, Kaneko A, Fukao T, Monkawa T, Yoshida T, Kim DK, Kanai Y, Endou H, Hayashi M, Saruta T. A new member of the HCO3- transporter superfamily is an apical anion exchanger of β-intercalated cells in the kidney. J Biol Chem 276: 8180-8189, 2001. 14. Church GM, and Gilbert W. Genomic sequencing. Proc. Nat. Acad. Sci. USA 81: 1991-1995, 1984. 15. Petrovic S, Wang Z, Ma L, Seidler U, Forte JG, Shull GE, and Soleimani M. Co-localization of the apical Cl-/HCO3- exchanger PAT1 and gastric H-KATPase in stomach parietal cells. Am. J. Physiol Gastrointest Liver Physiol 283: G1207-G1216. 24 16. Wang Z, Petrovic S, Mann E, Soleimani M. Identification of an apical Cl/HCO3- exchanger in the small intestine. Am J Physiol Gastrointest Liver Physiol 282: G573-G579, 2002. 17. Rajendran, V.M., Harig J.M., Adams M.B., and Ramaswamy K. Transport of acidic amino acids by human jejunal brush border membrane vesicles. Am. J. Physiol. 252:G33-G39, 1987. 18. Allen A, Flemstrom G, Garner A, and Kivilaakso E. Gastroduodenal mucosal protection. Physiol Rev 73: 823-57, 1993. 19. Feldman M. Gastric secretion: Normal and abnormal. In: Gastrointestinal and Liver Disease: Pathophysiology/Diagnosis/Management (2nd ed.). edited by Feldman MD, Scharschmidt BF, Sleisenger MH, Klein SWB. Saunders, 1998, p587-603. 20. Garner A, Flemstrom G, Allen A, Heylings JR, McQueen S. Gastric mucosal protective mechanisms: roles of epithelial bicarbonate and mucus secretions. Scand. J Gastroenterol Suppl. 101: 79-86, 1984. 21. Ko SB, Luo X, Hager H, Rojek A, Choi JY, Licht C, Suzuki M, Muallem S, Nielsen S, and Ishibashi K. AE4 is a DIDS-sensitive Cl-/HCO3 exchanger in the basolateral membrane of the renal CCD and the SMG duct. Am J Physiol Cell Physiol 283: C1206-18, 2002. 22. Bissig M, Hagenbuch B, Stieger B, Koller T, and Meier PJ. Functional expression cloning of the canalicular sulfate transport system of rat hepatocytes. J Biol Chem 269: 3017-3021, 1994. 25 23. Everett LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, Adawi F, Hazani E, Nassir E, Baxevanis AD, Sheffield VC, and Green ED. Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 17: 411-422, 1997. 24. Hastabacka J, de la Chapelle A, Mahtani MM, Clines G, Reeve-Daly MP, Daly M, Hamilton BA, Kusumi K, Trivedi B, Weaver A, Coloma A, Lovett M, Buckler A, Kaitila I, and Lander ES. The diastrophic dysplasia gene encodes a novel sulfate transporter: positional cloning by fine-structure linkage disequilibrium mapping. Cell 78: 1073-1087, 1994. 25. Hoglund P, Haila S, Socha J, Tomaszewski L, Saarialho-Kere U, KarjalainenLindsberg, M-L, Airola K, Holmberg C, Chapelle A, and Kere, J. Mutations of the Down-regulated in adenoma (DRA) gene cause congenital chloride diarrhea Nat Genet 14: 316-319, 1996. 26. Lohi H, Kujala M, Makela S, Lehtonen E, Kestila M, Saarialho-Kere U, Markovich D, Kere J. Functional characterization of three novel tissue-specific anion exchangers: SLC26A7, A8 and A9. J Biol Chem 277: 14246-14254, 2002. 27. Lohi H, Kujala M, Kerkela E, Saarialho-Kere U, Kestila M, and Kere J. Mapping of five new putative anion transporter genes in human and characterization of SLC26A6, a candidate gene for pancreatic anion exchanger. Genomics 70: 102-12, 2000. 28. Royaux IE, Wall SM, Karniski LP, Everett LA, Suzuki K, Knepper MA, Green ED. Pendrin, encoded by the Pendred syndrome gene, resides in the apical 26 region of renal intercalated cells and mediates bicarbonate secretion. Proc Natl Acad Sci U S A. 98: 4221-6, 2001. 29. Schweinfest CW, Henderson KW, Suster S, Kondoh N, and Papas TS. Identification of a colon mucosa gene that is down-regulated in colon adenomas and adenocarcinomas. Proc Natl Acad Sci U.S.A. 90: 4166-4170, 1993. 30. Knauf F, Yang CL, Thomson RB, Mentone, SA, Giebisch G, and Aronson PS. Identification of a chloride-formate exchanger expressed on the brush border membrane of renal proximal tubule cells. Proc Natl Acad Sci U S A. 98:9425-30, 2001. 31. Soleimani M. Molecular physiology of the renal chloride-formate exchanger. Curr. Opin Nephrol Hypertens 10: 677-83, 2001. 32. Zheng J, Shen W, He DZ, Long KB, Madison LD, Dallos P. Prestin is the motor protein of cochlear outer hair cells. Nature 405: 149-55, 2000. 33. Jacob P, Rossmann H, Lamprecht G, Kretz A, Neff C, Lin-Wu E, Gregor M, Groneberg DA, Kere J, and Seidler U. Down-regulated in adenoma mediates apical Cl-/HCO3- exchange in rabbit, rat, and human duodenum. Gastroenterology 122: 709-724, 2002. 34. Vincourt JB, Jullien D, Kossida S, Amalric F, Girard JP. Genomics. 79:249-56, 2002. 35. Melvin, JE, Park K, Richardson L, Schultheis PJ, and Shull GE. Mouse Down-Regulated in Adenoma (DRA) is an intestinal Cl-/HCO3- exchanger 27 and is upregulated in colon of mice lacking the NHE-3 Na+/H+ exchanger. J Biol Chem 274: 22855-22861, 1999. 28 Acknowledgments These studies were supported by National Institutes of Health Grants DK 54430 (M.S.), DK50594 (to G.E.S.), DK54016 (P.K.D), and DK 33349 (K.R), Merit Review grants from the Department of Veterans Affairs (M.S., P.K.D., K.R), a Cystic Fibrosis Foundation Grant and grants from Dialysis Clinic Incorporated (to M.S). Footnotes 1 AE, anion exchanger (the number following AE indicates the specific isoform); RT-PCR, reverse transcriptase-polymerase chain reaction; PCR, polymerase chain reaction. 2Parker MD, Boron WF, and Tanner MJA. Characterization of human AE4 as an electroneutral, sodium-dependent bicarbonate transporter. FASEB J. 16: A796, 2002. 29 Figure legends: Fig. 1. Expression of AE4 mRNA in the gastrointestinal tract. A, Mouse kidney and stomach RNA was analyzed by RT-PCR in the presence or absence of reverse transcriptase (RT) using mouse AE4-specific primers, and the products were fractionated by agarose gel electrophoresis. Ethidium bromide staining shows amplification of the expected PCR fragment (~420 bp) in both tissues. B, RNA from rabbit mucous and parietal cells was analyzed by RT-PCR in the presence (+) or absence (-) of reverse transcriptase (RT) using rabbit AE4-specific primers, and the products were fractionated by agarose gel electrophoresis. Ethidium bromide staining shows amplification of the expected PCR fragment (~600 bp) in both cell types. C, Northern hybridization analysis of AE4 mRNA from rabbit mucous and parietal cells reveals AE4 expression in both cell-types. Fig. 2. Immunoblotting and Immunocytochemical staining of AE4 in mouse stomach. A, Immunoblot analysis of AE4 in microsomal membranes from stomach. Left panel: AE4 immune serum identifies a ~120 kDa protein; right panel: preadsorbed immune serum. B, Immunocytochemical staining of AE4 in stomach indicates that AE4 is localized on the apical membrane of surface epithelial cells (left panel). Staining with the preadsorbed immune serum failed to detect any labeling in the stomach (right panel). C, Immunofluorescence double labeling with AE4 (green staining, left panel) and gastric H-K-ATPase 30 (red staining, right panel). The distribution of gastric H-K-ATPase β-subunit is distinct from AE4 when dual images were acquired (middle panel). Fig. 3. Immunocytochemical staining of AE4 in rabbit stomach and kidney. A, Immunofluorescence labeling with anti-AE4 antibody in rabbit stomach reveals expression of AE4 on the apical membrane of surface epithelial cells. B, Immunofluorescence double labeling of AE4 (left panel) and peanut lectin binding protein (right panel) in rabbit kidney demonstrates co-localization of both transporters to the same membrane domain (merged images in the middle). Fig. 4. Immunoblot localization of AE4 in the duodenum. A, Immunoblot analysis of AE4 in human duodenum from two donors reveals a ~110 kDa protein in brush border membrane (BBM) vesicles (left panel), but no bands were detected in basolateral membrane (BLM) vesicles. Preadsorbed immune serum did not detect any bands (right panel). B, Immunoblot analysis of AE4 in mouse duodenum using immune serum reveals a ~120 kDa protein in apical membrane vesicles (left panel). The labeling of the ~120 kDa band was prevented by preadsorbed immune serum (right panel). Fig. 5. Immunocytochemical staining of AE4 in mouse and rabbit duodenum. A, Immunocytochemical staining of AE4 in mouse duodenum indicates that AE4 is expressed on the apical membrane of the villi with lower expression levels on 31 the apical membrane of crypt cells (left panel). This reaction was specific, as the labeling was prevented by immune preadsorption (right panel). B, Immunocytochemical staining of AE4 in rabbit duodenum. The preadsorbed immune serum shows non-specific labeling on the basolateral membrane of villi in the duodenum (right panel). The AE4 immune serum specifically labels the apical membrane of the villi of the duodenum (see arrows). Fig. 6. Functional expression of AE4. A, representative tracings demonstrating Cl-/HCO3- exchange activity in oocytes expressing human AE4 cRNA. Oocytes were loaded with BCECF and perfused with solutions corresponding to the figure labels (see Methods for details). Solutions were gassed with 95% O2-5% CO2. As indicated, switching to a Cl--free solution resulted in intracellular alkalinization in oocytes injected with AE4 cRNA. The pHi returned to baseline upon switching back to the Cl--containing solution. The pHi in oocytes that were injected with water (control group) remained unchanged in response to the removal or addition of Cl-. Solutions containing bicarbonate were continuously bubbled with 95% O2 and 5% CO2. Solutions had a pH of ~7.4 at 37°C and osmolality of 290 ± 3 mOsm/kg H2O. Solutions without bicarbonate were gassed with 100% O2. Solutions containing gluconate salts had 4 mM Ca-acetate to account for complexing of Ca+2 with gluconate. B, Summary of pHi experiments. AE4 mediates Cl-/HCO3- exchange at the rate of 0.14 pH/min (p<0.001 vs. control). 32 Fig. 1a. AE4 expression in mouse stomach and kidney Kidney Stomach + - + - RT DN A la dde r 500 400 300 33 Fig. 1b. AE4 expression in rabbit gastric epithelial cells Mucous Parietal cells cells 1650 1000 850 600 500 400 300 200 100 RT - + - + 34 Fig. 1c. lls s Ce cou Mu Par ieta l Ce lls Northern hybridization of AE4 in gastric epithelial cells AE4 28S rRNA 35 Fig. 2a. 36 Fig. 2b. Immunofluorescence labeling of AE4 in mouse stomach AE4 immune serum Preadsorbed serum 37 Fig. 2c. Double labeling of AE4 and H-K-ATPase in mouse stomach AE4 merged image H-K-ATPase 38 Fig. 3a. Immunofluorescence labeling of AE4 in rabbit stomach. 39 Fig. 3b. Double immunofluorescent labeling of AE4 and peanut lectin in rabbit kidney AE4 Dual image Peanut lectin 40 Fig. 4a. Immunolocalization of AE4 in human duodenum. 41 Fig. 4b. 42 Fig. 5a Immunofluorescence labeling of AE4 in mouse duodenum 43 Fig. 5b Immunofluorescence labeling of AE4 in rabbit duodenum AE4 Immune serum Preadsorbed serum 44 Fig. 6a. Functional expression of AE4 in oocytes 33 mM HCO370.6 mM Cl- 0 mM Cl- 70.6 mM Cl- 7.5 7.4 7.3 7.2 7.1 7 0 500 1000 1500 Time (sec) 45 Fig. 6b. Cl- /HCO3- exchange activity (pHi /min) 0.2 P<0.0001 0.15 0.1 0.05 0 AE4 control 46 47