Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Improving adenovirus-based immunotherapies for treatment of solid
Document related concepts
no text concepts found
Transcript
71/2016 Aino Salminen
Matrix Metalloproteinase 8: Genetic, Diagnostic, and Therapeutic Approaches
72/2016 Maili Jakobson
Molecular Mechanisms Controlling Neuronal Bak Expression
73/2016 Lukasz Kuryk
Strategies to Enhance Efficacy of Oncolytic Virotherapy
74/2016 Sini Heinonen
Adipose Tissue Metabolism in Acquired Obesity
75/2016 Elina Karhu
Natural Products as a Source for Rational Antichlamydial Lead-Discovery
76/2016 Zhilin Li
Inflammatory Polarization of Immune Cells in Neurological and Neuropsychiatric Disorders
77/2016 Aino Salonsalmi
Alcohol Drinking, Health-Related Functioning and Work Disability
78/2016 Heini Wennman
Physical Activity, Sleep and Cardiovascular Diseases: Person-oriented and Longitudinal
Perspectives
79/2016 Andres Lõhmus
Helper Component-Proteinase and Coat Protein are Involved in the Molecular Processes of
Potato Virus A Translation and Replication
80/2016 Li Ma
Brain Immune Gene Network in Inbred Mouse Models of Anxiety- and Sociability-related
Neuropsychiatric Disorders
81/2016 Finny S. Varghese
Cracking the Code of Chikungunya Virus: Inhibitors as Tools to Explore Alphavirus Biology
82/2016 Vera Shirokova
Transcription Factor Foxi3 in Hair Follicle Development and Homeostasis
83/2016 Daria Bulanova
Novel Genetic Determinants of Breast Cancer Progression
84/2016 Hugh Chapman
The hERG1 (KV11.1) Potassium Channel: Its Modulation and the Functional Characterisation of
Genetic Variants
85/2016 Katja Rosti
Expression and Characterization of Neuronal Membrane Receptor Proteins
86/2016 Irepan Salvador-Martínez
Estimating Complexity and Adaptation in the Embryo: A Statistical Developmental Biology
Approach
1/2017 Essi Havula
Transcriptional Control of Dietary Sugar Metabolism and Homeostasis by Mondo-Mlx
Transcription Factors
2/2017 Satu Massinen
Specific Reading Disorder: Cellular and Neurodevelopmental Functions of
Susceptibility Genes
3/2017 Margarita Andreevskaya
Ecological Fitness and Interspecies Interactions of Food-SpoilageAssociated Lactic Acid Bacteria: Insights from the Genome Analyses and
Transcriptome Profiles
ISSN 2342-3161
ISBN 978-951-51-2834-8
dissertationes scholae doctoralis ad sanitatem investigandam
universitatis helsinkiensis
MIKKO SIURALA
Improving Adenovirus-based Immunotherapies
for Treatment of Solid Tumors
CANCER GENE THERAPY GROUP
DEPARTMENT OF ONCOLOGY
FACULTY OF MEDICINE
DOCTORAL PROGRAMME IN BIOMEDICINE
UNIVERSITY OF HELSINKI
4/2017
Helsinki 2017
MIKKO SIURALA Improving Adenovirus-based Immunotherapies for Treatment of Solid Tumors
Recent Publications in this Series
4/2017
IMPROVING ADENOVIRUS-BASED
IMMUNOTHERAPIES FOR TREATMENT OF SOLID
TUMORS
Mikko Siurala
Cancer Gene Therapy Group
Department of Oncology
Doctoral Programme in Biomedicine (DPBM)
Faculty of Medicine
University of Helsinki
ACADEMIC DISSERTATION
To be publicly discussed with the permission of the Faculty of Medicine of the University
of Helsinki, in Haartman Institute, Lecture Hall 2, on 20th of January 2017, at 12 noon
Helsinki 2017
1
Supervised by
Akseli Hemminki, MD, PhD
Jane and Aatos Erkko Foundation Professor of Oncology
Cancer Gene Therapy Group
Department of Oncology
Faculty of Medicine
University of Helsinki, Finland
and
Helsinki University Hospital Comprehensive Cancer Center
Thesis Committee
Hanna Jarva, MD, PhD, Docent
Leila Vaalavirta, MD, PhD, Docent
Department of Bacteriology and Immunology
Helsinki University Hospital
University of Helsinki, Finland
Comprehensive Cancer Center
Reviewers
Veijo Hukkanen, MD, PhD, Docent
Hanna Jarva, MD, PhD, Docent
Department of Virology
Department of Bacteriology and Immunology
University of Turku, Finland
University of Helsinki, Finland
Official Opponent
John Haanen, MD, PhD
Professor of Translational Immunotherapy of Cancer
Netherlands Cancer Institute, The Netherlands
Dissertationes Scholae Doctoralis Ad Sanitatem Investigandam Universitatis Helsinkiensis
No. 4/2017
http://ethesis.helsinki.fi
ISBN 978-951-51-2834-8 (paperback)
ISSN 2342-3161 (print)
ISBN 978-951-51-2835-5 (PDF)
ISSN 2342-317X (online)
2
“Avoid the temptation to work so hard that there is no time left for serious thinking.”
— Francis Crick
3
TABLE OF CONTENTS
PART A
LIST OF ORIGINAL PUBLICATIONS .................................................................... 7
ABBREVIATIONS........................................................................................................ 8
ABSTRACT ................................................................................................................. 11
PART B
1.
REVIEW OF THE LITERATURE .................................................................... 13
1.1.
Introduction ..................................................................................................... 13
1.2
Chemotherapy ................................................................................................. 13
1.2.1 Doxorubicin and ifosfamide ............................................................... 14
1.2.2 Immunogenic cell death ..................................................................... 15
1.3
Oncolytic viruses ............................................................................................ 16
1.3.1 Adenovirus biology ............................................................................ 17
1.3.2 Oncolytic adenoviruses ...................................................................... 18
1.3.2.1 Transcriptional and transductional targeting .............................. 19
1.3.2.2 Immunological aspects ............................................................... 20
1.3.2.3 Preclinical animal models........................................................... 22
1.3.2.4 Clinical experience ..................................................................... 23
1.4
Non-replicating adenovirus vectors ................................................................ 24
1.5
Tumor immunology and immunotherapy ....................................................... 25
1.5.1 Cancer immunoediting and the tumor microenvironment.................. 26
1.5.2 Recombinant cytokines in cancer treatment ....................................... 26
1.5.3 Immune checkpoint blockade ............................................................. 28
1.5.4 Adoptive cell therapies ....................................................................... 28
1.5.4.1 Tumor-infiltrating lymphocytes ................................................. 29
1.5.4.2 T-cell receptor-engineered T-cells ............................................. 31
1.5.4.3 Chimeric antigen receptor T-cells .............................................. 33
2. AIMS OF THE STUDY .......................................................................................... 35
3. MATERIALS AND METHODS ............................................................................ 36
3.1
Viruses ............................................................................................................ 36
3.2
Cell lines ......................................................................................................... 37
3.3
In vitro studies ................................................................................................ 38
3.3.1 Chemotherapeutic agents (I)............................................................... 38
3.3.2 Cell viability and co-culture experiments (I-IV) ................................ 38
3.3.3 Quantitative PCR from tumor cell lines (I) ........................................ 39
3.3.4 Immunogenic cancer cell death (I) ..................................................... 39
4
3.3.5 Blocking experiments (II)................................................................... 40
3.3.6 Cytokine expression (III, IV) ............................................................. 40
3.3.7 Cytokine functionality (III, IV) .......................................................... 40
3.4
In vivo studies ................................................................................................. 41
3.4.1 Syrian hamster sarcoma model (I) ...................................................... 41
3.4.2 Oncolytic adenovirus and chemotherapy in the B16.OVA model (I) 42
3.4.3 Quantitative PCR from tumors (I) ...................................................... 42
3.4.4 Human soft-tissue sarcoma xenograft model (I) ................................ 42
3.4.5 Histopathology (I, IV) ........................................................................ 42
3.4.6 TIL culture (II, IV) ............................................................................. 43
3.4.7 Adoptive TIL transfer and virus treatments (II, IV) ........................... 43
3.4.8 Transgene expression (III, IV) ........................................................... 43
3.4.9 Chemokine expression (III) ................................................................ 44
3.4.10 Adoptive OT-I transfer (III).............................................................. 44
3.4.11 OT-I radiolabelling and SPECT/CT imaging (III) ........................... 44
3.4.12 Orthotopic SCID mouse model of ovarian cancer (IV) .................... 44
3.4.13 Splenocyte proliferation (IV) ........................................................... 45
3.4.14 Flow cytometry (I-IV) ...................................................................... 45
3.5
Statistical analyses .......................................................................................... 46
3.6
Ethical considerations ..................................................................................... 46
4. RESULTS AND DISCUSSION .............................................................................. 47
4.1 In vitro studies with doxorubicin/ifosfamide and oncolytic adenovirus Ad5/3-D24GMCSF (I) ................................................................................................................. 47
4.2 In vivo antitumor efficacy is enhanced with oncolytic adenovirus and chemotherapy
combinations (I) ......................................................................................................... 48
4.3 Tumor-infiltrating lymphocytes (TIL) can be cultured ex vivo from syngeneic Syrian
hamster tumors (II) .................................................................................................... 49
4.4 Oncolytic adenovirus enhances TIL therapy of established pancreatic cancer (II)51
4.5 Armed adenovirus vectors produce high levels of tumor-restricted biologically active
cytokines (III) ............................................................................................................ 52
4.6 Cytokine-coding adenoviruses enhance adoptive T-cell therapy of murine melanoma by
reshaping the tumor microenvironment and inducing T-cell trafficking (III) ........... 52
4.7 Oncolytic adenoviruses coding for human TNFa and IL-2 kill human and hamster
cancer cells in vitro and synergize with hamster TIL (IV) ........................................ 55
4.8 Armed oncolytic adenoviruses exhibit potent antitumor activity against ovarian cancer
xenografts and Syrian hamster pancreatic cancer (IV) .............................................. 56
4.9 Cytokine-armed oncolytic adenoviruses induce tumor-specific antitumor immunity and
increased splenocyte proliferation (IV) ..................................................................... 57
5. SUMMARY AND CONCLUSIONS ...................................................................... 60
5
6. ACKNOWLEDGEMENTS .................................................................................... 61
7. REFERENCES ........................................................................................................ 63
PART C - ORIGINAL PUBLICATIONS ................................................................. 90
6
PART A
LIST OF ORIGINAL PUBLICATIONS
The thesis is based on the following original publications, which are referred to in the text by their
roman numerals.
I
SIURALA M, Bramante S, Vassilev L, Hirvinen M, Parviainen S, Tähtinen S, Guse
K, Cerullo V, Kanerva A, Kipar A, Vähä-Koskela M, Hemminki A. Oncolytic
adenovirus and doxorubicin-based chemotherapy results in synergistic antitumor
activity against soft-tissue sarcoma. International Journal of Cancer. 2015,
136(4):945-54.
II
SIURALA M, Vähä-Koskela M, Havunen R, Tähtinen S, Bramante S, Parviainen
S, Mathis JM, Kanerva A, Hemminki A. Syngeneic Syrian hamster tumors feature
tumor-infiltrating lymphocytes allowing adoptive cell therapy enhanced by
oncolytic adenovirus in a replication permissive setting. Oncoimmunology. 2016,
18;5(5).
III
SIURALA M, Havunen R, Saha D, Lumen D, Airaksinen AJ, Tähtinen S, CerveraCarrascon V, Bramante S, Parviainen S, Vähä-Koskela M, Kanerva A, Hemminki
A. Adenoviral delivery of tumor necrosis factor alpha and interleukin-2 enables
successful adoptive cell therapy of immunosuppressive melanoma. Molecular
Therapy. 2016, 24(8):1435-43.
IV
Havunen R, SIURALA M, Parviainen S, Grönberg-Vähä-Koskela S, Behr M,
Tähtinen S, Santos J, Rusanen J, Nettelbeck D, Ehrhardt A, Kanerva A, Hemminki
A. Oncolytic adenoviruses armed with tumor necrosis factor alpha and interleukin2 enable successful adoptive cell therapy with tumor-infiltrating lymphocytes.
Molecular Therapy – Oncolytics. Accepted for publication.
Publication I was included in the thesis of Simona Bramante (Oncolytic Adenovirus Coding for
GM-CSF in Treatment of Cancer, University of Helsinki, 2015).
7
ABBREVIATIONS
ACT
adoptive cell transfer or adoptive cell therapy
Ad
adenovirus
AFP
alpha-fetoprotein
AML
acute myeloid leukemia
ANOVA
analysis of variance
APC
antigen-presenting cell
ATAP
Advanced Therapy Access Program
ATCC
American Type Culture Collection
ATP
adenosine triphosphate
B-ALL
B cell acute lymphoblastic leukemia
BTLA
B and T lymphocyte attenuator
CAR
coxsackie-adenovirus receptor
CAR
chimeric antigen receptor
CEA
carcinoembryonic antigen
CIK
cytokine-induced killer
CMV
cytomegalovirus
Cox-2
cyclooxygenase-2
CTA
cancer–testis antigen
CTLA-4
cytotoxic T-lymphocyte-associated protein 4
CXCR3
C-X-C motif chemokine receptor 3
DAMP
damage-associated molecular pattern
DC
dendritic cell
DLT
dose-limiting toxicity
DSG-2
desmoglein-2
E/T
effector-to-target
ELISA
enzyme-linked immunosorbent assay
EMEA
European Medicines Agency
ER
endoplasmic reticulum
FBS
fetal bovine serum
FDA
Food and Drug Administration
8
FTV
fractional tumor volume
GAPDH
glyceraldehyde 3-phosphate dehydrogenase
GMCSF
granulocyte-macrophage colony-stimulating factor
HEPES
4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid
HMGB1
high mobility group box 1 protein
HPV
human papillomavirus
HSV-1
herpes simplex virus type 1
hTERT
human telomerase reverse transcriptase
ICD
immunogenic cell death
IDO
indoleamine 2,3-dioxygenase 1
IFNg
interferon gamma
IFNa2
interferon alpha-2
IFNb
interferon beta
IL
interleukin
IP-10
interferon gamma-induced protein 10
I-TAC
interferon-inducible T-cell alpha chemoattractant
ITAM
immunoreceptor tyrosine-based activation motif
LAG-3
lymphocyte-activated gene 3
LAK
lymphokine-activated killer cell
mAb
monoclonal antibody
MAGE
melanoma-associated antigen
MCP-1
monocyte chemoattractant protein-1
MDSC
myeloid-derived suppressor cell
MHC
major histocompatibility complex
MIG
monokine induced by gamma interferon
MIP1a/b
macrophage inflammatory protein 1 alpha/beta
MTD
maximum tolerated dose
MTS
3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2Htetrazolium
NAb
neutralizing antibody
NK
natural killer
NSG
NOD scid gamma
9
ORR
objective response rate
OVA
ovalbumin
PAMP
pathogen-associated molecular pattern
PBS
phosphate buffered saline
PD1
programmed death 1
PD-L1
programmed death ligand 1
PEG
polyethylene glycol
PET/CT
positron emission tomography/computed tomography
PRR
pattern recognition receptor
PSA
prostate-specific antigen
qPCR
quantitative polymerase chain reaction
RANTES
regulated on activation, normal T-cell expressed and secreted
Rb
retinoblastoma
REP
rapid expansion protocol
SCID
severe combined immunodeficiency
SPECT/CT single-photon emission computed tomography/computed tomography
STS
soft-tissue sarcoma
TAA
tumor-associated antigen
TBI
total body irradiation
TCR
T-cell receptor
TDO
tryptophan 2,3-dioxygenase
TGFb
transforming growth factor beta
TIL
tumor-infiltrating lymphocyte
TLR
toll-like receptor
TNFa
tumor necrosis factor alpha
TNBC
triple-negative breast cancer
Treg
regulatory T-cell
VEGF
vascular endothelial growth factor
VLS
vascular leak syndrome
VP
viral particle
VSV
vesicular stomatitis virus
10
ABSTRACT
New treatment modalities are needed for patients with advanced cancer, who have undergone
several unsuccessful pretreatments. Cancer immunotherapy has emerged as a promising field of
medicine with the potential to induce durable responses in these patients. Within the
immunotherapy field, a diverse set of approaches have been employed, all of which aim at
combating tumors with the cells of the immune system. Oncolytic immunotherapy encompasses
the use of genetically engineered viruses to specifically kill (lyse) tumor cells and, importantly, to
induce an antitumor immune response in the process. Oncolytic adenoviruses in particular possess
an excellent safety profile and can be armed with immunostimulatory transgenes for the
enhancement of antitumor immunity.
In the first part of the thesis, oncolytic adenovirus armed with granulocyte-macrophage colonystimulating factor (GMCSF) was used together with the chemotherapeutic agents doxorubicin and
ifosfamide to treat soft-tissue sarcoma (STS) in an adenovirus-permissive Syrian hamster model.
The combination treatment was highly effective against syngeneic hamster leiomyosarcoma
tumors in vivo, with indications that adenovirus replication was improved in the presence of
doxorubicin and that oncolytic adenovirus/chemotherapy combination induced immunogenic cell
death (ICD) of tumor cells.
Tumor-infiltrating lymphocytes (TIL) from syngeneic Syrian hamster tumors were cultured,
characterized and used therapeutically with oncolytic adenovirus in the second part of the thesis.
Co-treatment of pancreatic cancer tumors with adoptive transfer of pancreatic cancer –derived
TIL and oncolytic adenovirus resulted in improved antitumor efficacy when compared with either
monotherapy.
In the third part, non-replicating adenovirus vectors coding for the murine cytokines tumor
necrosis factor alpha (TNFa) and interleukin 2 (IL-2) were constructed and used in combination
with adoptive transfer of tumor-specific T-cell receptor –engineered (TCR) T-cells for the
treatment of immunosuppressive melanoma. This combination showed significant antitumor
efficacy over single agent treatments. Mechanistic studies revealed that intratumoral virus
injections induce trafficking of adoptively transferred T-cells to tumors. Furthermore, the
cytokine-coding adenoviruses caused favorable alterations in the tumor microenvironment.
In the final part of the thesis, oncolytic adenoviruses coding for human versions of TNFa and IL2 were used with hamster TIL to successfully treat pancreatic cancer tumors. In fact, virus
11
injections were capable of eliminating most tumors when combined TIL transfer, and protected
cured hamsters from tumor rechallenge. From a safety perspective it is noteworthy that virusmediated cytokine production was restricted to tumors, as negligible levels of cytokines were
observed in the sera of intratumorally injected animals.
In conclusion, the combinatorial approach studied in the preclinical setting here represents a
rational and effective solution for the treatment of advanced solid tumors, warranting the clinical
translation of adenovirus-based immunotherapy combined with other immunotherapies.
12
PART B
1. REVIEW OF THE LITERATURE
1.1. Introduction
Cancer is set to become the major cause of mortality in every region of the world, as new cases
are projected to increase dramatically by the year 2030 (Vineis & Wild 2014). Even though cure
rates have improved significantly during the 20th century with the advent of chemotherapy and
radiotherapy, many cancers survive the first, second, third and even fourth-line standard
treatments to eventually become death-causing diseases. Thus, new treatment options are sorely
needed for these patients whose disease has metastasized to multiple sites and are not within reach
of current therapies.
Development of genetic engineering methods has revolutionized the way new targets for cancer
therapy are being discovered (Helmy et al. 2013). Among emerging treatment modalities, cancer
immunotherapy aims to enable the immune system to effectively recognize and attack cancerous
cells (Farkona et al. 2016). Immunotherapy has developed rapidly into a promising field of
medicine. Although considered a relatively new field, its origins could be dated back to Edward
Jenner´s smallpox vaccine in the 1700s (Riedel 2005), and perhaps more appropriately to William
B. Coley´s mixed bacterial vaccine, or “Coley´s toxin”, in the late 1800s (Wiemann & Starnes
1994). Multiple approaches have been taken to empower the immune system to fight cancer; from
immunostimulatory cytokines to adoptive T-cell transfer, and more recently, oncolytic viruses.
Although many of these modalities have shown promising signs of efficacy, further work is
needed to find combinations of immunotherapies that complement each other for optimal
treatment outcome.
1.2 Chemotherapy
The term “chemotherapy” was first coined in the early 1900s by German chemist Paul Ehrlich,
who was developing drugs for infectious diseases (DeVita & Chu 2008). He was also interested
in cancer therapy with primitive alkylating agents. It was not until World War II that the field
started to truly develop. Soldiers accidentally exposed to sulfur mustards were markedly depleted
of bone marrow and lymph nodes, which eventually led to development of oral derivatives of
nitrogen mustard for lymphoma treatment. Further discoveries in the field led eventually to the
use of combinations of chemotherapeutics for solid tumors as well, e.g. advanced breast cancer
13
and testicular cancer, with encouraging results. Since the early years, combinatorial use has
matured significantly and is now used in several indications as standard treatment. However,
toxicities related to chemotherapeutics have limited their use from the beginning, and another
drawback of chemotherapy is the establishment of resistance, which can lead to tumor progression
and eventually death. Drug resistance is associated with overexpression of P-glycoprotein, a
transmembrane drug efflux pump (Malhotra & Perry 2003). Nevertheless, chemotherapeutic
regimens remain a valuable tool for oncologists alongside other conventional treatment
modalities.
1.2.1 Doxorubicin and ifosfamide
The combination of doxorubicin and ifosfamide has been the standard first-line chemotherapy
regimen for STS since the late 1970s (Ratan & Patel 2016). Doxorubicin, an anthracycline
antibiotic, acts by intercalating the base pairs of DNA´s double helix, resulting in ceased DNA
replication and RNA transcription, and subsequent cell death (Tacar et al. 2013). Cardiotoxicity
is the main toxic effect induced by doxorubicin due to enlargening of cardiomyocytes. Other
common side effects associated with doxorubicin administration include vomiting, nausea,
gastrointestinal problems and neurological disturbances. Ifosfamide, like its cousin
cyclophosphamide, works by alkylating (adding of alkyl group) DNA bases thus impairing DNA
replication and/or transcription (Puyo et al. 2014). Ifosfamide and cyclophospamide belong to
oxazaphorines which are derivatives of nitrogen mustards, but enhanced for stability and safety
(Giraud et al. 2010). They are prodrugs, meaning that they require activation in the liver by
cytochrome P450 enzymes to yield active metabolites (Preissner et al. 2015). The main serious
adverse effects of ifosfamide are nephrotoxicity and bladder toxicity (Korkmaz et al. 2007), which
necessitates the simultaneous use of Mesna (2-mercaptoethane sulfonate) to counter toxicities
(Salman et al. 2016).
As mentioned above, doxorubicin and ifosfamide in combination are used in the treatment of softtissue sarcomas. These malignancies are rare and heterogeneous, as they can arise from several
soft tissue types (Quesada & Amato 2012). Surgery and radiotherapy can be effective for local
resected disease, but for metastatic disease the aforementioned chemotherapy combination is most
widely used, although temozolomide and gemcitabine are also used (Awada et al. 2004, Reed &
Altiok 2011). The well-established doxorubicin plus ifosfamide standard therapy was recently
challenged, however, as the single largest Phase III clinical trial performed in STS (EORTC
14
62012) indicated that single agent doxorubicin was in fact as effective as doxorubicin combined
with ifosfamide (Judson et al. 2014).
1.2.2 Immunogenic cell death
Some chemotherapeutics possess features beyond direct cytotoxicity, for which they were
originally developed. The cancer cell death modality they trigger is called immunogenic cell death
(ICD), a variant of apoptosis, which is sensed by the innate immune system and contributes to the
overall antitumor activity of chemotherapy (Galluzzi et al. 2012). ICD is characterized by three
major cellular events: 1) cell-surface exposure of calreticulin, 2) extracellular HMGB1 (high
mobility group box 1 protein) release, and 3) extracellular ATP (adenosine triphosphate) release
(Kepp et al. 2014) (Figure 1). These damage-associated molecular patterns (DAMPs) bind to
pattern recognition receptors (PRRs) on immune cells to exert immunostimulatory effects
(Zitvogel et al. 2010).
The earliest event in ICD is the translocation of calreticulin, one of the most abundant proteins in
the endoplasmic reticulum (ER), to the surface of the dying cell (Obeid et al. 2007). Membraneexposed calreticulin delivers a phagocytic “eat-me” signal to antigen-presenting cells (APC)
improving their capability to take up dead tumor cells. Extracellular ATP in turn acts as a
chemoattractant to immune cells per se, but also activates the NLR family pyrin domain
containing 3 (NLRP3) inflammasome in APCs leading to release of IL-1b and IL-18 (Ghiringhelli
et al. 2009). Released HMGB1 binds to Toll-like receptors (TLR) on APCs thus stimulating the
production of proinflammatory cytokines (Andersson et al. 2000, Tesniere et al. 2008).
Interestingly, the redox status of HMGB1 seems to determine its immunomodulatory role
(Venereau et al. 2012). Reduced HMGB1 triggers immunogenic DCs, but oxidized HMGB1 fails
to do so. Since the tumor microenvironment features an unstable redox milieu, conflicting reports
on the effect of HMGB1 for antitumor immunity could be explained by these fluctuations (Inoue
& Tani 2013). The clinically approved chemotherapeutic drugs that have been confirmed to
induce immunogenic cancer cell death are bleomycin, bortezomib, cyclophosphamide,
doxorubicin, epirubicin, idarubicin, mitoxantrone and oxaliplatin (Pol et al. 2015b). It is
noteworthy that doxorubicin was in fact the “prototype” drug when chemotherapy-induced ICD
was first discovered (Casares et al. 2005).
15
Figure 1. Immunogenic cell death. A cancer cell exposed to chemotherapeutic agents (and/or
oncolytic adenovirus) translocates calreticulin (CRT) to the cell surface and secretes ATP and
HMGB1. These signals activate dendritic cells to take up tumor-associated antigens (TAAs)
released from the dying cell, ultimately leading to T-cell activation.
1.3 Oncolytic viruses
Oncolytic viruses are viruses that are capable of specifically infecting and lysing tumor cells
(Breitbach et al. 2016). To date, a plethora of viruses from various genera have been utilized as
oncolytics, either as genetically modified agents (e.g. vaccinia virus, adenovirus) or wild-type
viruses possessing natural tropism for cancer cells (e.g. reovirus) (Zamarin & Pesonen 2015). In
addition to their direct lytic properties, they have emerged as potent activators of antitumor
immune responses that are important for optimal efficacy. Over 20 years of development in the
field recently led to the first Food and Drug Administration (FDA) and European Medicines
Agency (EMEA) approved GMCSF-expressing oncolytic herpes virus therapeutic, Imlygic®
(talimogene laherparepvec), for advanced melanoma (Breitbach et al. 2016). Many others are
currently in randomized clinical trials, including Pexa-vec (poxvirus) and Reolysin® (reovirus)
(Pol et al. 2015a). The focus of this thesis was on adenovirus, which will therefore be discussed
in detail hereafter.
16
1.3.1 Adenovirus biology
Adenovirus particles were first isolated in the 1950s from adenoid tissue (Rowe et al. 1953). It is
a common virus that causes upper respiratory tract infections, pneumonia, bronchitis and
conjuctivitis (Kunz & Ottolini 2010). The over 50 identified serotypes (belonging to six groups
named from A to F) are each associated with different clinical manifestations. Also, the
seroprevalence in the adult population varies significantly (Schmitz et al. 1983). Serotype 5
adenovirus (member of group C) is the most frequently used vector in gene therapy studies, due
to its well-known functions and structure (Appaiahgari & Vrati 2015). By comparison, serotype
3 has utility in cancer gene therapy applications owing to its lower seroprevalence and the high
expression of serotype 3 receptors on cancer cells (Hemminki et al. 2011). Lower seroprevalence
is desirable, since pre-existing neutralizing antibodies limit the efficacy of systemic adenovirus
gene therapy (Uusi-Kerttula et al. 2015).
Structurally, adenovirus is a non-enveloped double-stranded DNA virus with an icosahedral
protein capsid (Nemerow et al. 2009) (Figure 2). Out of the 40 different proteins that the 36 kb
genome encodes, only 12 are involved with virus particle construction (Lehmberg et al. 1999).
The outer part of the virus is formed by 240 trimers of hexon, the major capsid protein. The two
other major capsid proteins are penton base and fiber. Penton base is a pentameric molecule that
associates with the fiber protein, which in turn is formed of shaft and knob parts that are
responsible for host cell attachment (Law & Davidson 2005). Minor capsid proteins pIX, pIIIa,
pVI and pVIII have been proposed to help stabilize the virus capsid (Saban et al. 2006). Inside the
virion, core proteins pV, pVII, pX (or μ) and terminal protein (TP) are associated with the DNA
genome.
Adenovirus life cycle can be considered to start from binding to host cell. This process involves
the knob proteins on the virus and the coxsackie-adenovirus receptors (CAR) (for serotype 5) or
desmoglein 2 (DSG-2) (for serotype 3) on the host cell surface (Bergelson et al. 1997, Wang et
al. 2011). After binding to high-affinity receptors, the virus enters the cell via clathrin-mediated
endocytosis (Smith et al. 2010). Once internalized, the virus particles inside endosomes are
stripped of capsid proteins due to the acidic environment. The resulting partially uncoated virus
particle is transported to the nucleus along microtubules. Finally, the viral genome is released into
the nucleus. Here, the expression of viral genes begins and new virions are generated.
Adenovirus transcription is a two-phase event, consisting of early and late phases (Russell 2000).
E1 (early) genes E1A and E1B are first expressed and these proteins interfere with cell division
17
processes to favor virus replication. E2 gene products provide the machinery for viral DNA
replication (Hay et al. 1995). The E3-derived proteins subvert host defence mechanisms and are
thus dispensable in in vitro situations (Russell 2000). E4 gene products shut off host protein
synthesis, promote virus DNA replication and facilitate virus mRNA metabolism (Halbert et al.
1985). Finally, the late genes L1-L5, encoding structural proteins needed for virion assembly, are
transcribed (Russell 2000). As the last step in the life cycle of adenovirus, the host cell is lysed
and new virions are released.
Figure 2. Structure of adenovirus.
1.3.2 Oncolytic adenoviruses
As adenoviruses have no natural tropism for tumor cells, genetic engineering techniques are
needed to modify them for this purpose. Two approaches are employed to produce viruses with
specificity to tumor cells: transcriptional and transductional targeting (Alemany 2009). In
transcriptional targeting, viral gene expression is controlled with tumor-specific promoters,
whereas in transductional targeting the virus capsid is modified for increased affinity for tumor
cells. Preclinical and clinical use of oncolytic adenovirus has demonstrated the safety and efficacy
18
of this form of cancer therapy, with indications that arming the viruses with immunostimulatory
molecules induces beneficial changes in the tumor microenvironment (Cerullo et al. 2010a, Ranki
et al. 2014, Vassilev et al. 2015, Ranki et al. 2016).
1.3.2.1 Transcriptional and transductional targeting
In transcriptional targeting, small deletions made to the adenovirus E1A gene render the virus
specific to cancer cells with regard to replication (Pesonen et al. 2011). The ONYX-015 virus,
with deletions in the E1B-55k gene, was one of the first of its kind and exhibited cell killing
specific to p53-mutated cells (Bischoff et al. 1996). Another E1A-deleted virus, Delta24, featured
a 24-base pair deletion in the retinoblastoma (Rb) binding region of E1A (Fueyo et al. 2000). This
renders the virus incapable of replicating in normal cells with intact Rb/p16 pathway which by
contrast is defective in cancer cells (Sherr & McCormick 2002). In normal cells the deleted E1A
is unable to bind Rb and to release the transcription factor E2F, which is required for replication
to start. However, in cancer cells the abundantly available E2F transcomplements the mutated
E1A thus enabling virus replication to proceed.
In addition to E1A deletions, tumor-specific promoters can be incorporated into adenovirus
genomes to restrict virus replication to tumors. For example, prostate tumors expressing prostatespecific antigen (PSA) have been targeted successfully in this way (Rodriguez et al. 1997).
Melanoma has been targeted by controlled E1A expression by the tyrosinase promoter (Nettelbeck
et al. 2002). Alpha-fetoprotein (AFP) –producing hepatocellular carcinoma has been used as target
for tumor-specific viruses (Li et al. 2001, Kim et al. 2002, Kwon et al. 2010), and colorectal cancer
has been targeted by a carcinoembryonic antigen (CEA) –specific promoter (Li et al. 2003). A set
of more broadly usable promoters have also been studied including E2F (Hemminki et al. 2015,
Yan et al. 2015), vascular endothelial growth factor (VEGF) (Rein et al. 2004, Kanerva et al.
2008), human telomerase reverse transcriptase (hTERT) (Diaconu et al. 2012, Hemminki et al.
2012) and cyclooxygenase (Cox-2) (Pesonen et al. 2010).
As described earlier, transductional targeting aims to modify the adenovirus capsid proteins to
improve binding and entry to tumor cells. Several modification strategies have been studied; some
addressing the problem of low CAR expression (the primary Ad5 receptor) on tumor cells that
inhibits effective entry (Hemminki et al. 2003), and some de-targeting the liver where hepatic
macrophages (Kupffer cells) take up and neutralize adenovirus particles (Tao et al. 2001).
Insertion of an RGD-motif in the HI loop of the fiber knob enables virus entry through integrins
19
that are abundantly expressed on many cancer cells (Kangasniemi et al. 2006). Heparan sulfate
proteoglycans present in many tumors have been targeted with adenoviruses containing a COOHterminal polylysine tail (Kleeff et al. 1998, Ranki et al. 2007). In adapter-based targeting, a
“molecular bridge” is generated between the cell surface receptor and the adenovirus particle
(Glasgow et al. 2006). Examples of this approach include an adenovirus construct that targeted
malignant cells expressing folate receptors (Douglas et al. 1996), and bispecific antibodies that
bridged pulmonary endothelial cells to adenovirus vectors (Reynolds et al. 2000).
An effective approach to improve cancer cell transduction is the modification of the fiber knob to
feature components of different serotypes, also called fiber knob chimerism or serotype fiber
switching (Everts & Curiel 2004). In the 5/3 chimeric capsid construct the shaft part is derived
from serotype 5 and the knob from serotype 3, which has been shown to transduce cancer cells
efficiently (Krasnykh et al. 1996, Kanerva et al. 2002). The 5/3 chimeric virus has been studied
extensively in preclinical and clinical settings with promising results in various indications (Guse
et al. 2007, Bramante et al. 2014, Bramante et al. 2015). In another approach, Ad5/35 chimeric
adenovirus that targets the CD46 receptor instead of CAR showed effective tumor transduction
(Liu et al. 2009). More recently, an Ad5/11 virus carrying the interleukin-24 (IL-24) transgene
exhibited potent antitumor efficacy against acute myeloid leukemia (AML) (Wei et al. 2015).
Liver sequestration of adenovirus has been shown to depend on the fiber protein (Nicklin et al.
2005). For this reason, serotype 5 –based viruses with a shorter fiber shaft from serotype 3 were
constructed and demonstrated attenuated liver uptake after intravenous administration
(Breidenbach et al. 2004). Similarly, when the native fiber shaft of Ad5 was genetically shortened,
significantly lower liver uptake was observed in vivo (Vigne et al. 2003).
1.3.2.2 Immunological aspects
Adenovirus particles (like any virus particles) are sensed as “non-self” when an infection occurs,
which leads to an immediate innate immune response against the virus followed by an adaptive
immune response (Fausther-Bovendo & Kobinger 2014). Adenovirus is considered one of the
most immunogenic of viruses, inducing robust adaptive immune responses (Afkhami et al. 2016).
Various PRRs, including TLR 4 and 9, are activated upon adenovirus infection to trigger
production of proinflammatory mediators (Fejer et al. 2011). These include cytokines such as
TNFa, IL-1a/b and IFNa/b, but also chemokines MCP-1, RANTES, IP-10, MIP-1a/b and IL-8
(Hartman et al. 2008). Among first responders to these danger signals are dendritic cells, natural
20
killer cells, macrophages and neutrophils that help to control the infection by direct and indirect
mechanisms (Thaci et al. 2011). Effective triggering of an adaptive immune response requires
uptake of viral antigens via professional APCs, such as dendritic cells, and their cross-presentation
on major histocompatibility complex (MHC) molecules to naïve T-cells (helper and cytotoxic) in
the lymph node (Tacken et al. 2006). Development of an adaptive response takes approximately
one week, and the development of a full humoral response (i.e. antibody-producing B-cells)
against virus infection takes 2-4 weeks (Pesonen et al. 2010).
The role of adenovirus-neutralizing antibodies (NAb) in gene therapy applications has been
studied preclinically and in clinical trials with conflicting results. In some reports, pre-exisiting
immunity has been associated with poor efficacy when intravenous adenovirus vectors have been
administered repeatedly (Sterman et al. 2010). By contrast, pre-existing antiviral immunity
appears to be an important part of the overall antitumor response, as seen in a preclinical
adenovirus-permissive Syrian hamster model (Wang et al. 2016), and in patients treated with
capsid-chimeric oncolytic adenovirus (Kanerva et al. 2013). Of note, Ad5/3 –based adenovirus
can transduce distant brain metastases through the intravenous administration route despite the
presence of neutralizing antibodies (Koski et al. 2015).
Several approaches have been employed to protect virus particles from neutralization upon
systemic administration. Cells of the immune system can be used as “carriers”, as shown with
oncolytic reovirus in animal models (Ilett et al. 2011), and in cancer patients (Adair et al. 2012).
Coating virus particles with polyethylene glycol (PEG) (O'Riordan et al. 1999) or albuminbinding domains (Rojas et al. 2016) can shield the virus from pre-existing NAbs, but transduction
efficiency can also be reduced (Hedley et al. 2006).
Oncolytic viruses have been shown to elicit immunogenic cancer cell death (Guo et al. 2014).
This should not be surprising, since virus infection produces abundant pathogen-associated
molecular patterns (PAMPs) to be sensed by PRRs. In addition, viral oncolysis releases a natural
repertoire of tumor-associated antigens (TAAs) for uptake by DCs (Bridle et al. 2010) (Figure
1). Besides adenovirus, the following viruses have been shown to induce ICD: herpes simplex
virus type 1 (Takasu et al. 2016), Newcastle disease virus (Koks et al. 2015, Schirrmacher 2015),
measles virus (Donnelly et al. 2013), parvovirus (Angelova et al. 2014), and vaccinia virus
(Parviainen et al. 2014). With regard to adenovirus, ICD induction has been confirmed with
several virus constructs: Ad5/3-hTERT-E1A-hCD40L in EJ bladder carcinoma cells (Diaconu et
21
al. 2012), Ad5/3-D24-GMCSF in PC3-MM2 prostate cancer cells (Liikanen et al. 2013), and
Ad5/3-D24-hTNFa in both of the above cell lines (Hirvinen et al. 2015).
1.3.2.3 Preclinical animal models
The study of oncolytic adenoviruses in vivo is limited to the available animal species that are
permissive for human adenovirus replication. Unfortunately, the most widely used animals, i.e.
immunocompetent mice, do not support replication (Ying et al. 2009). Immunodeficient mice
with human xenograft tumors can, however, be utilized to evaluate adenovirus replication, but
this scenario does not allow the assessment of host immune responses that are critically important
for overall efficacy and safety. Mouse adenoviruses exist but their biology is far from human
counterparts, and therefore are not of translational value (Lenaerts et al. 2005). Pigs have been
reported to support Ad5 replication following intravenous administration (Jogler et al. 2006), and
some porcine cell lines are permissive for certain serotypes (Griesche et al. 2008). However, the
size of these animals inhibits their use as laboratory animals.
Human group C adenovirus replicates in tissues of the cotton rat (Sigmodon hispidus) (Prince et
al. 1993). Subsequently, syngeneic subcutaneous tumors of this animal have been treated with
oncolytic adenoviruses (Toth et al. 2005, Steel et al. 2007). Also, cotton rats have been utilized as
platforms for biodistribution and pharmacokinetic studies (Sonabend et al. 2009, Thaci et al.
2012). Unfortunately, the cotton rat breeds poorly and is notoriously difficult to handle, which
limits its usability as an experimental animal model (Niewiesk & Prince 2002).
In addition to the cotton rat, Syrian (Golden) hamsters (Mesocricetus auratus) are permissive for
human adenovirus (Thomas et al. 2006). To be precise, hamsters are “semi-permissive” as the
replication efficiency is not directly equivalent to humans. Still, it is a significant improvement
when compared with mice. As docile animals they are easy to handle and readily available from
commercial breeders (Thomas et al. 2007). Therefore, many have taken advantage of this fully
immunocompetent animal model in oncolytic adenovirus studies. For example, antitumor effects
and safety of IL-12 or oncostatin M –coding viruses were evaluated in hamsters bearing orthotopic
HapT1 pancreatic cancer tumors (Nistal-Villan et al. 2015, Poutou et al. 2015). The bioactivity of
human GMCSF in hamster tissues was confirmed when the GMCSF-coding virus CGTG-102 (or
Ad5/3-D24-GMCSF) was studied in hamsters with HapT1 tumors, in addition to replication
kinetics and antitumor efficacy of this virus (Koski et al. 2010). Moreover, the GMCSF-coding
virus Ad5-D24-GMCSF was able to not only eradicate HapT1 tumors, but induce tumor-specific
22
immunity as demonstrated by rechallenge experiments of cured animals (Cerullo et al. 2010a).
Finally, Syrian hamsters are useful in preclinical biodistribution and toxicity studies when
planning clinical trials with adenovirus (Matthews et al. 2009).
1.3.2.4 Clinical experience
The first oncolytic adenovirus taken into clinical trials, ONYX-015, was further modified and
eventually accepted in China in 2005 (Oncorine) for nasopharyngeal carcinomas in combination
with chemotherapy (Liang 2012). The results from Phase I and II trials with ONYX-015 showed
that intratumoral, intravenous or hepatic artery administrations were all well-tolerated with no
dose-limiting toxicities (Reid et al. 2002, Makower et al. 2003, Nemunaitis et al. 2007, Aiuti et
al. 2007). Common adverse events were flu-like symptoms that were short-lived (Aiuti et al.
2007). Interestingly, acute tumor enlargement followed by tumor regression was observed in the
ONYX-015 trials (Reid et al. 2005). This therapy-mediated tumor swelling (or pseudoprogession)
phenomenon has since been identified as a common theme in oncolytic virotherapy, and likely
reflects the strong local inflammatory response that occurs after injection that masks the reduction
in viable tumor cells (Hemminki 2014, Hemminki et al. 2014).
The safety of a human telomerase reverse transcriptase promoter driven oncolytic adenovirus,
Telomelysin, was studied in 16 patients with various advanced solid tumors (Nemunaitis et al.
2010). This Phase I trial indicated that intratumoral virus injection was well-tolerated and
suggestive evidence of efficacy was also observed. Another Phase I study confirmed the safety
and feasibility of Ad5-D24-RGD in 21 patients with gynecologic malignancies (Kimball et al.
2010). Treatment of 35 bladder cancer patients with GMCSF-encoding virus, CG0070, showed
tolerable safety and a complete response rate of 48.6% (Burke et al. 2012). Recurrent ovarian
cancer patients were treated intraperitoneally with a fiber-chimeric Ad5/3-D24 virus in a Phase I
trial (Kim et al. 2013). 6 patients out of the 8 treated had stable disease and 2 patients had
progressive disease, while adverse events were mild. Oncolytic adenovirus armed with cytosine
deaminase/thymidine kinase transgenes has been used to treat prostate cancer patients with
promising results (Freytag et al. 2007, Freytag et al. 2014).
ONCOS-102 (or CGTG-102 or Ad5/3-D24-GMCSF) was recently studied in a Phase I trial with
12 patients (Ranki et al. 2016). The patients received repeated intratumoral virus injections and
daily low-dose cyclophosphamide. Virus treatment was well-tolerated, as no dose-limiting
toxicities were observed. Based on positron emission tomography/computed tomography
23
(PET/CT) imaging, 40% had disease control, and interestingly 11 out of 12 patients showed
prominent TIL infiltration post-treatment. Previously, CGTG-102 was used to treat patients with
advanced solid tumors in the Advanced Therapy Access Program (ATAP) which was not a clinical
trial, but a personalized treatment program under the Advanced Therapy Directive
(EU/1394/2007) (Cerullo et al. 2010b, Koski et al. 2010, Bramante et al. 2014). Out of 290
patients treated between 2007 and 2012, 115 received CGTG-102. The safety and efficacy profile
in these patients was very similar to the 12 patients treated in the Phase I trial with CGTG-102.
1.4 Non-replicating adenovirus vectors
In addition to their use as oncolytics, adenoviruses can be utilized as vectors for transgene delivery
into tumors. Early examples include a study where murine breast cancer was treated
intratumorally with an adenovirus vector encoding the human IL-2 gene, which eliminated the
tumors and induced protection against rechallenge (Addison et al. 1995). Similarly, a murine IL2 –coding vector was injected into murine mastocytoma tumors with a 75% cure rate (Cordier et
al. 1995). Established fibrosarcoma tumors treated with IL-2 -coding adenovirus resulted in
delayed tumor growth (Toloza et al. 1996). Mouse thyroid carcinoma tumors showed marked
infiltration of CD4+ and CD8+ cells following injection with AdCMVmIL2, and protected cured
animals from rechallenge (Zhang et al. 1998). In a Phase I clinical trial with breast cancer and
melanoma patients, an E1/E3-deleted adenovirus encoding IL-2 (AdCAIL-2) was injected into
subcutaneous lesions (Stewart et al. 1999). Clinical responses were not seen, but lymphocyte
infiltration was observed in post-injection biopsies. Importantly, no circulating IL-2 was observed
at any timepoint, indicating safety of the treatment. TG1024, another IL-2 –coding adenoviral
vector, was used in a Phase I/II trial to treat advanced solid tumors and melanoma (Dummer et al.
2008). In this trial, objective responses were only observed at the higher doses (above 3 x 10 11
VP). However, CD8+ lymphocyte infiltration was induced in injected lesions, and side effects
were mild.
Adenoviral vector carrying the TNFa gene was used to treat mouse colon adenocarcinoma MCA26 with intratumoral injections (Wright et al. 1999). As seen with IL-2 gene delivery, cured
animals in this study developed protective immunity against rechallenge with the same tumor.
TNFerade, a replication-deficient adenoviral vector for TNFa, has been studied in 8 clinical trials
for various cancers (Kali 2015). In the most recent Phase I and Phase III trials TNFerade was
administered alongside chemotherapy and radiation; the Phase I dose-escalation study indicated
24
the safety of the therapy (Seiwert et al. 2013), but antitumor efficacy in the Phase III study was
absent despite the good safety profile seen before (Herman et al. 2013).
TG1042, an adenovirus vector coding for interferon gamma (IFNg), has been studied in the
treatment of cutaneous T- and B-cell lymphomas (Dummer et al. 2004, Dummer et al. 2010,
Dreno et al. 2014). Treatments were well-tolerated and objective response rates were observed in
50-85% of patients. Of note, CD8+ T-lymphocyte infiltration in the injected lesions correlated
with clinical benefit (Accart et al. 2013). TG1042 has also been combined with adoptive transfer
of TIL in metastatic melanoma patients (Khammari et al. 2015). In this clinical study, 18 stage
IIIc/IV patients received repeated intralesional injections of TG1042 and two TIL infusions on
days 1 and 29. Subcutaneous IL-2 was given after TIL infusions for 10 days. Overall objective
response rate was 38.5% among the 13 patients evaluable, and the treatment was well-tolerated.
Intratumoral administration of interferon beta (IFNb) –coding adenovirus vector caused tumor
regressions in immunodeficient mice with established human xenograft tumors (Qin et al. 1998,
Cao et al. 2001). Clinical studies with IFNb-coding viruses have been performed in patients with
mesothelioma (Sterman et al. 2007, Sterman et al. 2010) and glioma (Chiocca et al. 2008) with
good safety profiles (Dummer et al. 2004).
Adp53, an adenovirus vector that restores the wild-type function of the tumor suppressor gene
p53, was approved in China for the treatment of head and neck squamous cell carcinoma in 2004
after clinical trials demonstrated safety and efficacy gains (Chen et al. 2014). Gene therapy for
glioblastoma has been studied in a Phase III study with an adenoviral vector containing the herpes
simplex virus thymidine kinase gene (sitimagene ceradenovec) in combination with ganciclovir
(Westphal et al. 2013). 124 patients received the experimental treatment, whereas 126 received
standard care; time to death was increased in the former but overall survival was not improved.
Taken together, clinical studies with cytokine-coding adenoviral vectors have confirmed the
safety of the approach, but antitumor efficacy has remained rather modest.
1.5 Tumor immunology and immunotherapy
Tumors comprise a complex network of cellular and soluble factors that promote the growth and
spread of the cancer, while hampering efficient recognition by the immune system in a process
called cancer immunoediting (Dunn et al. 2002). The immunosuppressive tumor
microenvironment (TME) represents a major barrier to tumor-reactive immune cells that have the
25
capacity to destroy tumor cells, but face a hostile environment. Overcoming immunosuppression
is therefore one of the main goals of cancer immunotherapy.
1.5.1 Cancer immunoediting and the tumor microenvironment
The relationship between a developing tumor and the host immune system was originally
postulated as “cancer immunosurveillance”, but has since been updated and termed “cancer
immunoediting” to more accurately describe immune system-tumor interactions (Dunn et al.
2004). Three phases can be distinguished, termed the “three E´s of cancer immunoediting:”
Elimination, Equilibrium, and Escape.
In the elimination phase, developing malignant cells are eradicated by innate and adaptive immune
responses, i.e. through NK and T-cell activity, respectively. Tumor cells surviving the elimination
phase enter the equilibrium phase, in which the immune system holds the tumor in a state of
functional dormancy. Here, tumor cell variants that resist immune recognition evolve. Also, tumor
cells induce immunosuppression by expression of programmed death ligand 1 (PD-L1). The
tumor cytokine milieu in the equilibrium phase is a balance between tumor-promoting cytokines
(IL-10, IL-23) and anti-tumor cytokines (IL-12, IFNg) (Mittal et al. 2014).
In the escape phase, tumor cell variants that were selected in the previous phase can now grow
and expand to a clinically detectable disease. Tumor escape consists of direct cellular interactions
and indirect factors that disrupt the development of an antitumor immune response that could
restrict tumor outgrowth. Tumor cells evade immune recognition by downregulating MHC Class
I expression, but express survival-promoting molecules such as the anti-apoptotic bcl2 or
resistance-increasing molecules like STAT3. Escape phase tumor cells also express molecules
that mediate immunosuppression, e.g. PD-L1, indoleamine 2,3-dioxygenase 1 (IDO), tryptophan
2,3-dioxygenase (TDO), and secrete angiogenesis-enhancing cytokines VEGF, IL-6, and TGFb.
In addition, immunosuppressive cells such as M2 macrophages, myeloid-derived suppressor cells
(MDSC) and regulatory T-cells (Treg) can express immunoregulatory molecules (arginase, iNOS,
IDO) and immunosuppressive cytokines (IL-10, TGFb) (Mittal et al. 2014).
1.5.2 Recombinant cytokines in cancer treatment
Immunostimulatory cytokines have been used in cancer therapy based on their potent capacity to
induce proliferation, differentiation and activation of immune cell subsets (Vacchelli et al. 2013).
26
To date, a handful of recombinant cytokines have been FDA-approved for the treatment of various
cancers: IL-2, IFN-a2a, IFN-a2b, G-CSF, GMCSF and TNFa (Vacchelli et al. 2015). High-dose
bolus IL-2 was approved for treatment of patients with renal cell carcinoma already in 1992,
becoming the first immunotherapeutic cancer drug (Rosenberg 2014).
Recombinant GMCSF has been evaluated for the treatment of renal cell carcinoma in multiple
trials, but with modest results (Arellano & Lonial 2008). For melanoma, GMCSF has been
administered together with IL-2, IFNa and chemotherapy with promising results, although
systemic toxicity was also evident (Vaughan et al. 2000). In recent trials, GMCSF has been used
in combination with radiotherapy (Golden et al. 2015) or with the cytotoxic T-lymphocyteassociated protein 4 (CTLA4)-blocking monoclonal antibody ipilimumab (Luke et al. 2015). A
27% response rate was observed in the former, whereas in the ipilimumab trial the response rate
was 21%.
TNFa is a powerful cytokine capable of inducing hemorrhagic necrosis (Carswell et al. 1975) and
vasculature destruction in tumors (Watanabe et al. 1988). However, due to its toxicity profile, it
is only used in isolated limb perfusion for treatment of soft-tissue sarcoma and melanoma
metastases (Eggermont et al. 2003). In this role, TNFa is effective and safe as it can salvage limbs
that would have otherwise undergone amputation in both of the aforementioned indications
(Deroose et al. 2011, Deroose et al. 2012).
Recombinant IFNg was studied in metastatic renal cell carcinoma patients who were administered
IFNg-1b (n=91) or placebo (n=90) (Gleave et al. 1998). In this trial, no differences in efficacy
were seen between the two treatment arms. Later, IFNg-1b was combined with
carboplatin/paclitaxel chemotherapy for the treatment of advanced ovarian cancer patients in a
phase III trial, but showed no improvement over chemotherapy alone (Alberts et al. 2008).
As mentioned earlier, recombinant IL-2 was FDA-approved in the early 1990s for kidney cancer
after clinical trials provided promising data (Lotze et al. 1986, Rosenberg et al. 1987). A clinical
study performed in 270 patients with metastatic melanoma resulted in a 16% overall objective
response rate, which prompted the approval of IL-2 for melanoma treatment in 1998 (Atkins et
al. 1999). In the early trials, unexpected toxicities caused treatment-related deaths. This systemic
IL-2 –related toxicity is caused by vascular leak syndrome (VLS), that is characterized by
extravasation of fluids (via permeabilization of endothelial cells) into visceral organs that can
result in organ failure (Baluna & Vitetta 1997).
27
In summary, cancer therapy with systemically administered recombinant cytokines can achieve
some degree of antitumor activity that is, however, associated with severe toxicity.
1.5.3 Immune checkpoint blockade
Tumors express inhibitory molecules like PD-L1, which upon binding to its receptor programmed
death 1 (PD1) on T-cells induces an inhibitory signal that results in reduced cytokine production,
proliferation and cytotoxic activity (Freeman et al. 2000). In preclinical animal models blocking
of the PD1/PD-L1 axis promotes antitumor activity (Curiel et al. 2003, Nomi et al. 2007). In
humans, treatment with the checkpoint inhibiting anti-PD1 antibody, nivolumab, resulted in
objective responses in patients with non-small-cell lung cancer (14 of 76 patients), melanoma (26
of 94 patients), and renal cell cancer (9 of 33 patients) (Topalian et al. 2012). Another PD1
inhibitor, pembrolizumab, has been used to treat advanced melanoma patients (Ribas et al. 2016),
and Merkel-cell carcinoma patients (Nghiem et al. 2016). The overall objective response rate
(ORR) in the melanoma trial was 33%. A 56% ORR was observed in the trial with Merkel-cell
carcinoma patients. Pembrolizumab treatment in triple-negative breast cancer (TNBC) patients
reached an ORR of 18.5%, with the median time to response being 17.9 weeks (Nanda et al. 2016),
exemplifying the characteristic delayed response time of immunotherapies which warrants
development of novel endpoint criteria (Hoos 2012).
In addition to PD1/PD-L1, the cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) has been
targeted by an inhibiting antibody, ipilimumab, with success in clinical trials (Weber et al. 2008,
Robert et al. 2011). Altogether four checkpoint-inhibiting antibodies have been approved by the
FDA: nivolumab, pembrolizumab, ipilimumab and atezolizumab (anti-PD-L1) (Pitt et al. 2016).
Other immune checkpoint molecules being studied as targets for therapeutic intervention include
lymphocyte-activated gene 3 (LAG-3), T cell immunoglobulin and mucin domain-containing
molecule 3 (TIM-3), and B and T lymphocyte attenuator (BTLA) (Vilgelm et al. 2016).
1.5.4 Adoptive cell therapies
Pioneered by Dr. Steven Rosenberg at the Surgery Branch of the National Cancer Institute,
adoptive cell therapy (ACT) aims to generate large numbers of tumor-reactive T-cells ex vivo that
are subsequently administered back to patients with concurrent IL-2 infusions (Verdegaal 2016).
Here, the three main approaches are summarized: unmodified tumor-infiltrating lymphocytes
28
(TIL), and the genetically engineered T-cell receptor-modified (TCR) and chimeric antigen
receptor-modified (CAR) T-cells.
1.5.4.1 Tumor-infiltrating lymphocytes
Autologous lymphokine-activated killer (LAK) cells and systemic IL-2 infusions were used to
treat metastatic cancer patients already in the mid-1980s (Rosenberg et al. 1985). Shortly after,
tumors harboring tumor-specific lymphocyte populations were cultured and used therapeutically
in a mouse model for colon adenocarcinoma (Rosenberg et al. 1986). In this study, the TIL were
administered together with preconditioning lymphodepletion (cyclophosphamide) and systemic
IL-2 infusions. Efficacy was impressive (50 to 100 times more effective than LAK) and provided
the rationale to treat humans with adoptive transfer of TIL.
Methods for obtaining sufficient amounts of TIL from tumor fragments have developed during
the past three decades. In early methods, large metastatic lesions (around 3 cm) were resected and
fragmented into microcultures in the presence of IL-2 for initial TIL outgrowth (Lee & Margolin
2012). These TIL were then co-cultured with autologous tumor cells for assessment of IFNg
release, indicating tumor-specific recognition by the TIL. Further propagation of the selected TIL
populations was achieved by culturing them with high-dose IL-2, soluble anti-CD3 monoclonal
antibody and irradiated feeder cells. This process of generating enough TIL for patient infusion
took 5-6 weeks from biopsy.
Several clinical trials have been performed with “selected TIL” in metastatic melanoma. ORRs
have varied from 34% (Rosenberg et al. 1994) to 72% (Rosenberg et al. 2011), when
lymphodepletion and total body irradiation (TBI) have been included in the regimen. However,
the long ex vivo culture time presents a problem for the patient suffering from metastatic disease:
rapid disease progression may prevent the patient from benefiting from TIL infusion. Also, it has
been observed that those TIL that have spent a longer period of time in culture have shorter
telomeres than younger TIL, thus limiting their proliferative capacity after adoptive transfer
(Donia et al. 2011). These observations prompted the development of culture protocols that yield
“young” TIL (Dudley et al. 2010) (Figure 3). The young TIL protocol omits the selection step
and therefore shortens the culture time by several weeks, which increases the number of patients
that can be included in the trial. The development of cell culture devices that specifically support
optimal lymphocyte growth has improved T-cell production further (Vera et al. 2010, Jin et al.
2012, Bajgain et al. 2014).
29
Clinical trials using young TIL have been performed in and outside the United States. The first
one (at the Surgery Branch) enrolled 122 patients with metastatic melanoma, and eventually 56
were treated (Dudley et al. 2010). The dropout rate was therefore 50%, still considerably less than
with selected TIL. The ORR for treated patients was 54%. In this trial, the young TIL were
enriched for CD8+ T-cells with the intention of avoiding Treg infusion. Later, the same group
performed a trial comparing CD8+ enriched TIL and unselected “bulk” TIL (Dudley et al. 2013).
101 patients were enrolled and 69 of them received TIL; 35 were treated with CD8+ enriched
cells and 34 with unselected TIL. Interestingly, the ORR between the two arms (20% and 35%,
respectively) was not significantly different, suggesting that TIL products containing CD4+ cells
may play an important role in adoptive immunotherapy.
At the MD Anderson Cancer Center, young TIL were administered to 31 patients with an ORR
of 42% (Radvanyi et al. 2012). In Israel (Ella Institute), 32 patients were treated and the ORR was
47% (Itzhaki et al. 2011). A similar study was performed later at the same site, with 80 enrolled
patients of whom 57 were eventually treated with young TIL (Besser et al. 2013). The ORR for
the treated patients was 40%. More recently, at the Herlev Hospital in Denmark, an ORR of 42%
was achieved in 25 patients with melanoma (Andersen et al. 2016).
The majority of TIL trials have been performed in patients with metastatic melanoma. However,
the presence of TIL has been observed in almost all solid tumor types (Fridman et al. 2012).
Several studies have demonstrated the feasibility of culturing tumor-reactive TIL from head and
neck cancer (Junker et al. 2011), renal cell carcinoma (Markel et al. 2009, Baldan et al. 2015) and
gastrointestinal cancer (Turcotte et al. 2013). In a recent clinical study, nine patients with
metastatic cervical cancer were treated with human papillomavirus (HPV) –selected TIL, and
three patients experienced objective responses (Stevanovic et al. 2015). Also, TIL therapy for
ovarian cancer has shown promising results (Fujita et al. 1995).
The rationale behind preconditioning lymphodepletion before TIL infusion is to “clear” the host
of factors that might impede the function of the transferred cells (Hershkovitz et al. 2010). This
chemotherapy regimen typically consists of cyclophosphamide and fludarabine administered
intravenously, sometimes combined with TBI. Endogenous suppressive cell compartments are
targeted with preconditioning to relieve immunosuppression. Also, the removal of “cellular sinks”
that deplete vital cytokines such as IL-7 and IL-15 has been shown to improve the efficacy of
adoptively transferred T-cells (Gattinoni et al. 2005). In accord with this preclinical observation,
patients treated with lymphodepletion prior to TIL infusion had elevated serum levels of these
30
cytokines (Dudley et al. 2008). In addition to preconditioning, TIL patients receive
postconditioning IL-2 immediately after TIL infusion to support the transferred cells (Rosenberg
2014). The systemic IL-2 administration is associated with severe but usually transient toxicity
that requires specialized care (Schwartz et al. 2002). The importance of postconditioning IL-2 has
been questioned, however, as it might in fact expand endogenous Tregs for a negative effect on
efficacy (Yao et al. 2012).
Figure 3. Adoptive cell therapy with “young” TIL. After tumor biopsy (1), the processed tumor
material is cultured in IL-2 to enable initial TIL outgrowth (2). Further expansion is achieved by
culturing the TIL in the presence of IL-2, anti-CD3 antibody and irradiated feeder cells (3).
Following rapid expansion, the cells are administered back to the patient with concomitant IL-2
infusions (4).
1.5.4.2 T-cell receptor-engineered T-cells
Tumor-infiltrating lymphocytes are not always available for expansion and sometimes the
expansion phase itself can fail to produce enough TIL for infusion. By contrast, peripheral blood
–derived T-cells are easy to obtain and can be transduced with retroviruses coding for TAAspecific T-cell receptors (TCR) (Bonini & Mondino 2015). TCRs are antigen receptors that
recognize their target only when the antigen (i.e. processed peptide fragment) is bound to MHC
Class I or II molecules. Adoptive cell therapy applications have so far been restricted to MHC
31
Class I –bound targets. The advantage of TCR-engineered cells, in addition to availability, is their
ability to recognize tumor antigens derived from the entire protein composition of tumor cells,
unlike CAR T-cells that require a surface antigen for recognition. On the other hand, the reliance
on coreceptors (i.e. CD8) for TCR binding to MHC/peptide -complexes limits the effectiveness
of target cell killing. Also, the expression of MHC Class I molecules is often downregulated on
tumor cells, which may reduce the efficacy of TCR-engineered T-cells (Hicklin et al. 1999).
The first TCR-engineered T-cells were generated in the mid-1980s for mouse studies (Dembic et
al. 1986). Initial clinical studies in humans targeted melanoma antigen recognized by T cells 1
(MART-1) (Duval et al. 2006). In this phase I dose-escalation trial, 15 patients received MART1 T-cells with a good safety profile and indications of tumor regressions. Later, 36 patients were
treated with the MART-1 TCRs (and gp100 TCRs) in a larger trial (Johnson et al. 2009). Objective
responses were seen in 30% of patients, but adverse events were also evident as “on-target, offtumor” effects; normal melanocytes of the inner ear and eye were attacked by the T-cells.
More recently, cancer–testis antigen (CTA) family members have been targeted with TCRengineered T-cells in clinical trials: NY-ESO-1 (Robbins et al. 2011) and melanoma-associated
antigen (MAGE) (Morgan et al. 2013). In the former, both metastatic melanoma and metastatic
synovial cell sarcoma patients were treated, and clinical responses were observed in four (out of
six) sarcoma patients and five (out of 11) melanoma patients without serious adverse events. In
the latter trial, five out of nine patients experienced tumor regressions, but 2 patients died of
neurological toxicity. This was due to the fact that MAGE-A3 –targeted TCRs also targeted
MAGE-A12 expressed in the brain, which was not known at the time. In another MAGE-A3 TCR
trial, the first two patients died of cardiotoxicity that was attributed to the “off-target, off-tumor”
phenomenon as the TCRs exhibited cross-reactivity to a striated muscle protein, titin (Linette et
al. 2013).
TCR-engineered T-cells are a valuable tool in preclinical research. Several TCR-transgenic mouse
strains are available from commercial breeders, and some are extensively used in cancer
immunotherapy studies (Uckert & Schumacher 2009). Especially useful are artificial antigentargeting TCRs, such as the OT-I (Hogquist et al. 1994) and OT-II (Barnden et al. 1998) strains
that target chicken ovalbumin. Tumor cell lines transduced to stably express ovalbumin, such as
the murine B16.OVA melanoma, can be utilized in preclinical evaluation of novel
immunotherapeutic approaches (Capasso et al. 2015, Tähtinen et al. 2015a, Tähtinen et al. 2015b).
32
1.5.4.3 Chimeric antigen receptor T-cells
Chimeric antigen receptor T-cells (CAR-T) are genetically modified T-cells that recognize their
target tumor antigens in an MHC-unrestricted manner (Ruella & June 2016). The chimeric
receptor typically consists of a single-chain variable fragment (scFv) of a monoclonal antibody
linked by a hinge and transmembrane domain to intracellular signaling/activation domains, i.e.
immunoreceptor tyrosine-based activation motifs (ITAM) (Figure 4). Early constructs contained
a single ITAM (Gross et al. 1989), while subsequent generations incorporated three ITAMs in the
form of the TCR/CD3 zeta chain (CD3ζ) (Letourneur & Klausner 1991). The so-called second
generation of CAR-T introduced an intracellular costimulatory domain, the cytoplasmic part of
the CD28 receptor, in addition to the CD3ζ (Hombach et al. 2001). This additional domain
improved T-cell activation upon binding to antigen (Maher et al. 2002). The third CAR-T
generation has two costimulatory domains (e.g. 4-1BB or OX40 together with CD28) and the
CD3ζ, providing even more potent responses (Milone et al. 2009, Hombach & Abken 2011).
CAR-T targeting the pan-B-cell antigen CD19 have shown the most promising results in clinical
trials: two children with B cell acute lymphoblastic leukemia (B-ALL) treated with anti-CD19
CAR-T experienced complete remissions (Grupp et al. 2013), and in another trial all five B-ALL
patients treated demonstrated rapid tumor eradication (Brentjens et al. 2013). More recently, a
phase I trial performed in B-ALL patients resulted in a 70% complete response rate with
manageable toxicities (Lee et al. 2015). Besides CD19, a variety of targets have been studied
preclinically in the context of CAR-T therapy including MUC16 for ovarian cancer (Chekmasova
et al. 2010), MUC1 for breast cancer (Wilkie et al. 2008), and EGFRvIII for glioblastoma (Miao
et al. 2014).
The remarkable clinical efficacy of CAR-T against hematological malignancies has not, however,
been observed in solid tumors (Beatty & O'Hara 2016). Three main factors have been proposed
to contribute to this phenomenon: 1) poor expansion and persistence of T-cells (Kershaw et al.
2006), 2) insufficient T-cell trafficking (Kershaw et al. 2006), and 3) immunosuppressive tumor
microenvironment (Moon et al. 2014).
33
Figure 4. Evolution of CAR-T constructs. In early constructs (1st generation), the mAb-derived
scFv was linked to a transmembrane domain and a CD3ζ activation domain. 2nd and 3rd generation
constructs include additional intracellular co-stimulatory domains (CD28, 4-1BB, OX-40) for
enhanced T-cell activation.
34
2. AIMS OF THE STUDY
1. To evaluate the antitumor efficacy and biological mechanisms of oncolytic
adenovirotherapy combined with chemotherapy or adoptive cell therapy in preclinical
rodent models for cancer (I-IV).
2. To establish an immunocompetent and adenovirus-permissive Syrian hamster model for
the study of adoptive TIL therapy combined with oncolytic adenovirus (II).
3. To generate and characterize adenoviruses carrying the immunostimulatory cytokines
IL-2 and TNFa for the enhancement of adoptive cell therapy (III-IV).
35
3. MATERIALS AND METHODS
3.1 Viruses
Murine cytokine-coding non-replicating adenovirus vectors were constructed by insertion of
expression cassettes with cytokine genes into the multiple cloning site of the shuttle plasmid
pDC315 (AdMax, Microbix Biosystems, Mississauga, Canada), which was then recombined with
pBHGloxdelE13cre (AdMax) that contains the whole adenovirus genome. For the generation of
the final virus constructs, rescue plasmids from the previous step were transfected to 293 cells.
Viruses were propagated on 293 cells and purified with cesium chloride gradient centrifugation
(Kanerva et al. 2002). The capsid-chimeric oncolytic adenoviruses used in Study IV were
constructed by placing cytokine-transgenes into the E3 region of the adenovirus genome utilizing
an adapted BAC-recombineering method (Warming et al. 2005, Ruzsics et al. 2006, Muck-Hausl
et al. 2015). The resultant viruses were purified with cesium chloride gradient centrifugation,
followed by VP-titering with OD260 reading, and Tissue Culture Infectious Dose (TCID50) assay
to determine the number of infectious virus particles. The presence of exosome particles was not
evaluated. All viruses used in the studies are listed in Table 1.
Table 1. List of viruses used in the studies.
Virus
Ad5/3-D24-GMCSF (aka CGTG-102)
Replicating
Yes
Ad5-D24
Yes
Ad5Luc1
No
Ad5-CMV-mTNFa
Ad5-CMV-mIL2
Ad5-CMV-mIFNg
Ad5-CMV-mIFNb
Ad5/3-E2F-D24
Ad5/3-E2F-D24-hTNFa
Ad5/3-E2F-D24-hIL2
Ad5/3-E2F-D24-hTNFa-IRES-hIL2
Vesicular stomatitis virus (VSV) strain
M51
No
No
No
No
Yes
Yes
Yes
Yes
Yes
36
Transgene
GMCSF
mTNFa
mIL2
mIFNg
mIFNb
hTNFa
hIL2
hTNFa + hIL2
Reference
Koski et
al. 2010
Kanerva
et al. 2003
Kanerva
et al. 2002
III
III
III
III
IV
IV
IV
IV
Diallo et
al. 2012
3.2 Cell lines
All cell lines used in the studies were cultured in recommended conditions and are summarized
in Table 2.
Table 2. List of cell lines used in the studies.
Cell line
DDT1-MF2
HT-1080
SK-LMS-1
RD
SW872
SW982
B16.OVA
HapT1
HMAM5
PC1
HaK
RPMI 1846
A549
293
L-929
CTLL-2
Species
hamster
human
human
human
human
human
mouse
hamster
hamster
hamster
hamster
hamster
human
human
mouse
mouse
B16-Blue IFN-α/β mouse
Panc1
SK-MEL-28
OVCAR-3
SKOV3-Luc
human
human
human
human
Description
leiomyosarcoma
fibrosarcoma
leiomyosarcoma
rhabdomyosarcoma
liposarcoma
synovial sarcoma
Source
Used in
Prof. Wold
1
ATCC
I
ATCC
2
I
ATCC
2
I
ATCC
2
I
ATCC
2
I
3
melanoma
Prof. Vile
pancreatic cancer
breast cancer
pancreatic cancer
kidney cancer
I, II, IV
2
I, II, III
4
DSMZ
II, IV
5
II
Prof. Wold
1
II
Prof. Wold
1
II
Dr. Mathis
ATCC
2
II
lung adenocarcinoma ATCC
2
II, IV
embryonic kidney
ATCC
2
III
ATCC
2
III, IV
ATCC
2
melanoma
fibroblast
T lymphocyte
reporter melanoma
pancreatic cancer
melanoma
ovarian carcinoma
ovarian carcinoma
InvivoGen
III, IV
6
ATCC
IV
ATCC
2
IV
ATCC
2
Dr. Negrin
IV
7
1
Prof. William S.M. Wold (St. Louis University, School of Medicine, USA)
2
American Type Culture Collection (Manassas, USA)
3
Prof. Richard Vile (Mayo Clinic, USA)
4
DSMZ (Braunschweig, Germany)
5
Dr. Michael J. Mathis (Louisiana State University, USA)
6
InvivoGen (San Diego, USA)
7
Dr. Robert Negrin (Stanford Medical School, USA)
37
III
2
IV
3.3 In vitro studies
3.3.1 Chemotherapeutic agents (I)
Ifosfamide (Holoxan®, Baxter Inc., Deerfield, USA) and 4-hydroperoxyifosfamide powder
(Niomech GmbH, Bielefeld, Germany) were first reconstituted in sterile H2O, and subsequently
diluted in growth media (for cell culture experiments) or sterile H2O if used in animal experiments.
Doxorubicin (Medac GmbH, Wedel, Germany) was diluted in 0.9% sodium chloride (NaCl)
solution for animal use, or in growth media if used in cell culture.
3.3.2 Cell viability and co-culture experiments (I-IV)
To determine cell viability after exposure to viruses, cells were seeded on 96-well plates at 1 x
104 cells/well. Following overnight incubation, the cells were infected with varying viral
particle/cell ratios (1-10 000). Viruses were diluted in growth medium (GM) containing 5% fetal
bovine serum (FBS). After incubation at 37°C/5% CO2 for the indicated times, cell viability was
measured
using
the
[3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-
sulfophenyl)-2H-tetrazolium] (MTS) assay (Promega, Madison, USA).
In co-culture experiments with adenovirus and chemotherapeutics, target cells were seeded and
cultured overnight as described above, and infected with virus (1000 VP/cell) and 4hydroperoxyifosfamide (3000 ng/ml) and/or doxorubicin (100 ng/ml) simultaneously. 14 days
after incubation, cell viability was determined by MTS.
In order to evaluate the cell killing capacity of hamster TIL, effector-to-target assays (E/T) were
performed with autologous tumor cells, other hamster tumor cells or human A549 cells by seeding
96-well plates with target cells at 1 x 104 cells/well, followed by the addition of TIL (as effectors)
at different E/T ratios. After 24 hours of incubation, target cell viability was determined by MTS.
For the assessment of cell killing synergy between Ad5-D24 and HapT1 TIL, target cells seeded
the day before were first infected with 100 VP/cell of Ad5-D24 and culture for 3 days before
adding HapT1 TIL at a 2:1 E/T ratio. 24 hours after co-culture the viability of target cells was
determined by MTS. In Study IV, synergy between viruses and TIL was examined by infecting
HapT1 cells with viruses (5000 VP/cell) for 72 hours before adding 2.5 x 104 TIL. Cell viability
was determined 24 hours later by MTS.
38
3.3.3 Quantitative PCR from tumor cell lines (I)
Total DNA was extracted (with QIAamp DNA Mini Kit, Qiagen, Valencia, USA) from DDT1MF2 cell culture monolayers to perform qPCR after exposure to adenovirus, with or without
chemotherapy. The target was the adenoviral E4 gene while hamster GAPDH served as the
housekeeping gene, as described previously (Koski et al. 2010). In studies with human STS cell
lines, monolayers were harvested identically and analyzed for E4 while human beta-actin served
as the housekeeping gene. All primer and probe sequences are summarized in Table 3.
Table 3. Primers and probes used in quantitative PCR.
Target
Type
Sequence 5´ to 3´
Adenovirus
E4
Forward primer
GGAGTGCGCCGAGACAAC
Reverse primer
ACTACGTCCGGCGTTCCAT
Probe
TGGCATGACACTACGACCAACACGATCT
Forward primer
CACCGAGGACCAGGTTGTCT
Reverse primer
CATACCAGGAGATGAGCTTTACGA
Probe
CAAGAGTGACTCCCACTCTTCCACCTTTGA
Forward primer
TCACCCACACTGTGCCCATCT
Reverse primer
GTGAGGATCTTCATGAGGTAGTCAGTC
Probe
ATGCCCTCCCCCATGCCATCCTGCGT
Hamster
GAPDH
Human betaactin
3.3.4 Immunogenic cancer cell death (I)
The capability of oncolytic adenovirus to induce immunogenic cell death of cancer cells in
combination with chemotherapy was studied in vitro by infecting hamster cells (DDT1-MF2) with
Ad5/3-D24-GMCSF (1000 VP/cell) and doxorubicin (5 ng/ml) plus 4-hydroperoxyifosfamide
(150 ng/ml). Calreticulin exposure was assessed 12 hours later by staining the cells first with anticalreticulin antibody (ab2907, Abcam, Cambridge, UK), followed by Alexa-Fluor® 488 conjugated secondary antibody staining (A21202, Invitrogen, San Diego, USA). BD Accuri C6
flow cytometer (BD Biosciences, San Jose, USA) was used for analysis of stained cells. The cell
culture supernatants were analyzed for HMGB1 and ATP secretion using HMGB1 ELISA kit
39
(ST51011, IBL International, Hamburg, Germany) and ATP Determination kit (A22066,
Molecular Probes, Invitrogen) 24 and 48 hours after treatment, respectively. Induction of ICD in
human STS cells was studied similarly, with the exception of using a virus concentration of 100
VP/cell and only doxorubicin as chemotherapeutic.
3.3.5 Blocking experiments (II)
To evaluate the role of MHC-restriction in target cell killing of hamster TIL, tumor cells plated
on 96-well plates were pre-incubated for 2 hours with cross-reactive anti-MHC-I monoclonal
antibody (50 μg/ml) (clone 2G5, Novus Biologicals, Littleton, USA) or isotype control (mouse
IgG2b, Novus Biologicals) before TIL effector cells were added. Cell viability was determined
24 hours later by MTS. To confirm that the anti-MHC-I mAb indeed has blocking capability,
B16.OVA cells were pre-incubated with the mAb (or isotype control mAb) before OVA-specific
CD8-enriched OT-I T-cells were added, and target cell viability was determined as previously.
3.3.6 Cytokine expression (III, IV)
293 cells were used to evaluate cytokine production from non-replicating adenovirus vectors
coding for murine cytokines. Supernatants from virus-infected cell cultures (100 VP/cell) were
collected after 48 hours of incubation and analyzed with ELISA kits for mIFNb (PBL
InterferonSource, Piscataway, USA), mIFNg (Abcam), mIL-2 and mTNFa (IBL International).
In vitro cytokine expression from oncolytic viruses coding for human IL-2 and human TNFa were
studied in HapT1, DDT1-MF2, SKOV3-Luc and A549 cell culture supernatants after a 72 hour
infection period. Detection was performed with CBA Flex Sets (558270 and 558273, BD
Biosciences) together with BD Cytometric Bead Array Human Soluble Protein Master Buffer Kit,
and analyzed with BD Accuri C6.
3.3.7 Cytokine functionality (III, IV)
To confirm the biological functionality of the virus-encoded murine cytokines, standard bioassays
were performed on supernatants collected from virus-infected 293 cells. Before assaying, the
supernatants were filtered through 0.02 μm inorganic membrane filters (Whatman, Maidstone,
UK) to prevent virus carryover. In all functionality assays, recombinant cytokines from a
commercial vendor were used as positive controls (R&D Systems, Minneapolis, USA), and
Ad5luc1 served as the negative control for the cytokine-coding viruses (Kanerva et al. 2002).
40
For the assessment of virus-derived mIL-2 bioactivity, the IL-2-dependent non-adherent CTLL-2
cell line was used. Filtered supernatant was added on CTLL-2 cells on 96-well plates (2.5 x 104
cells/well) and incubated for 48 hours before determining cell viability by MTS. The functionality
of mTNFa was confirmed by co-culturing filtered supernatant with TNFa-sensitive mouse L-929
fibroblast cells (1 x 104 cells/well, 96-well plate). After 24 hours of incubation, cell viability was
determined by MTS. The bioassay for mIFNg is a “protection assay”, i.e. if bioactive mIFNg is
present, L-929 cells are protected from vesicular stomatitis virus (VSV) infection. To this end,
L-929 cells were pre-incubated with filtered supernatant for 6 hours before exposure to 1 x 104
VP/well of VSV strain M51 (kindly provided by Dr. Markus Vähä-Koskela, University of
Helsinki). Cell viability was determined 96 hours post-infection. For mIFNb bioactivity,
commercial B16-Blue IFN-α/β murine type I IFNs sensor cells (InvivoGen, San Diego, USA)
were used according to manufacturer´s instructions. Human cytokines hIL-2 and hTNFa (from
viruses constructed in Study IV) were confirmed to be bioactive with CTLL-2 and L-929 cells,
respectively.
3.4 In vivo studies
3.4.1 Syrian hamster sarcoma model (I)
For evaluation of antitumor efficacy of the adenovirus/chemotherapy combination, Syrian
(Golden) hamsters obtained from Harlan Laboratories (Indianapolis, USA) were implanted with
DDT1-MF2 leiomyosarcoma cells subcutaneously into both flanks of each animal (5 x 106
cells/flank). In the first experiment (with doxorubicin and ifosfamide) male hamsters were
anesthetized for all experimental procedures with a mixture of Ketalar® (ketamine) 80 mg/kg +
Rompun vet® (xylazine) 5 mg/kg administered intraperitoneally. After reaching 5 mm in
diameter, intratumoral virus injections (2.25 x 108 VP/tumor) and intraperitoneal chemotherapy
injections (doxorubicin 1 mg/kg, ifosfamide 30 mg/kg) were started and repeated every 3 days
after that. Animals in the control group received PBS vehicle only. Digital calipers were used to
measure tumor growth throughout the experiment. In the second experiment where only
doxorubicin was given together with adenovirus, all animals were anesthetized with isoflurane
before procedures. Virus (2.25 x 108 VP/tumor) and doxorubicin (1.25 mg/kg) were administered
every other day.
41
3.4.2 Oncolytic adenovirus and chemotherapy in the B16.OVA model (I)
To gain deeper understanding of the biological mechanisms behind therapeutic synergy, the
B16.OVA murine melanoma model was employed. Female C57BL/6 mice (Harlan Laboratories)
were implanted subcutaneously with 2.5 x 106 B16.OVA cells into both flanks. 5 mm diameter
tumors were injected intratumorally with 4.5 x 109 VP/tumor every 3 days, and chemotherapy
(doxorubicin 1 mg/kg, ifosfamide 30 mg/kg) was administered intraperitoneally every 3 days.
Endpoint tumors and spleens were collected for flow cytometric analyses.
3.4.3 Quantitative PCR from tumors (I)
To perform qPCR from DDT1-MF2 tumors, tumor fragments were excised from euthanized
hamsters and snap-frozen at -80°C for storage. Total DNA was extracted by first digesting tumor
samples overnight with proteinase K in tissue lysis buffer ATL (Qiagen), followed by QIAamp
DNA Mini Kit (Qiagen) extraction protocol. Quantification of adenoviral E4 (normalized to
hamster GAPDH) was performed with primers and probes described in Table 3.
3.4.4 Human soft-tissue sarcoma xenograft model (I)
For the assessment of antitumor efficacy against STS tumors of human origin, female NMRI nude
mice (from Harlan Laboratories) were implanted with 5 x 106 HT-1080 fibrosarcoma cells into
both flanks under isoflurane anesthesia. After reaching 5 mm in diameter, the tumors were injected
with 1 x 108 VP/tumor of virus on days 1, 4, 8 and 15. Chemotherapy, i.e. doxorubicin, was given
intraperitoneally on days 1, 8 and 15 with a dose of 2 mg/kg. Control animals received vehicle
only. Tumor sizes were measured with digital calipers every 3 days.
3.4.5 Histopathology (I, IV)
For histopathological analysis tumors, spleen, liver, heart, lung and kidneys were collected from
hamsters and fixed in 10% formalin for 48-72 hours before transfer into 70% ethanol for storage.
4 μm sections were cut from paraffin-wax embedded organ samples and stained with hematoxylin
and eosin. Histological changes were evaluated by independent veterinary pathologists, and
tumors that lacked neoplastic cells were considered cured.
42
3.4.6 TIL culture (II, IV)
For initiation of TIL culture, Syrian hamsters were first implanted with tumors subcutaneously
and allowed to develop until 1 cm in diameter. In Study II, the excised tumors were processed
into small fragments (1-3 mm3) and cultured on 24-well plates (1 fragment/well). The RPMI-1640
–based culture medium contained 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, 1%
L-glutamine, 15 mM HEPES, 50 μM 2-mercaptoethanol, 1 mM Na-pyruvate and 6000 IU/ml
human IL-2 (hIL-2) (PeproTech, Rocky Hill, USA). After 5 days of initial culture, 50% of the
medium was removed and replaced with fresh medium. Medium renewal was repeated every 2
days after Day 5. On Day 10, the TIL culture wells that contained visible lymphocyte growth were
pooled for further experiments in vivo or in vitro.
In Study IV, tumors for initiation of TIL culture were implanted and processed similarly, but the
tumor fragments were cultured in gas-permeable G-Rex10 flasks (80040S, Wilson Wolf, New
Brighton, USA) in the presence of 3000 IU/ml hIL-2 (PeproTech). On Day 5, 50% of the medium
was replaced with fresh medium containing 1 μg/ml Concanavalin A (C0412, Sigma-Aldrich, St.
Louis, USA). Medium renewal was repeated every 2 days until Day 10 when TIL were collected
and used in animal experiments or cell killing assays.
3.4.7 Adoptive TIL transfer and virus treatments (II, IV)
In Study II, established HapT1 tumors were treated with Ad5-D24 (1 x 107 VP/tumor) and on the
following day HapT1 TIL were injected intratumorally (1.5 x 106 TIL/tumor). Virus treatment
was repeated on Day 8. In Study IV, the hamsters were given virus injections on Days 1, 4, 8, 13
and 19 (1 x 109 VP/tumor). HapT1 TIL were administered on Day 2 intratumorally (4 x 105
TIL/tumor). In the repeat experiment, only the virus dose was altered (1 x 108 VP/tumor on Days
1 and 8). Animals cured of tumors in the first experiment were rested for 2 weeks before being
subjected to tumor rechallenge with the same tumor (HapT1) or another tumor type (DDT1-MF2).
3.4.8 Transgene expression (III, IV)
Expression of transgenes in vivo was evaluated in the B16.OVA model in Study III. C57BL/6
mice (Harlan Laboratories) were implanted with B16.OVA tumors and injected with 1 x 109 VP
of cytokine-coding adenoviruses. Tumors and serum were collected 72 hours later by snapfreezing at -80°C. After homogenization of the tumors, murine cytokine concentrations were
measured with CBA Flex Sets (BD) and normalized to total protein content.
43
In Study IV, Syrian hamsters bearing HapT1 tumors were utilized to determine in vivo human
cytokine expression from the newly constructed oncolytic adenoviruses. To this end, 1 x 108 VP
were injected into HapT1 tumors, and 48 hours later the tumors were collected along with serum.
CBA Flex Sets for human IL-2 and TNFa were used to quantify cytokine levels in tumors and
serum after normalization to total protein content.
3.4.9 Chemokine expression (III)
CBA Flex Sets were used to determine chemokine levels in B16.OVA tumors after treatment with
adenoviruses and OT-I cells. 7 days after injection, snap-frozen tumors were homogenized and
analyzed for RANTES, MCP1, MIP-1a, MIP-1b, MIG and I-TAC normalized to total protein
content.
3.4.10 Adoptive OT-I transfer (III)
Culture and expansion of OT-I T-cells for adoptive transfer was performed by collecting spleens
of OT-I TCR transgenic mice (The Jackson Laboratory, Bar Harbor, USA), and culturing the
splenocytes in mIL-2 (160 ng/ml, R&D Systems) and anti-mouse CD3e antibody (300 ng/ml,
clone 145-2C11, eBioscience, San Diego, USA). After 3 days in culture, CD8-enrichment was
performed with CD8a+ T Cell Isolation Kit II (Miltenyi Biotec, Bergisch Gladbach, Germany). Tcell expansion was continued for another 7 days in the presence of mIL-2 and anti-CD3e.
Adoptive transfer of expanded OT-I CD8+ T-cells was performed by injecting 1.5 x 106 cells (in
a volume of 100 μl) intraperitoneally into B16.OVA tumor-bearing mice.
3.4.11 OT-I radiolabelling and SPECT/CT imaging (III)
To follow the fate of adoptively transferred OT-I T-cells, we labelled 6 x 106 CD8+ enriched cells
with
111
In-oxine and injected them into tumor-bearing and adenovirus-injected mice
intraperitoneally (5.98 ± 0.53 MBq/animal). A preclinical four-headed gamma camera with
integrated CT system (nanoSPECT/CT, Bioscan Inc., USA) was used to image the mice 24, 48
and 96 hours after cell/virus treatment.
3.4.12 Orthotopic SCID mouse model of ovarian cancer (IV)
To investigate the antitumor effects of cytokine-coding oncolytic adenoviruses against human
tumors, immunocompromised female CB-17 SCID mice (Janvier Labs, Saint Berthevin, France)
44
were implanted with 5 x 106 SKOV3-Luc luciferase-coding ovarian cancer cells intraperitoneally.
In a dose-finding pilot experiment the mice received 1 x 105, 1 x 107 or 1 x 109 VP of Ad5/3-E2Fd24-hTNFa-IRES-hIL2 in 300 μl of PBS intraperitoneally. Bioluminescent imaging was
performed by administering D-luciferin (3 mg in 100 μl PBS, bc219, Synchem, Felsberg,
Germany) 8 minute before placing the animals in the IVIS 100 imaging device (Xenogen,
Alameda, USA). In the full-scale experiment, 1 x 109 VP of each virus in 300 μl PBS was given
intraperitoneally to tumor-bearing mice. IVIS imaging was performed once per week.
3.4.13 Splenocyte proliferation (IV)
Splenocytes proliferation ex vivo was assessed by culturing splenocytes for 72 hours before
counting the cells with BD Accuri C6. Samples (i.e. spleens from individual animals) were pooled
within a treatment group before performing the assay.
3.4.14 Flow cytometry (I-IV)
Tissues in all Studies were first processed into single-cell suspensions by passing them through
40-70 μm cell strainers. After overnight culture at 37°C, cell suspensions were frozen and stored
at -80°C or -140°C. For flow cytometric analyses, thawed samples were stained with fluorescently
labelled antibodies (Table 4) for 30 minutes at 4°C before analysis with BD Accuri C6.
Table 4. List of antibodies used in flow cytometric analyses.
Antibody
CD80-PerCP-Cy5.5
CD8a-PE
CD3-APC
CD86-PE
CD11c-FITC
MHC Class II-FITC
CD4-APC
CD8b-PE
CD8b-FITC
CD8a-APC
PD-1-PeCy7
NK1.1-FITC
CD19-PE
Host species
armenian hamster
rat
armenian hamster
rat
armenian hamster
mouse
rat
mouse
rat
rat
armenian hamster
mouse
rat
45
Supplier
BD
BD
BD
BD
BD
eBioscience
eBioscience
eBioscience
eBioscience
eBioscience
eBioscience
eBioscience
eBioscience
Used in
I
I
I, III
I, III
I, III
II, IV
II, IV
II, IV
III
III
III
III
III
CD25-PE
Foxp3-APC
CD69-PeCy7
F4/80-APC
CD3-PeCy7
CD4-PerCP.Cy5.5
CD11b-PerCP-Cy5.5
Gr-1-FITC
rat
rat
armenian hamster
rat
rat
rat
rat
rat
eBioscience
eBioscience
eBioscience
eBioscience
BD
BD
BD
BD
III
III
III
III
III
III
III
III
3.5 Statistical analyses
In all Studies, statistical analyses were performed with SPSS version 21 or 22 (SPSS IBM, New
York, USA) and GraphPad Prism 6 (GraphPad Software Inc., San Diego, USA). When applicable
(i.e. no missing values present), repeated measures ANOVA was performed on log-transformed
tumor volume data. For estimation of statistical differences between groups in other cases, nonparametric Mann-Whitney test, two-tailed Student´t t-test and linear mixed-effects model were
used. P-values of <0.05 were considered significant in all Studies. In Study I, synergy between
adenovirus and chemotherapy was evaluated with an adapted Webb method (Webb 1963), named
FTV (fractional tumor volume). Ratios above 1 indicate synergistic interactions, whereas ratios
below 1 indicate less than additive effects.
3.6 Ethical considerations
All animal protocols were reviewed and approved by the Experimental Animal Committee of the
University
of
Helsinki
and
the
Provincial
Government
of
Southern
Finland
(ESAVI/7759/04.10.07/2013). Animals were humanely euthanized when tumor size exceeded the
maximum acceptable size or when any signs of pain or distress were evident.
46
4. RESULTS AND DISCUSSION
4.1 In vitro studies with doxorubicin/ifosfamide and oncolytic adenovirus Ad5/3-D24GMCSF (I)
The efficacy of oncolytic adenoviruses as single agents to treat advanced cancer has been
unimpressive (Rosewell Shaw & Suzuki 2016). Chemotherapeutic regimens have suffered from
the same problem, as only a portion of patients benefit from treatment and for soft-tissue sarcoma
(STS) specifically the response rates with preferred first-line chemotherapeutics doxorubicin and
ifosfamide are modest (Clark et al. 2005, Reed & Altiok 2011, Quesada & Amato 2012).
Therefore, in Study I we set out to study the combination of these two treatment modalities for
possible synergistic interactions that could yield a translationally relevant combination therapy
approach for STS.
First, the in vitro effects of the oncolytic adenovirus Ad5/3-D24-GMCSF (aka CGTG-102)
together with doxorubicin and 4-hydroperoxyifosfamide (the active metabolite of ifosfamide)
were studied in cytotoxicity and immunogenic cell death (ICD) assays with STS cells. Infection
of DDT1-MF2 Syrian hamster leiomyosarcoma cells with Ad5/3-D24-GMCSF resulted in
significant upregulation of cell-surface calreticulin exposure, that was further enhanced with the
addition of doxorubicin/4-hydroperoxyifosfamide chemotherapy (Figure 1a, Study I). The same
trend was observed for the two other ICD markers, HMGB1 and ATP secretion (Figure 1b-c,
Study I). The immunogenic cell death status of human STS cells exposed to adenovirus and
chemotherapeutics showed less clear results when compared with the hamster DDT1-MF2 cells
(Suppl. Figure S2-S4, Study I), although a similar trend for additivity was observed with HT-1080
fibrosarcoma cells.
We then studied the effect of chemotherapy on adenoviral replication efficiency and observed an
increase when doxorubicin/4-hydroperoxyifosfamide were present in the cell culture (Figure 1d,
Study I). Moreover, hamster STS cell killing was enhanced with the combination of Ad5/3-D24GMCSF and doxorubicin/4-hydroperoxyifosfamide (Figure 1e, Study I). When human STS cell
lines were studied for adenovirus replication kinetics in the presence of doxorubicin, we showed
that in 4 out of 5 cell lines the efficiency of virus replication was improved during the 96 hour
incubation period (Figure 4, Study I).
Several oncolytic viruses have the ability to induce immunogenic cancer cell death (Workenhe &
Mossman 2014). We have shown this with different adenovirus constructs before (Diaconu et al.
47
2012, Liikanen et al. 2013, Hirvinen et al. 2015). Our results from Study I are in line with a recent
report (with the same adenovirus construct Ad5/3-D24-GMCSF) where ICD was induced in
mesothelioma cell lines in combination with chemotherapy (Kuryk et al. 2016). An intriguing line
of investigation involving the induction of ICD in vivo was not pursued in Study I due to feasibility
issues. ICD is relatively easy to assess in vitro in the homogeneous “tumor cells on a plate” setting,
whereas the heterogeneity of established tumors makes it impossible to identify the specific source
of secreted ATP/HMGB1. This highly relevant topic of in vivo ICD should be studied further if
more advanced methods can be developed.
With regard to synergistic interactions between oncolytic viruses and doxorubicin in vitro, our
observations are similar to studies performed with measles virus (Weiland et al. 2014), herpes
simplex virus (Bolyard et al. 2014), coxsackievirus (Skelding et al. 2012), vesicular stomatitis
virus (Schache et al. 2009), and adenovirus (Osaki et al. 2016). The mechanism behind synergy
was attributed to enhanced virus replication in our study which, interestingly, was also observed
in the report with oncolytic measles virus (Weiland et al. 2014). In the latter, induction of tumor
cell senescence by doxorubicin was shown to promote viral replication.
4.2 In vivo antitumor efficacy is enhanced with oncolytic adenovirus and chemotherapy
combinations (I)
Results obtained from in vitro studies with Ad5/3-D24-GMCSF and doxorubicin-based
chemotherapy provided strong rationale for further experiments in vivo. As an immunocompetent
animal model we used the Syrian hamster. Established DDT1-MF2 tumors were treated with the
combination of doxorubicin/ifosfamide and Ad5/3-D24-GMCSF or with the single agents every
3 days (Figure 2a-b, Study I). Antitumor efficacy was greatly enhanced with the combination
approach against this highly aggressive tumor model. Importantly, we evaluated combination
effects with the Fractional Tumor Volume method (FTV), that is derived from the Webb method
(Webb 1963), to provide a more accurate assessment of the nature of the interaction between virus
and chemotherapy. With the FTV approach we were able to confirm that the combination of
Ad5/3-D24-GMCSF and doxorubicin/ifosfamide was indeed synergistic in the hamster model
(Figure 2c, Study I).
Prompted by the EORTC 62012 Phase III trial result (Judson et al. 2014), which indicated that
doxorubicin plus ifosfamide was not superior to doxorubicin alone, we conducted a combination
study in Syrian hamsters with Ad5/3-D24-GMCSF and doxorubicin alone. This experiment
48
revealed that the virus combined with doxorubicin was not superior to doxorubicin alone, although
both were superior to mock (Figure 3a, Study I). Interestingly, when the tumors were collected at
the end of the experiment and analyzed for adenoviral E4 gene copies by qPCR we observed a
significant increase in E4 copy numbers if the animals were treated with doxorubicin plus Ad5/3D24-GMCSF as compared with virus alone (Figure 3b, Study I). This result was in line with our
in vitro observations where chemotherapy enhanced virus replication in STS cells.
NMRI nude mice were used to examine the antitumor effects of Ad5/3-D24-GMCSF and
doxorubicin against STS of human origin. HT-1080 fibrosarcoma xenografts could be very
effectively treated with the combination approach as most tumors (15 out of 16) were completely
eradicated in the virus plus chemotherapy group (Figure 5a-b, Study I). The interaction was
synergistic, as confirmed by the FTV method (Figure 5c, Study I).
The role of chemotherapy in modulating host leukocyte number and function could be studied in
more detail in Syrian hamsters if more reagents emerge. Cyclophosphamide has already been
shown to selectively deplete Tregs (Ghiringhelli et al. 2007). Since ifosfamide bears significant
structural resemblance to cyclophosphamide, it is possible that ifosfamide has similar effects on
Tregs. However, this has not been studied in preclinical or clinical settings. Recently it was
discovered that doxorubicin selectively eliminates immunosuppressive MDSC in spleen, blood
and tumor ((Alizadeh et al. 2014). Again, this is not an aspect that can be studied in hamsters due
to lack of reagents but remains an interesting topic for future research. Taken together, the
combinatorial use of ifosfamide and doxorubicin in immunocompetent tumor models could render
the tumor microenvironment less immunosuppressive, thus facilitating antitumor T-cell
responses.
In conclusion, the combination of oncolytic adenovirus and doxorubicin-based chemotherapy
represents an effective approach for treatment of soft-tissue sarcoma. Our results suggest that
synergy between the two agents comprises two nonmutually exclusive mechanisms: induction of
immunogenic cell death and enhancement of adenovirus replication.
4.3 Tumor-infiltrating lymphocytes (TIL) can be cultured ex vivo from syngeneic Syrian
hamster tumors (II)
The study of adoptive cell therapies (ACT) in the preclinical setting has been limited to the use of
mice. To broaden the repertoire of preclinical animal models for ACT and to establish an
adenovirus-permissive model suitable for oncolytic virotherapy studies combined with ACT, we
49
set out to culture and characterize tumor-infiltrating lymphocytes (TIL) of the Syrian hamster in
Study II.
Several implantable tumor cell lines were available for this study. These syngeneic cells
represented various histologies and could successfully be grown in hamsters subcutaneously.
Flow cytometric immunophenotyping studies revealed that the tumors contained varying amounts
of infiltrating CD4+ and CD8+ T-cells (Figure 1a-f, Study II). The most abundant T-cell type was
CD4 in all six tumor types studied. CD8+ T-cells were found in 4 out of 6 tumors. When the
tumors were excised, cut into small fragments and cultured in high-dose IL-2, we observed
lymphocyte expansion around the fragments within 5 days (Figure 2a-f, Study II). After 10 days
of ex vivo culture the lymphocytes were collected and used in effector-to-target assays to examine
the cell killing capability of the cultured TIL (Figure 3a-f, Study II). HapT1 pancreatic cancerderived TIL were able to kill autologous HapT1 cells specifically while sparing non-related
hamster tumor cells (DDT1-MF2) or human A549 cells. The same applied for TIL cultured from
RPMI 1846 melanoma tumors. TIL from the other 4 tumor types exhibited non-specific cell
killing properties.
In further experiments with HapT1 and RPMI 1846 TIL we evaluated the effect of MHC Class I
blocking on the cytolytic activity of TIL (Figure 4a-b, Study II). Interestingly, the cell killing
ability of RPMI 1846 TIL was completely abolished by MHC blocking which indicates that tumor
cell killing in the TIL population is mediated by cytotoxic T lymphocytes (CTL). On the contrary,
cytotoxicity of TIL from HapT1 was only partially abrogated by blocking. Since HapT1 TIL cell
killing was still specific to HapT1 tumor cells, the presence of NK cells seemed counterintuitive.
Therefore, we hypothesized that CD4+ T-cells in the TIL population could have gained cytotoxic
properties which was also supported by the observation that HapT1 cells expressed MHC Class
II molecules (Suppl. Figure S1, Study II).
The role of CD4+ T-cells in adoptive immunotherapy (and tumor immunology in general)
warrants further investigation. Clinical trials have been performed where adoptively transferred
TIL preparations have consisted of predominantly CD4+ T-cells and yet the patients respond well
(Wu et al. 2012). CD4+ T-cells have an important role in supporting CD8+ T-cell function and
thus it would seem preferable to include CD4+ T-cells in TIL preparations (Kamphorst & Ahmed
2013). In our preclinical hamster model the TIL administered to tumor-bearing animals comprised
15% CD4+ T-cells and 10% CD8+ T-cells. Furthermore, these TIL were considered “young”
50
since the ex vivo culture period was only 10 days. Taken together, the TIL used in Study II might
represent an ideal TIL product.
4.4 Oncolytic adenovirus enhances TIL therapy of established pancreatic cancer (II)
Following ex vivo culture and expansion of HapT1 TIL, we used the TIL together with the
oncolytic adenovirus Ad5-D24 to study the therapeutic potential of these agents combined. First,
cell killing was examined in vitro by infecting HapT1 cells with Ad5-D24 for 3 days before adding
HapT1 TIL. 24 hours after this the viability of HapT1 target cells was determined. With this
method we observed significantly improved cell killing with the combination of Ad5-D24 and
TIL over the single agents (Figure 5, Study II). Encouraged by these results we proceeded to in
vivo studies where HapT1 tumors implanted in Syrian hamsters were treated with the combination
approach. Indeed, the combination treatment was superior to TIL or virus alone in controlling
HapT1 tumor growth (Figure 6, Study II). Excitingly, analysis of endpoint spleens collected on
Day 24 revealed an enhanced ex vivo tumor cell killing capacity in the group that received TIL
plus Ad5-D24 treatment (Figure 7c, Study II). Also, a moderate increase in tumor-infiltrating
CD8+ T-cells was observed in the combination-treated tumors (Figure 7b, Study II).
The addition of checkpoint blockade antibodies to TIL therapy could prove an effective approach.
This has been studied preclinically in mice where PD-L1 blockade and TIL transfer showed
promising results (Kodumudi et al. 2016). However, the approach was not curative indicating that
complementary treatment modalities are needed. Oncolytic adenoviruses might provide the
solution, especially if armed with immunostimulatory cytokines. Another exciting approach to
enhance the efficacy of adoptive TIL transfer is to transfect TIL with mRNA encoding chemokine
receptors, such as CXCR3, for improved tumor migration (Idorn et al. 2016). Again, oncolytic
viruses could aid in tumor-trafficking of transfected TIL by modulating chemokine expression
indirectly (Study III) or directly if armed with chemokine-encoding transgenes (Nishio et al.
2014). To conclude, the antitumor efficacy of TIL therapy can be enhanced with oncolytic
adenovirus in a novel immunocompetent animal model supporting the clinical translation of this
combination approach.
51
4.5 Armed adenovirus vectors produce high levels of tumor-restricted biologically active
cytokines (III)
Adoptive T-cell therapies have shown promising results in many indications, but the treament
often comes with toxic side effects and not all patients benefit. Especially difficult to treat are
solid tumors that feature a hostile immunosuppressive microenvironment for the adoptively
transferred cells. In order to enable the full potential of T-cell therapy we set out to develop
adenoviral vectors carrying immunostimulatory cytokines that could, when injected
intratumorally, support the transferred T-cells locally at the tumor for enhanced efficacy.
The constructed human serotype 5 –based non-replicating adenoviruses featured a promoter from
human cytomegalovirus to drive constitutive expression of murine cytokines (Figure 1a, Study
III). All cytokines (mIL-2, mTNFa, mIFNg and mIFNb) were produced in high concentrations in
vitro and they were confirmed to be biologically active in appropriate bioassays (Figure 1b and
Suppl. Figure S1, Study III). As an important feasibility and safety aspect we studied the
expression of adenovirally delivered murine cytokines in vivo in mouse B16.OVA melanoma
tumors. Adenoviruses injected into tumors produced high local levels of cytokines, yet systemic
levels were negligible (Figure 1c-f, Study III).
Tumor-restricted production of such potent cytokines as IL-2 and TNFa is of critical importance.
Even though the viruses used in Study III are not specific for tumor cells per se, we did not observe
systemic exposure, which has been shown to cause significant side effects including hypotension
and hepatotoxicity (for TNFa)(Roberts et al. 2011), and vascular leakage syndrome (for IL-2)(Den
Otter et al. 2008). Thus, local delivery of these cytokines with adenoviral vectors represents a
safer approach.
4.6 Cytokine-coding adenoviruses enhance adoptive T-cell therapy of murine melanoma by
reshaping the tumor microenvironment and inducing T-cell trafficking (III)
To assess the antitumor effects of cytokine-armed adenoviruses combined with T-cell transfer, we
utilized the immunosuppressive B16.OVA melanoma model. Established B16.OVA tumors were
treated with intratumoral injections of Ad5-CMV-mIL2, Ad5-CMV-mTNFa, Ad5-CMV-mIFNg,
Ad5-CMV-mIFNb with or without intraperitoneal administration of T-cell receptor transgenic
CD8+ enriched OT-I T-cells. The T-cell transfer alone was not effective in controlling tumor
growth, but when combined with weekly injections of Ad5-CMV-mIL2 or Ad5-CMV-mTNFa,
efficacy was significantly improved (Figure 2a-b, Study III). The aforementioned viruses coding
52
for mIL-2 and mTNFa showed the best antitumor effects as they were able, when coupled with
OT-I T-cell transfer, to induce a stable non-progressing disease status in this aggressive melanoma
model. In comparison, Ad5-CMV-mIFNg combined with OT-I cells did not achieve the same
effect (Figure 2c, Study III). Also, treatment with Ad5-CMV-mIFNb did not bring any additional
benefit to T-cell transfer as the virus itself was an effective therapeutic (Figure 2d, Study III).
Based on experiments performed with viruses coding individual murine cytokines we then went
out to combine the two best candidates to further improve antitumor efficacy together with T-cell
transfer. These two cytokines were mIL-2 and mTNFa. Thus, in the same B16.OVA melanoma
model we combined Ad5-CMV-mIL2 and Ad5-CMV-mTNFa in a 1 to 1 ratio with concomitant
OT-I T-cell transfer and observed that this double combination of Ad5-CMV-mTNFa/Ad5-CMVmIL2 was superior to the mTNFa-armed virus combined with OT-I and the mIL-2-armed virus
combined with OT-I (Figure 3, Study III).
In mechanistic studies we studied the different cell types present in treated B16.OVA tumors.
Lymphocyte subsets were first examined for CD4+ and CD8+ cells and we observed an increased
number of CD4+ T-cells in tumors treated with mIL-2-coding virus plus OT-I (Figure 4a, Study
III). CD8+ T-cell levels were higher in the mIL-2 and triple combination-treated groups (Figure
4b, Study III). Interestingly, treatment with cytokine-armed viruses resulted in increased numbers
of activated T-cells (i.e. CD3+ cells positive for CD69) infiltrating the tumors (Figure 4c, Study
III). On the other hand, regulatory T-cell (Treg) infiltration was increased in triple combinationtreated tumors (Figure 4d, Study III). For B-cells and NK cells a similar pattern was observed;
mIL-2-treated tumors contained the highest levels of these lymphocytes (Figure 4e-f, Study III).
Low levels of immunosuppressive M2 macrophages were observed in tumors treated with
combinations of cytokine-armed viruses and T-cells when compared with mTNFa and mIL-2 –
coding viruses (Suppl. Figure S2a, Study III). Moreover, the number of mature dendritic cells was
increased in Ad5-CMV-mIL2 plus OT-I treated tumors (Suppl. Figure S2b, Study III).
Immune checkpoint molecules PD1 and PD-L1 were also studied and we observed significant
upregulation of PD-L1 expression in OT-I-treated tumors, which was further enhanced with the
addition of adenoviruses (Figure 5a, Study III). The target of PD-L1 on T-cells, PD1, was shown
to be downregulated on T-cells in mIL-2-treated tumors (Figure 5b, Study III). Lastly, the
expression of chemokines was assessed in B16.OVA tumors following treatment with viruses and
OT-I. When individual chemokine results were pooled (i.e. RANTES, MCP1, MIP-1a, MIP-1b,
MIG and I-TAC) the combination treatment with Ad5-CMV-mTNFa plus OT-I showed
53
significant upregulation of these molecules when compared with OT-I alone (Figure 5c, Study
III).
The promising efficacy and immunophenotyping results motivated us to study further the fate of
the transferred OT-I cells in vivo in the context of intratumoral adenovirus injections. To this end,
we labelled OT-I cells with a radioactive isotope of indium (111Indium) and followed their tissue
distribution in B16.OVA tumor-bearing mice with SPECT/CT imaging. 96 hours after treating
mice with radiolabelled T-cells and cytokine-armed viruses we observed a significant
accumulation of transferred T-cells in tumors treated with both viruses (Figure 6, Study III).
In earlier studies performed in our group, we saw improved antitumor efficacy when adenovirus
was combined with adoptive T-cell transfer in the B16 melanoma model (Tähtinen et al. 2015a).
The adenovirus used in these studies was an unarmed one, and the efficacy was attributed to
enhanced tumor immunogenicity, breaking of tumor-induced peripheral tolerance, and epitope
spreading. Later, we studied adoptive OT-I transfer together with intratumorally injected
recombinant cytokines (Tähtinen et al. 2015b). IFN-a2, IFNg, TNFa, and IL-2 significantly
enhanced antitumor efficacy of OT-I therapy. The results indicated that these cytokines increased
intratumoral cytokine secretion and recruited NK cells and mature DCs. Also, IFN-a2 and IL-2
increased the numbers of activated CD8+ T-cells in tumors, while T-cell anergy markers CTLA4 and PD1 were downregulated on CD8+ TIL. In Study III, similar results were obtained with the
newly constructed adenovirus vectors encoding murine TNFa and IL-2.
As mentioned before, immunosuppressiveness of the tumor microenvironment poses a significant
hurdle to adoptively transferred cells (Baitsch et al. 2011, Kalos & June 2013). Therefore, the
local changes seen in a) PD1 expression, b) M2 macrophages, c) CD69+ T-cells, d) dendritic cells
and e) chemokine expression hold much promise for future studies and possible human
translation. The aforementioned alterations brought on by adenovirus injections coupled with the
remarkable trafficking effect on T-cells could provide a solution for the well-known obstacle in
the CAR T-cell therapy field: efficacy against solid tumors has been unimpressive despite
breakthroughs in hematological malignancies (Beatty & O'Hara 2016). With regard to
chemokines, preclinical and clinical studies have demonstrated the critical importance of
chemokine/chemokine receptor expression in melanoma lesions for effective CD8+ T-cell
responses (Harlin et al. 2009, Mikucki et al. 2015).
54
4.7 Oncolytic adenoviruses coding for human TNFa and IL-2 kill human and hamster
cancer cells in vitro and synergize with hamster TIL (IV)
The most promising immunostimulatory cytokines in the context of adoptive T-cell therapy were
successfully identified in Study III. Thus, in Study IV, replication-competent oncolytic
adenoviruses coding for human TNFa and IL-2 were constructed and used in combination with
TIL transfer in immunocompetent Syrian hamsters. As described earlier the Syrian hamster
represents a significantly more relevant animal model for studying adenovirus-based gene therapy
due to its ability to support replication of human adenovirus as opposed to mice.
The new adenoviruses carry a backbone of Ad5/3-E2F-d24. The 24-base pair deletion in E1A and
the E2F promoter renders virus replication specific to tumor cells (Figure 1a, Study IV). Cytokine
transgenes were placed into the E3 region to yield viruses coding for human TNFa (Ad5/3-E2Fd24-hTNFa), human IL-2 (Ad5/3-E2F-d24-hIL2), and both (Ad5/3-E2F-d24-hTNFa-IREShIL2). A panel of human and hamster cancer cell lines were first used to assess the cell killing
ability of the constructed adenoviruses. All viruses were able to kill cancer cells with similar
efficacy as the virus without transgenes (Figure 1b, Suppl. Figure S1, Study IV). In addition,
HapT1-derived TIL were studied together with the adenoviruses to assess combination effects in
vitro and we observed synergistic cell killing with combinations of TIL and adenovirus (Figure
1c, Study IV). Expression and bioactivity of adenovirus-encoded human cytokines were
confirmed both in vitro and in vivo (Figure 2a-b, Suppl. Figure S2, Study IV). From a safety
perspective it is noteworthy that cytokine levels were undetectable in sera of intratumorally
injected hamsters while tumor levels were high, indicating that cytokine production is strictly
limited to tumors (Figure 2c, Study IV).
Synergistic tumor cell killing with TIL and adenovirus in vitro was also observed in Study II. The
mechanism of synergy was not studied further in either of the two studies, although it is expected
to differ from the more complex in vivo situation. Previous research with IL-12 –encoding
adenovirus and cytokine-induced killer (CIK) cells showed improved cell killing in vitro as well,
but mechanistic studies were not pursued (Yang et al. 2012). More recently, the combination of
Ad5-D24 and CAR T-cells was investigated in several human tumor cell lines, and the superior
cell killing that was observed was associated with accelerated caspase pathways (Nishio et al.
2014). The mechanism of synergy between adenoviruses and hamster TIL in Studies II and IV
might bear similar features, but this requires further examination.
55
Clinical adoptive T-cell transfer protocols include high-dose IL-2 administered intravenously
following the transfer (Rosenberg 2014). This postconditioning regimen is considered essential
for the T-cell graft, but it is accompanied by severe toxicities on the systemic level. For this reason,
the possibility of circumventing the need for systemic IL-2 by local delivery would represent a
notable safety improvement. In Study III we utilized non-replicating adenoviral vectors to deliver
IL-2 (and TNFa), and we observed that cytokine production was limited to tumors.
Correspondingly, the oncolytic viruses constructed and used in Study IV showed tumor-restricted
IL-2 expression with no systemic exposure. This observation was not surprising since cytokine
production from an oncolytic adenovirus platform has been shown to be contained to tumors
(Koski et al. 2010). Thus, in future studies, a head-to-head comparison between adenovirally
delivered IL-2 and systemically administered IL-2 should be performed in the context of adoptive
T-cell transfer. For this approach to be considered a competitive option to traditional systemic
administration, antitumor efficacy needs to be non-inferior, if not superior.
In addition to postconditioning IL-2, non-myeloablative chemotherapy consisting of
cyclophosphamide and fludarabine is typically included as “preconditioning” for patients
undergoing adoptive T-cell transfer (Hershkovitz et al. 2010). As with IL-2, preconditioning is
associated with toxicities. To date, it has not been studied whether local oncolytic adenovirus
injections could also replace the need for systemic chemotherapy prior to T-cell transfer.
Preclinically this aspect can be assessed in mice using cytokine-coding non-replicating viruses
described in Study III or in Syrian hamsters using oncolytic viruses described in Study IV.
4.8 Armed oncolytic adenoviruses exhibit potent antitumor activity against ovarian cancer
xenografts and Syrian hamster pancreatic cancer (IV)
Antitumor efficacy of the new armed adenoviruses was studied in two different animal models.
First, a xenograft model for orthotopic ovarian cancer was employed to study the effects against
tumors of human origin. SCID mice bearing luciferase-expressing SKOV3-Luc tumors were
treated with intraperitoneal injections of Ad5/3-E2F-d24, Ad5/3-E2F-d24-hTNFa, Ad5/3-E2Fd24-hIL2 or Ad5/3-E2F-d24-hTNFa-IRES-hIL2 once per week. All viruses displayed potent
efficacy despite the inclusion of transgenes (Figure 3, Study IV). Differences between viruses
were not significant, since immunostimulatory cytokines are not expected to have downstream
adaptive response effects in an immunocompromised animal lacking a full immune system.
56
Since Syrian hamsters support human adenovirus replication, the logical next step was to assess
antitumor efficacy in hamsters with or without TIL transfer. The unarmed virus had very little
efficacy, as did TIL transfer alone, but when combined a highly effective response was observed
(Figure 4a, Study IV). The armed viruses showed very potent antitumor efficacy even as single
agents (Figure 4b-d, Study IV). However, the percentage of cured animals was higher in groups
receiving TIL and virus compared with virus-only groups (Figure 4e, Study IV). This observation
was confirmed in histopathological post-mortem analysis, which revealed that 100% of hamsters
treated with Ad5/3-E2F-d24-hTNFa-IRES-hIL2 and TIL were cured of tumors. Similar results in
antitumor efficacy were obtained when a reduced virus dose was used (Figure 4f, Study IV).
The ovarian cancer model (SKOV3) used in Study IV has been studied extensively in the context
of adenovirotherapy (Bauerschmitz et al. 2002, Kanerva et al. 2003, Kanerva et al. 2005, Raki et
al. 2005, Raki et al. 2008). It has proven useful for orthotopic gene therapy studies despite its
tendency to gain resistance to adenovirus, that was shown to arise through induction of interferon
pathways (Liikanen et al. 2011). A rational combination therapy to be studied preclinically in the
SKOV3 model would involve CAR T-cells (targeted against over-expressed epitopes on ovarian
cancer) and Ad5/3-E2F-d24-hTNFa-IRES-hIL2. Recently, L1-CAM –specific CAR T-cells were
used against SKOV3 implanted in NOD scid gamma (NSG) mice with promising results (Hong
et al. 2016). However, the CAR T-cells did not eradicate all tumors leaving room for
combinatorial approaches that would logically include oncolytic adenoviruses.
4.9 Cytokine-armed oncolytic adenoviruses induce tumor-specific antitumor immunity and
increased splenocyte proliferation (IV)
Endpoint tumors and organs were collected from Syrian hamsters to gain understanding of the
observed antitumor efficacy. Interestingly, CD8+ and CD4+ T-cells were more frequent in tumors
treated with IL-2-coding adenovirus (Figure 5a-b, Study IV). In lymph nodes and spleens the
changes in cell composition were less pronounced (Suppl. Figure S3, Study IV). Additionally,
splenocyte proliferation ex vivo was significantly increased when the animals were treated with
cytokine-coding viruses (Figure 5d, Study IV).
Those hamsters that were previously cured of HapT1 tumors were subjected to rechallenge with
the same tumor and another tumor (DDT1-MF2), after a two-week rest period. The animals treated
and cured with cytokine-armed viruses were able to reject HapT1, whereas the one animal cured
with the unarmed virus had a non-progressing disease status (Figure 6a, Study IV). Importantly,
57
the growth of DDT1-MF2 tumors in cured animals was comparable to growth in naïve animals
(Figure 6b, Study IV). Together, these data indicate that treatment with cytokine-coding oncolytic
adenoviruses induce tumor-specific antitumor immunity.
For the assessment of safety, histopathological analysis of key organs was performed by a
veterinary pathologist. Mild and minimal lymphocyte hyperplasia, slightly expanded white pulp,
and mildly increased number of heterophils in the marginal zone or red pulp were observed in
spleens of all treatment groups (data not shown). Treatment-related changes in tissue structures
of heart, lung, liver, and kidney were absent indicating that treatment with cytokine-armed
adenoviruses was safe.
Previously, an oncolytic adenovirus coding for GMCSF (Ad5-D24-GMCSF) was studied in
Syrian hamsters with HapT1 tumors (Cerullo et al. 2010a). As in Study IV, the animals treated
with Ad5-D24-GMCSF were cured and later rechallenged with the same tumor and with a
different tumor (HaK). The results were very similar in this rechallenge experiment as in Study
IV, i.e. the cured animals were able to reject the same tumor but not the new one. Comparable
results have been reported with oncolytic vaccinia virus coding for GMCSF (Parviainen et al.
2015).
Future studies should focus on utilizing Syrian hamsters to their full extent. Sequencing and
annotation of the hamster transcriptome enables construction of CAR T-cells targeting epitopes
present on several implantable tumors of various histologies, and subsequent combination studies
with oncolytic adenoviruses (Tchitchek et al. 2014). Moreover, the development of assays to
monitor immune responses in Syrian hamsters significantly increases the translational value of
this animal model within the cancer immunotherapy field (Zivcec et al. 2011).
One potential application (in addition to T-cell therapy enhancement) for the TNFa/IL-2 –coding
adenovirus constructed in Study IV relates to a hot topic in oncology that is immune checkpoint
blockade. The predictive biomarkers for benefiting from checkpoint blockade treatment have been
identified: tumor CD8+ infiltration and PD-L1 upregulation (Spranger 2016). As shown in Study
III, both of these markers are influenced by cytokine-coding adenoviruses even in the absence of
true oncolysis. In Studies II and IV, only one of these key phenomena (CD8+ infiltration) could
be studied due to lack of tools for detecting hamster PD-L1. Nevertheless, armed oncolytic
adenoviruses (such as the one described in Study IV) have the potential of making checkpoint
blockade therapy work by converting “cold” tumors to “hot” tumors (Zamarin et al. 2014). Other
oncolytic viruses have been recently studied with checkpoint-blocking antibodies: measles virus
58
with CTLA-4 and PD-L1 blockade (Engeland et al. 2014), Semliki Forest Virus with PD1
blockade (Quetglas et al. 2015), and reovirus with PD1 blockade (Rajani et al. 2016). To date,
clinical experience with oncolytic virus and checkpoint blockade combination is limited, yet
encouraging reports are emerging: T-VEC (HSV-1 –based oncolytic virus) combined with
pembrolizumab (anti-PD1 mAb) in unresectable stage IIIB-IV melanoma patients resulted in a
50% response rate (Long et al., Abstract 9568, 2016 ASCO Annual Meeting). Combinatorial
clinical studies with many other viruses are underway and the results are eagerly awaited (Lawler
et al. 2016).
59
5. SUMMARY AND CONCLUSIONS
The editors of Science selected cancer immunotherapy as the Breakthrough of the Year for 2013
(Couzin-Frankel 2013). Despite the evident progress, much work remains to be done to improve
cure rates further, and to identify the right treatment for each individual patient. It has become
clear that rational combinations of treatment modalities are the key to success, as exemplified by
clinical trials with: two checkpoint-inhibiting antibodies versus only one (Larkin et al. 2015,
Postow et al. 2015), checkpoint inhibitor combined with chemotherapy (Rizvi et al. 2016), and
oncolytic virus combined with checkpoint inhibition (Long et al., Abstract 9568, 2016 ASCO
Annual Meeting). However, the safety of effective novel treatments (and their combinations)
needs to be carefully evaluated in order to avoid unexpected toxicities such as the ones reported
with TCRs and CARs (Linette et al. 2013, Kochenderfer et al. 2012), and checkpoint inhibitors
(Spain et al. 2016). Importantly, the safety profile of oncolytic adenoviruses has been considered
excellent (Pesonen et al. 2011), and in some cases dose-limiting toxicities (DLT) or maximum
tolerated doses (MTD) have not even been reached (Ranki et al. 2016).
In this thesis we show that oncolytic adenovirus encoding a potent immunostimulatory cytokine,
GM-CSF, synergizes with standard first-line chemotherapy against soft-tissue sarcomas of human
and Syrian hamster origin (Study I). We provide clues on the mechanism-of-action and suggest
that this combination treatment is not only effective but also safe for clinical translation. In the
second study, TIL were successfully cultured from syngeneic Syrian hamster tumors and
subsequently used together with oncolytic adenovirus injections to treat established pancreatic
cancer. With this approach, improved antitumor efficacy was achieved as compared with the
single agents, and the treatment was safe. When oncolytic adenoviruses armed with the human
cytokines IL-2 and TNFa were combined with TIL transfer in Study IV, complete tumor
eradication and tumor-specific immunity was induced. In Study III, adenovirus vectors coding for
murine IL-2 and TNFa enhanced T-cell therapy of immunosuppressive mouse melanoma similar
to many human melanomas, with indications that T-cell trafficking to tumors was improved by
the cytokines and that the combination treatment ameliorated local tumor-induced
immunosuppression. In conclusion, the preclinical results presented in this thesis strongly support
the translation of adenovirus-based cancer immunotherapy combinations into patient care.
60
6. ACKNOWLEDGEMENTS
This thesis work was carried out in the Cancer Gene Therapy Group (CGTG) between the years
2012-2016. CGTG was previously part of the Molecular Cancer Biology Research Program in
Biomedicum Helsinki and is currently affiliated to the Department of Oncology, Faculty of
Medicine, University of Helsinki.
I wish to thank the Dean of the Faculty of Medicine, Professor Risto Renkonen, the head of the
Haartman Institute, Professor Tom Böhling, Directors of the Doctoral Programme in Biomedicine
(DPBM), for providing excellent research facilities and courses.
I am grateful for financial support provided by the Cancer Gene Therapy Group, Oncos
Therapeutics Ltd, TILT Biotherapeutics Ltd, University of Helsinki, Finnish Cancer
Organizations, European Research Council, HUCH Research (EVO), ASCO Foundation,
Biomedicum Helsinki Foundation, Jane and Aatos Erkko Foundation, Sigrid Juselius Foundation,
Biocentrum Helsinki, and Biocenter Finland.
I also want to thank all collaborators that participated in my research, Docent Anu J. Airaksinen,
Dr. Tiina Hakonen, Professor Michael J. Mathis, Professor Anja Kipar, and Dave Lumen.
I want to express my gratitude to pre-examiners Docent Hanna Jarva and Docent Veijo Hukkanen
for taking the time to review my work and for giving thoughtful comments that made the thesis
better. Many thanks to my Thesis Committee members Docent Leila Vaalavirta and Docent Hanna
Jarva for providing support and valuable advice.
I am sincerely grateful to my supervisor Professor Akseli Hemminki for the excellent guidance
and encouragement that produced the 24th CGTG doctor. I admire your relentless enthusiasm and
optimism. Being part of translational research in CGTG/TILT has been truly eye-opening.
I thank all CGTG members for both scientific and non-scientific activities in or outside the lab
that made my thesis happen: the seniors Markus (!), Anniina, Ilkka, Kilian, Iulia, Dipu, Lotta,
Otto, Karo, Vince, Mari and Kristian; the young guns João and Sadia; and my young padawan
Víctor. Thank you Minna and Suski for daily help and for keeping things from falling apart. Extraspecial thanks to Simona, Siri, Suvi and Riikka for all the great conference trips, coffee breaks
and general silliness; an amazing batch of not-so-ordinary superwomen!
61
Special thanks to Conan and Jimmy, and especially Ricky, Steve and Karl for the 400 hours of
utter tripe that made cancer research so much easier to bear. Lastly, I wish to thank my friends
and my extended family of cousins, siblings, parents, aunts and unofficial uncles for support and
fun times!
Helsinki, December 2016
Mikko
62
7. REFERENCES
Accart N, Urosevic-Maiwald M, Dummer R, Bataille V, Kehrer N, Niculescu C, Limacher JM,
Chenard MP, Bonnefoy JY, Rooke R. Lymphocytic infiltration in the cutaneous lymphoma
microenvironment after injection of TG1042. J Transl Med 2013, 11: 226-5876-11-226.
Adair RA, Roulstone V, Scott KJ, Morgan R, Nuovo GJ, Fuller M, Beirne D, West EJ, Jennings
VA, Rose A, Kyula J, Fraser S, Dave R, Anthoney DA, Merrick A, Prestwich R, Aldouri A,
Donnelly O, Pandha H, Coffey M, Selby P, Vile R, Toogood G, Harrington K, Melcher AA. Cell
carriage, delivery, and selective replication of an oncolytic virus in tumor in patients. Sci Transl
Med 2012, 4: 138ra77.
Addison CL, Braciak T, Ralston R, Muller WJ, Gauldie J, Graham FL. Intratumoral injection of
an adenovirus expressing interleukin 2 induces regression and immunity in a murine breast cancer
model. Proc Natl Acad Sci U S A 1995, 92: 8522-8526.
Afkhami S, Yao Y, Xing Z. Methods and clinical development of adenovirus-vectored vaccines
against mucosal pathogens. Mol Ther Methods Clin Dev 2016, 3: 16030.
Aiuti A, Bachoud-Levi AC, Blesch A, Brenner MK, Cattaneo F, Chiocca EA, Gao G, High KA,
Leen AM, Lemoine NR, McNeish IA, Meneguzzi G, Peschanski M, Roncarolo MG, Strayer DS,
Tuszynski MH, Waxman DJ, Wilson JM. Progress and prospects: gene therapy clinical trials (part
2). Gene Ther 2007, 14: 1555-1563.
Alberts DS, Marth C, Alvarez RD, Johnson G, Bidzinski M, Kardatzke DR, Bradford WZ, Loutit
J, Kirn DH, Clouser MC, Markman M, GRACES Clinical Trial Consortium. Randomized phase
3 trial of interferon gamma-1b plus standard carboplatin/paclitaxel versus carboplatin/paclitaxel
alone for first-line treatment of advanced ovarian and primary peritoneal carcinomas: results from
a prospectively designed analysis of progression-free survival. Gynecol Oncol 2008, 109: 174181.
Alemany R. Designing adenoviral vectors for tumor-specific targeting. Methods Mol Biol 2009,
542: 57-74.
Alizadeh D, Trad M, Hanke NT, Larmonier CB, Janikashvili N, Bonnotte B, Katsanis E,
Larmonier N. Doxorubicin eliminates myeloid-derived suppressor cells and enhances the efficacy
of adoptive T-cell transfer in breast cancer. Cancer Res 2014, 74: 104-118.
Andersen R, Donia M, Ellebaek E, Borch TH, Kongsted P, Iversen TZ, Holmich LR, Hendel HW,
Met O, Andersen MH, Thor Straten P, Svane IM. Long-Lasting Complete Responses in Patients
with Metastatic Melanoma after Adoptive Cell Therapy with Tumor-Infiltrating Lymphocytes and
an Attenuated IL2 Regimen. Clin Cancer Res 2016, 22: 3734-3745.
Andersson U, Wang H, Palmblad K, Aveberger AC, Bloom O, Erlandsson-Harris H, Janson A,
Kokkola R, Zhang M, Yang H, Tracey KJ. High mobility group 1 protein (HMG-1) stimulates
proinflammatory cytokine synthesis in human monocytes. J Exp Med 2000, 192: 565-570.
63
Angelova AL, Grekova SP, Heller A, Kuhlmann O, Soyka E, Giese T, Aprahamian M, Bour G,
Ruffer S, Cziepluch C, Daeffler L, Rommelaere J, Werner J, Raykov Z, Giese NA.
Complementary induction of immunogenic cell death by oncolytic parvovirus H-1PV and
gemcitabine in pancreatic cancer. J Virol 2014, 88: 5263-5276.
Appaiahgari MB, Vrati S. Adenoviruses as gene/vaccine delivery vectors: promises and pitfalls.
Expert Opin Biol Ther 2015, 15: 337-351.
Arellano M, Lonial S. Clinical uses of GM-CSF, a critical appraisal and update. Biologics 2008,
2: 13-27.
Atkins MB, Lotze MT, Dutcher JP, Fisher RI, Weiss G, Margolin K, Abrams J, Sznol M,
Parkinson D, Hawkins M, Paradise C, Kunkel L, Rosenberg SA. High-dose recombinant
interleukin 2 therapy for patients with metastatic melanoma: analysis of 270 patients treated
between 1985 and 1993. J Clin Oncol 1999, 17: 2105-2116.
Awada A, Gil T, Sales F, Dubuisson M, Vereecken P, Klastersky J, Moerman C, de Valeriola D,
Piccart MJ. Prolonged schedule of temozolomide (Temodal) plus liposomal doxorubicin (Caelyx)
in advanced solid cancers. Anticancer Drugs 2004, 15: 499-502.
Baitsch L, Baumgaertner P, Devevre E, Raghav SK, Legat A, Barba L, Wieckowski S,
Bouzourene H, Deplancke B, Romero P, Rufer N, Speiser DE. Exhaustion of tumor-specific
CD8(+) T cells in metastases from melanoma patients. J Clin Invest 2011, 121: 2350-2360.
Bajgain P, Mucharla R, Wilson J, Welch D, Anurathapan U, Liang B, Lu X, Ripple K, Centanni
JM, Hall C, Hsu D, Couture LA, Gupta S, Gee AP, Heslop HE, Leen AM, Rooney CM, Vera JF.
Optimizing the production of suspension cells using the G-Rex "M" series. Mol Ther Methods
Clin Dev 2014, 1: 14015.
Baldan V, Griffiths R, Hawkins RE, Gilham DE. Efficient and reproducible generation of tumourinfiltrating lymphocytes for renal cell carcinoma. Br J Cancer 2015, 112: 1510-1518.
Baluna R, Vitetta ES. Vascular leak syndrome: a side effect of immunotherapy.
Immunopharmacology 1997, 37: 117-132.
Barnden MJ, Allison J, Heath WR, Carbone FR. Defective TCR expression in transgenic mice
constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous
regulatory elements. Immunol Cell Biol 1998, 76: 34-40.
Bauerschmitz GJ, Lam JT, Kanerva A, Suzuki K, Nettelbeck DM, Dmitriev I, Krasnykh V,
Mikheeva GV, Barnes MN, Alvarez RD, Dall P, Alemany R, Curiel DT, Hemminki A. Treatment
of ovarian cancer with a tropism modified oncolytic adenovirus. Cancer Res 2002, 62: 1266-1270.
Beatty GL, O'Hara M. Chimeric antigen receptor-modified T cells for the treatment of solid
tumors: Defining the challenges and next steps. Pharmacol Ther 2016, 166: 30-9.
Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones EA, Krithivas A, Hong JS, Horwitz MS,
Crowell RL, Finberg RW. Isolation of a common receptor for Coxsackie B viruses and
adenoviruses 2 and 5. Science 1997, 275: 1320-1323.
64
Besser MJ, Shapira-Frommer R, Itzhaki O, Treves AJ, Zippel DB, Levy D, Kubi A, Shoshani N,
Zikich D, Ohayon Y, Ohayon D, Shalmon B, Markel G, Yerushalmi R, Apter S, Ben-Nun A, BenAmi E, Shimoni A, Nagler A, Schachter J. Adoptive transfer of tumor-infiltrating lymphocytes in
patients with metastatic melanoma: intent-to-treat analysis and efficacy after failure to prior
immunotherapies. Clin Cancer Res 2013, 19: 4792-4800.
Bischoff JR, Kirn DH, Williams A, Heise C, Horn S, Muna M, Ng L, Nye JA, Sampson-Johannes
A, Fattaey A, McCormick F. An adenovirus mutant that replicates selectively in p53-deficient
human tumor cells. Science 1996, 274: 373-376.
Bolyard C, Yoo JY, Wang PY, Saini U, Rath KS, Cripe TP, Zhang J, Selvendiran K, Kaur B.
Doxorubicin synergizes with 34.5ENVE to enhance antitumor efficacy against metastatic ovarian
cancer. Clin Cancer Res 2014, 20: 6479-6494.
Bonini C, Mondino A. Adoptive T-cell therapy for cancer: The era of engineered T cells. Eur J
Immunol 2015, 45: 2457-2469.
Bramante S, Kaufmann JK, Veckman V, Liikanen I, Nettelbeck DM, Hemminki O, Vassilev L,
Cerullo V, Oksanen M, Heiskanen R, Joensuu T, Kanerva A, Pesonen S, Matikainen S, VahaKoskela M, Koski A, Hemminki A. Treatment of melanoma with a serotype 5/3 chimeric
oncolytic adenovirus coding for GM-CSF: Results in vitro, in rodents and in humans. Int J Cancer
2015, 137: 1775-1783.
Bramante S, Koski A, Kipar A, Diaconu I, Liikanen I, Hemminki O, Vassilev L, Parviainen S,
Cerullo V, Pesonen SK, Oksanen M, Heiskanen R, Rouvinen-Lagerstrom N, Merisalo-Soikkeli
M, Hakonen T, Joensuu T, Kanerva A, Pesonen S, Hemminki A. Serotype chimeric oncolytic
adenovirus coding for GM-CSF for treatment of sarcoma in rodents and humans. Int J Cancer
2014, 135: 720-730.
Breidenbach M, Rein DT, Wang M, Nettelbeck DM, Hemminki A, Ulasov I, Rivera AR, Everts
M, Alvarez RD, Douglas JT, Curiel DT. Genetic replacement of the adenovirus shaft fiber reduces
liver tropism in ovarian cancer gene therapy. Hum Gene Ther 2004, 15: 509-518.
Breitbach CJ, Lichty BD, Bell JC. Oncolytic Viruses: Therapeutics With an Identity Crisis.
EBioMedicine 2016, 9: 31-6.
Brentjens RJ, Davila ML, Riviere I, Park J, Wang X, Cowell LG, Bartido S, Stefanski J, Taylor
C, Olszewska M, Borquez-Ojeda O, Qu J, Wasielewska T, He Q, Bernal Y, Rijo IV, Hedvat C,
Kobos R, Curran K, Steinherz P, Jurcic J, Rosenblat T, Maslak P, Frattini M, Sadelain M. CD19targeted T cells rapidly induce molecular remissions in adults with chemotherapy-refractory acute
lymphoblastic leukemia. Sci Transl Med 2013, 5: 177ra38.
Bridle BW, Stephenson KB, Boudreau JE, Koshy S, Kazdhan N, Pullenayegum E, Brunelliere J,
Bramson JL, Lichty BD, Wan Y. Potentiating cancer immunotherapy using an oncolytic virus.
Mol Ther 2010, 18: 1430-1439.
Burke JM, Lamm DL, Meng MV, Nemunaitis JJ, Stephenson JJ, Arseneau JC, Aimi J, Lerner S,
Yeung AW, Kazarian T, Maslyar DJ, McKiernan JM. A first in human phase 1 study of CG0070,
a GM-CSF expressing oncolytic adenovirus, for the treatment of nonmuscle invasive bladder
cancer. J Urol 2012, 188: 2391-2397.
65
Cao G, Su J, Lu W, Zhang F, Zhao G, Marteralli D, Dong Z. Adenovirus-mediated interferonbeta gene therapy suppresses growth and metastasis of human prostate cancer in nude mice.
Cancer Gene Ther 2001, 8: 497-505.
Capasso C, Hirvinen M, Garofalo M, Romaniuk D, Kuryk L, Sarvela T, Vitale A, Antopolsky M,
Magarkar A, Viitala T, Suutari T, Bunker A, Yliperttula M, Urtti A, Cerullo V. Oncolytic
adenoviruses coated with MHC-I tumor epitopes increase the antitumor immunity and efficacy
against melanoma. Oncoimmunology 2015, 5: e1105429.
Carswell EA, Old LJ, Kassel RL, Green S, Fiore N, Williamson B. An endotoxin-induced serum
factor that causes necrosis of tumors. Proc Natl Acad Sci U S A 1975, 72: 3666-3670.
Casares N, Pequignot MO, Tesniere A, Ghiringhelli F, Roux S, Chaput N, Schmitt E, Hamai A,
Hervas-Stubbs S, Obeid M, Coutant F, Metivier D, Pichard E, Aucouturier P, Pierron G, Garrido
C, Zitvogel L, Kroemer G. Caspase-dependent immunogenicity of doxorubicin-induced tumor
cell death. J Exp Med 2005, 202: 1691-1701.
Cerullo V, Pesonen S, Diaconu I, Escutenaire S, Arstila PT, Ugolini M, Nokisalmi P, Raki M,
Laasonen L, Sarkioja M, Rajecki M, Kangasniemi L, Guse K, Helminen A, Ahtiainen L,
Ristimaki A, Raisanen-Sokolowski A, Haavisto E, Oksanen M, Karli E, Karioja-Kallio A, Holm
SL, Kouri M, Joensuu T, Kanerva A, Hemminki A. Oncolytic adenovirus coding for granulocyte
macrophage colony-stimulating factor induces antitumoral immunity in cancer patients. Cancer
Res 2010a, 70: 4297-4309.
Cerullo V, Pesonen S, Diaconu I, Escutenaire S, Arstila PT, Ugolini M, Nokisalmi P, Raki M,
Laasonen L, Sarkioja M, Rajecki M, Kangasniemi L, Guse K, Helminen A, Ahtiainen L,
Ristimaki A, Raisanen-Sokolowski A, Haavisto E, Oksanen M, Karli E, Karioja-Kallio A, Holm
SL, Kouri M, Joensuu T, Kanerva A, Hemminki A. Oncolytic adenovirus coding for granulocyte
macrophage colony-stimulating factor induces antitumoral immunity in cancer patients. Cancer
Res 2010b, 70: 4297-4309.
Chekmasova AA, Rao TD, Nikhamin Y, Park KJ, Levine DA, Spriggs DR, Brentjens RJ.
Successful eradication of established peritoneal ovarian tumors in SCID-Beige mice following
adoptive transfer of T cells genetically targeted to the MUC16 antigen. Clin Cancer Res 2010, 16:
3594-3606.
Chen GX, Zhang S, He XH, Liu SY, Ma C, Zou XP. Clinical utility of recombinant adenoviral
human p53 gene therapy: current perspectives. Onco Targets Ther 2014, 7: 1901-1909.
Chiocca EA, Smith KM, McKinney B, Palmer CA, Rosenfeld S, Lillehei K, Hamilton A,
DeMasters BK, Judy K, Kirn D. A phase I trial of Ad.hIFN-beta gene therapy for glioma. Mol
Ther 2008, 16: 618-626.
Clark MA, Fisher C, Judson I, Thomas JM. Soft-tissue sarcomas in adults. N Engl J Med 2005,
353: 701-711.
Cordier L, Duffour MT, Sabourin JC, Lee MG, Cabannes J, Ragot T, Perricaudet M, Haddada H.
Complete recovery of mice from a pre-established tumor by direct intratumoral delivery of an
adenovirus vector harboring the murine IL-2 gene. Gene Ther 1995, 2: 16-21.
66
Couzin-Frankel J. Breakthrough of the year 2013. Cancer immunotherapy. Science 2013, 342:
1432-1433.
Curiel TJ, Wei S, Dong H, Alvarez X, Cheng P, Mottram P, Krzysiek R, Knutson KL, Daniel B,
Zimmermann MC, David O, Burow M, Gordon A, Dhurandhar N, Myers L, Berggren R,
Hemminki A, Alvarez RD, Emilie D, Curiel DT, Chen L, Zou W. Blockade of B7-H1 improves
myeloid dendritic cell-mediated antitumor immunity. Nat Med 2003, 9: 562-567.
Dembic Z, Haas W, Weiss S, McCubrey J, Kiefer H, von Boehmer H, Steinmetz M. Transfer of
specificity by murine alpha and beta T-cell receptor genes. Nature 1986, 320: 232-238.
Den Otter W, Jacobs JJ, Battermann JJ, Hordijk GJ, Krastev Z, Moiseeva EV, Stewart RJ,
Ziekman PG, Koten JW. Local therapy of cancer with free IL-2. Cancer Immunol Immunother
2008, 57: 931-950.
Deroose JP, Eggermont AM, van Geel AN, Burger JW, den Bakker MA, de Wilt JH, Verhoef C.
Long-term results of tumor necrosis factor alpha- and melphalan-based isolated limb perfusion in
locally advanced extremity soft tissue sarcomas. J Clin Oncol 2011, 29: 4036-4044.
Deroose JP, Eggermont AM, van Geel AN, de Wilt JH, Burger JW, Verhoef C. 20 years
experience of TNF-based isolated limb perfusion for in-transit melanoma metastases: TNF dose
matters. Ann Surg Oncol 2012, 19: 627-635.
DeVita VT,Jr, Chu E. A history of cancer chemotherapy. Cancer Res 2008, 68: 8643-8653.
Diaconu I, Cerullo V, Hirvinen ML, Escutenaire S, Ugolini M, Pesonen SK, Bramante S,
Parviainen S, Kanerva A, Loskog AS, Eliopoulos AG, Pesonen S, Hemminki A. Immune response
is an important aspect of the antitumor effect produced by a CD40L-encoding oncolytic
adenovirus. Cancer Res 2012, 72: 2327-2338.
Donia M, Junker N, Ellebaek E, Andersen MH, Straten PT, Svane IM. Characterization and
comparison of "Standard" and "Young" tumor infiltrating lymphocytes for adoptive cell therapy
at a Danish Translational Research Institution. Scand J Immunol 2011,
Donnelly OG, Errington-Mais F, Steele L, Hadac E, Jennings V, Scott K, Peach H, Phillips RM,
Bond J, Pandha H, Harrington K, Vile R, Russell S, Selby P, Melcher AA. Measles virus causes
immunogenic cell death in human melanoma. Gene Ther 2013, 20: 7-15.
Douglas JT, Rogers BE, Rosenfeld ME, Michael SI, Feng M, Curiel DT. Targeted gene delivery
by tropism-modified adenoviral vectors. Nat Biotechnol 1996, 14: 1574-1578.
Dreno B, Urosevic-Maiwald M, Kim Y, Guitart J, Duvic M, Dereure O, Khammari A, Knol AC,
Derbij A, Lusky M, Didillon I, Santoni AM, Acres B, Bataille V, Chenard MP, Bleuzen P,
Limacher JM, Dummer R. TG1042 (Adenovirus-interferon-gamma) in primary cutaneous B-cell
lymphomas: a phase II clinical trial. PLoS One 2014, 9: e83670.
Dudley ME, Gross CA, Langhan MM, Garcia MR, Sherry RM, Yang JC, Phan GQ, Kammula
US, Hughes MS, Citrin DE, Restifo NP, Wunderlich JR, Prieto PA, Hong JJ, Langan RC, Zlott
DA, Morton KE, White DE, Laurencot CM, Rosenberg SA. CD8+ enriched "young" tumor
67
infiltrating lymphocytes can mediate regression of metastatic melanoma. Clin Cancer Res 2010,
16: 6122-6131.
Dudley ME, Gross CA, Somerville RP, Hong Y, Schaub NP, Rosati SF, White DE, Nathan D,
Restifo NP, Steinberg SM, Wunderlich JR, Kammula US, Sherry RM, Yang JC, Phan GQ,
Hughes MS, Laurencot CM, Rosenberg SA. Randomized selection design trial evaluating CD8+enriched versus unselected tumor-infiltrating lymphocytes for adoptive cell therapy for patients
with melanoma. J Clin Oncol 2013, 31: 2152-2159.
Dudley ME, Yang JC, Sherry R, Hughes MS, Royal R, Kammula U, Robbins PF, Huang J, Citrin
DE, Leitman SF, Wunderlich J, Restifo NP, Thomasian A, Downey SG, Smith FO, Klapper J,
Morton K, Laurencot C, White DE, Rosenberg SA. Adoptive cell therapy for patients with
metastatic melanoma: evaluation of intensive myeloablative chemoradiation preparative
regimens. J Clin Oncol 2008, 26: 5233-5239.
Dummer R, Eichmuller S, Gellrich S, Assaf C, Dreno B, Schiller M, Dereure O, Baudard M,
Bagot M, Khammari A, Bleuzen P, Bataille V, Derbij A, Wiedemann N, Waterboer T, Lusky M,
Acres B, Urosevic-Maiwald M. Phase II clinical trial of intratumoral application of TG1042
(adenovirus-interferon-gamma) in patients with advanced cutaneous T-cell lymphomas and
multilesional cutaneous B-cell lymphomas. Mol Ther 2010, 18: 1244-1247.
Dummer R, Hassel JC, Fellenberg F, Eichmuller S, Maier T, Slos P, Acres B, Bleuzen P, Bataille
V, Squiban P, Burg G, Urosevic M. Adenovirus-mediated intralesional interferon-gamma gene
transfer induces tumor regressions in cutaneous lymphomas. Blood 2004, 104: 1631-1638.
Dummer R, Rochlitz C, Velu T, Acres B, Limacher JM, Bleuzen P, Lacoste G, Slos P, Romero
P, Urosevic M. Intralesional adenovirus-mediated interleukin-2 gene transfer for advanced solid
cancers and melanoma. Mol Ther 2008, 16: 985-994.
Dunn GP, Bruce AT, Ikeda H, Old LJ, Schreiber RD. Cancer immunoediting: from
immunosurveillance to tumor escape. Nat Immunol 2002, 3: 991-998.
Dunn GP, Old LJ, Schreiber RD. The three Es of cancer immunoediting. Annu Rev Immunol
2004, 22: 329-360.
Duval L, Schmidt H, Kaltoft K, Fode K, Jensen JJ, Sorensen SM, Nishimura MI, von der Maase
H. Adoptive transfer of allogeneic cytotoxic T lymphocytes equipped with a HLA-A2 restricted
MART-1 T-cell receptor: a phase I trial in metastatic melanoma. Clin Cancer Res 2006, 12: 12291236.
Eggermont AM, de Wilt JH, ten Hagen TL. Current uses of isolated limb perfusion in the clinic
and a model system for new strategies. Lancet Oncol 2003, 4: 429-437.
Engeland CE, Grossardt C, Veinalde R, Bossow S, Lutz D, Kaufmann JK, Shevchenko I,
Umansky V, Nettelbeck DM, Weichert W, Jager D, von Kalle C, Ungerechts G. CTLA-4 and PDL1 checkpoint blockade enhances oncolytic measles virus therapy. Mol Ther 2014, 22: 19491959.
Everts M, Curiel DT. Transductional targeting of adenoviral cancer gene therapy. Curr Gene Ther
2004, 4: 337-346.
68
Farkona S, Diamandis EP, Blasutig IM. Cancer immunotherapy: the beginning of the end of
cancer? BMC Med 2016, 14: 73-016-0623-5.
Fausther-Bovendo H, Kobinger GP. Pre-existing immunity against Ad vectors: humoral, cellular,
and innate response, what's important? Hum Vaccin Immunother 2014, 10: 2875-2884.
Fejer G, Freudenberg M, Greber UF, Gyory I. Adenovirus-triggered innate signalling pathways.
Eur J Microbiol Immunol (Bp) 2011, 1: 279-288.
Freeman GJ, Long AJ, Iwai Y, Bourque K, Chernova T, Nishimura H, Fitz LJ, Malenkovich N,
Okazaki T, Byrne MC, Horton HF, Fouser L, Carter L, Ling V, Bowman MR, Carreno BM,
Collins M, Wood CR, Honjo T. Engagement of the PD-1 immunoinhibitory receptor by a novel
B7 family member leads to negative regulation of lymphocyte activation. J Exp Med 2000, 192:
1027-1034.
Freytag SO, Movsas B, Aref I, Stricker H, Peabody J, Pegg J, Zhang Y, Barton KN, Brown SL,
Lu M, Savera A, Kim JH. Phase I trial of replication-competent adenovirus-mediated suicide gene
therapy combined with IMRT for prostate cancer. Mol Ther 2007, 15: 1016-1023.
Freytag SO, Stricker H, Lu M, Elshaikh M, Aref I, Pradhan D, Levin K, Kim JH, Peabody J,
Siddiqui F, Barton K, Pegg J, Zhang Y, Cheng J, Oja-Tebbe N, Bourgeois R, Gupta N, Lane Z,
Rodriguez R, DeWeese T, Movsas B. Prospective randomized phase 2 trial of intensity modulated
radiation therapy with or without oncolytic adenovirus-mediated cytotoxic gene therapy in
intermediate-risk prostate cancer. Int J Radiat Oncol Biol Phys 2014, 89: 268-276.
Fridman WH, Pages F, Sautes-Fridman C, Galon J. The immune contexture in human tumours:
impact on clinical outcome. Nat Rev Cancer 2012, 12: 298-306.
Fueyo J, Gomez-Manzano C, Alemany R, Lee PS, McDonnell TJ, Mitlianga P, Shi YX, Levin
VA, Yung WK, Kyritsis AP. A mutant oncolytic adenovirus targeting the Rb pathway produces
anti-glioma effect in vivo. Oncogene 2000, 19: 2-12.
Fujita K, Ikarashi H, Takakuwa K, Kodama S, Tokunaga A, Takahashi T, Tanaka K. Prolonged
disease-free period in patients with advanced epithelial ovarian cancer after adoptive transfer of
tumor-infiltrating lymphocytes. Clin Cancer Res 1995, 1: 501-507.
Galluzzi L, Senovilla L, Zitvogel L, Kroemer G. The secret ally: immunostimulation by anticancer
drugs. Nat Rev Drug Discov 2012, 11: 215-233.
Gattinoni L, Finkelstein SE, Klebanoff CA, Antony PA, Palmer DC, Spiess PJ, Hwang LN, Yu
Z, Wrzesinski C, Heimann DM, Surh CD, Rosenberg SA, Restifo NP. Removal of homeostatic
cytokine sinks by lymphodepletion enhances the efficacy of adoptively transferred tumor-specific
CD8+ T cells. J Exp Med 2005, 202: 907-912.
Ghiringhelli F, Apetoh L, Tesniere A, Aymeric L, Ma Y, Ortiz C, Vermaelen K, Panaretakis T,
Mignot G, Ullrich E, Perfettini JL, Schlemmer F, Tasdemir E, Uhl M, Genin P, Civas A, Ryffel
B, Kanellopoulos J, Tschopp J, Andre F, Lidereau R, McLaughlin NM, Haynes NM, Smyth MJ,
Kroemer G, Zitvogel L. Activation of the NLRP3 inflammasome in dendritic cells induces IL1beta-dependent adaptive immunity against tumors. Nat Med 2009, 15: 1170-1178.
69
Ghiringhelli F, Menard C, Puig PE, Ladoire S, Roux S, Martin F, Solary E, Le Cesne A, Zitvogel
L, Chauffert B. Metronomic cyclophosphamide regimen selectively depletes CD4+CD25+
regulatory T cells and restores T and NK effector functions in end stage cancer patients. Cancer
Immunol Immunother 2007, 56: 641-648.
Giraud B, Hebert G, Deroussent A, Veal GJ, Vassal G, Paci A. Oxazaphosphorines: new
therapeutic strategies for an old class of drugs. Expert Opin Drug Metab Toxicol 2010, 6: 919938.
Glasgow JN, Everts M, Curiel DT. Transductional targeting of adenovirus vectors for gene
therapy. Cancer Gene Ther 2006, 13: 830-844.
Gleave ME, Elhilali M, Fradet Y, Davis I, Venner P, Saad F, Klotz LH, Moore MJ, Paton V,
Bajamonde A. Interferon gamma-1b compared with placebo in metastatic renal-cell carcinoma.
Canadian Urologic Oncology Group. N Engl J Med 1998, 338: 1265-1271.
Golden EB, Chhabra A, Chachoua A, Adams S, Donach M, Fenton-Kerimian M, Friedman K,
Ponzo F, Babb JS, Goldberg J, Demaria S, Formenti SC. Local radiotherapy and granulocytemacrophage colony-stimulating factor to generate abscopal responses in patients with metastatic
solid tumours: a proof-of-principle trial. Lancet Oncol 2015, 16: 795-803.
Griesche N, Zikos D, Witkowski P, Nitsche A, Ellerbrok H, Spiller OB, Pauli G, Biere B. Growth
characteristics of human adenoviruses on porcine cell lines. Virology 2008, 373: 400-410.
Gross G, Waks T, Eshhar Z. Expression of immunoglobulin-T-cell receptor chimeric molecules
as functional receptors with antibody-type specificity. Proc Natl Acad Sci U S A 1989, 86: 1002410028.
Grupp SA, Kalos M, Barrett D, Aplenc R, Porter DL, Rheingold SR, Teachey DT, Chew A, Hauck
B, Wright JF, Milone MC, Levine BL, June CH. Chimeric antigen receptor-modified T cells for
acute lymphoid leukemia. N Engl J Med 2013, 368: 1509-1518.
Guo ZS, Liu Z, Bartlett DL. Oncolytic Immunotherapy: Dying the Right Way is a Key to Eliciting
Potent Antitumor Immunity. Front Oncol 2014, 4: 74.
Guse K, Ranki T, Ala-Opas M, Bono P, Sarkioja M, Rajecki M, Kanerva A, Hakkarainen T,
Hemminki A. Treatment of metastatic renal cancer with capsid-modified oncolytic adenoviruses.
Mol Cancer Ther 2007, 6: 2728-2736.
Halbert DN, Cutt JR, Shenk T. Adenovirus early region 4 encodes functions required for efficient
DNA replication, late gene expression, and host cell shutoff. J Virol 1985, 56: 250-257.
Harlin H, Meng Y, Peterson AC, Zha Y, Tretiakova M, Slingluff C, McKee M, Gajewski TF.
Chemokine expression in melanoma metastases associated with CD8+ T-cell recruitment. Cancer
Res 2009, 69: 3077-3085.
Hartman ZC, Appledorn DM, Amalfitano A. Adenovirus vector induced innate immune
responses: impact upon efficacy and toxicity in gene therapy and vaccine applications. Virus Res
2008, 132: 1-14.
70
Hay RT, Freeman A, Leith I, Monaghan A, Webster A. Molecular interactions during adenovirus
DNA replication. Curr Top Microbiol Immunol 1995, 199 ( Pt 2): 31-48.
Hedley SJ, Chen J, Mountz JD, Li J, Curiel DT, Korokhov N, Kovesdi I. Targeted and shielded
adenovectors for cancer therapy. Cancer Immunol Immunother 2006, 55: 1412-1419.
Helmy KY, Patel SA, Nahas GR, Rameshwar P. Cancer immunotherapy: accomplishments to
date and future promise. Ther Deliv 2013, 4: 1307-1320.
Hemminki A. Oncolytic immunotherapy: where are we clinically? Scientifica (Cairo) 2014, 2014:
862925.
Hemminki A, Kanerva A, Liu B, Wang M, Alvarez RD, Siegal GP, Curiel DT. Modulation of
coxsackie-adenovirus receptor expression for increased adenoviral transgene expression. Cancer
Res 2003, 63: 847-853.
Hemminki O, Bauerschmitz G, Hemmi S, Lavilla-Alonso S, Diaconu I, Guse K, Koski A,
Desmond RA, Lappalainen M, Kanerva A, Cerullo V, Pesonen S, Hemminki A. Oncolytic
adenovirus based on serotype 3. Cancer Gene Ther 2011, 18: 288-296.
Hemminki O, Diaconu I, Cerullo V, Pesonen SK, Kanerva A, Joensuu T, Kairemo K, Laasonen
L, Partanen K, Kangasniemi L, Lieber A, Pesonen S, Hemminki A. Ad3-hTERT-E1A, a fully
serotype 3 oncolytic adenovirus, in patients with chemotherapy refractory cancer. Mol Ther 2012,
20: 1821-1830.
Hemminki O, Immonen R, Narvainen J, Kipar A, Paasonen J, Jokivarsi KT, Yli-Ollila H, Soininen
P, Partanen K, Joensuu T, Parvianen S, Pesonen SK, Koski A, Vaha-Koskela M, Cerullo V,
Pesonen S, Grohn OH, Hemminki A. In vivo magnetic resonance imaging and spectroscopy
identifies oncolytic adenovirus responders. Int J Cancer 2014, 134: 2878-2890.
Hemminki O, Parviainen S, Juhila J, Turkki R, Linder N, Lundin J, Kankainen M, Ristimaki A,
Koski A, Liikanen I, Oksanen M, Nettelbeck DM, Kairemo K, Partanen K, Joensuu T, Kanerva
A, Hemminki A. Immunological data from cancer patients treated with Ad5/3-E2F-Delta24GMCSF suggests utility for tumor immunotherapy. Oncotarget 2015, 6: 4467-4481.
Herman JM, Wild AT, Wang H, Tran PT, Chang KJ, Taylor GE, Donehower RC, Pawlik TM,
Ziegler MA, Cai H, Savage DT, Canto MI, Klapman J, Reid T, Shah RJ, Hoffe SE, Rosemurgy
A, Wolfgang CL, Laheru DA. Randomized phase III multi-institutional study of TNFerade
biologic with fluorouracil and radiotherapy for locally advanced pancreatic cancer: final results.
J Clin Oncol 2013, 31: 886-894.
Hershkovitz L, Schachter J, Treves AJ, Besser MJ. Focus on adoptive T cell transfer trials in
melanoma. Clin Dev Immunol 2010, 2010: 260267.
Hicklin DJ, Marincola FM, Ferrone S. HLA class I antigen downregulation in human cancers: Tcell immunotherapy revives an old story. Mol Med Today 1999, 5: 178-186.
Hirvinen M, Rajecki M, Kapanen M, Parviainen S, Rouvinen-Lagerstrom N, Diaconu I,
Nokisalmi P, Tenhunen M, Hemminki A, Cerullo V. Immunological effects of a tumor necrosis
factor alpha-armed oncolytic adenovirus. Hum Gene Ther 2015, 26: 134-144.
71
Hogquist KA, Jameson SC, Heath WR, Howard JL, Bevan MJ, Carbone FR. T cell receptor
antagonist peptides induce positive selection. Cell 1994, 76: 17-27.
Hombach A, Wieczarkowiecz A, Marquardt T, Heuser C, Usai L, Pohl C, Seliger B, Abken H.
Tumor-specific T cell activation by recombinant immunoreceptors: CD3 zeta signaling and CD28
costimulation are simultaneously required for efficient IL-2 secretion and can be integrated into
one combined CD28/CD3 zeta signaling receptor molecule. J Immunol 2001, 167: 6123-6131.
Hombach AA, Abken H. Costimulation by chimeric antigen receptors revisited the T cell
antitumor response benefits from combined CD28-OX40 signalling. Int J Cancer 2011, 129:
2935-2944.
Hong H, Brown CE, Ostberg JR, Priceman SJ, Chang WC, Weng L, Lin P, Wakabayashi MT,
Jensen MC, Forman SJ. L1 Cell Adhesion Molecule-Specific Chimeric Antigen ReceptorRedirected Human T Cells Exhibit Specific and Efficient Antitumor Activity against Human
Ovarian Cancer in Mice. PLoS One 2016, 11: e0146885.
Hoos A. Evolution of end points for cancer immunotherapy trials. Ann Oncol 2012, 23 Suppl 8:
viii47-52.
Idorn M, Thor Straten P, Svane IM, Met O. Transfection of Tumor-Infiltrating T Cells with
mRNA Encoding CXCR2. Methods Mol Biol 2016, 1428: 261-276.
Ilett EJ, Barcena M, Errington-Mais F, Griffin S, Harrington KJ, Pandha HS, Coffey M, Selby PJ,
Limpens RW, Mommaas M, Hoeben RC, Vile RG, Melcher AA. Internalization of oncolytic
reovirus by human dendritic cell carriers protects the virus from neutralization. Clin Cancer Res
2011, 17: 2767-2776.
Inoue H, Tani K. Multimodal immunogenic cancer cell death as a consequence of anticancer
cytotoxic treatments. Cell Death Differ 2013,
Itzhaki O, Hovav E, Ziporen Y, Levy D, Kubi A, Zikich D, Hershkovitz L, Treves AJ, Shalmon
B, Zippel D, Markel G, Shapira-Frommer R, Schachter J, Besser MJ. Establishment and largescale expansion of minimally cultured "young" tumor infiltrating lymphocytes for adoptive
transfer therapy. J Immunother 2011, 34: 212-220.
Jin J, Sabatino M, Somerville R, Wilson JR, Dudley ME, Stroncek DF, Rosenberg SA. Simplified
method of the growth of human tumor infiltrating lymphocytes in gas-permeable flasks to
numbers needed for patient treatment. J Immunother 2012, 35: 283-292.
Jogler C, Hoffmann D, Theegarten D, Grunwald T, Uberla K, Wildner O. Replication properties
of human adenovirus in vivo and in cultures of primary cells from different animal species. J Virol
2006, 80: 3549-3558.
Johnson LA, Morgan RA, Dudley ME, Cassard L, Yang JC, Hughes MS, Kammula US, Royal
RE, Sherry RM, Wunderlich JR, Lee CC, Restifo NP, Schwarz SL, Cogdill AP, Bishop RJ, Kim
H, Brewer CC, Rudy SF, VanWaes C, Davis JL, Mathur A, Ripley RT, Nathan DA, Laurencot
CM, Rosenberg SA. Gene therapy with human and mouse T-cell receptors mediates cancer
regression and targets normal tissues expressing cognate antigen. Blood 2009, 114: 535-546.
72
Judson I, Verweij J, Gelderblom H, Hartmann JT, Schoffski P, Blay JY, Kerst JM, Sufliarsky J,
Whelan J, Hohenberger P, Krarup-Hansen A, Alcindor T, Marreaud S, Litiere S, Hermans C,
Fisher C, Hogendoorn PC, dei Tos AP, van der Graaf WT, European Organisation and Treatment
of Cancer Soft Tissue and Bone Sarcoma Group. Doxorubicin alone versus intensified
doxorubicin plus ifosfamide for first-line treatment of advanced or metastatic soft-tissue sarcoma:
a randomised controlled phase 3 trial. Lancet Oncol 2014, 15: 415-423.
Junker N, Andersen MH, Wenandy L, Dombernowsky SL, Kiss K, Sorensen CH, Therkildsen
MH, Von Buchwald C, Andersen E, Straten PT, Svane IM. Bimodal ex vivo expansion of T cells
from patients with head and neck squamous cell carcinoma: a prerequisite for adoptive cell
transfer. Cytotherapy 2011, 13: 822-834.
Kali A. TNFerade, an innovative cancer immunotherapeutic. Indian J Pharmacol 2015, 47: 479483.
Kalos M, June CH. Adoptive T cell transfer for cancer immunotherapy in the era of synthetic
biology. Immunity 2013, 39: 49-60.
Kamphorst AO, Ahmed R. CD4 T-cell immunotherapy for chronic viral infections and cancer.
Immunotherapy 2013, 5: 975-987.
Kanerva A, Lavilla-Alonso S, Raki M, Kangasniemi L, Bauerschmitz GJ, Takayama K, Ristimaki
A, Desmond RA, Hemminki A. Systemic therapy for cervical cancer with potentially regulatable
oncolytic adenoviruses. PLoS One 2008, 3: e2917.
Kanerva A, Mikheeva GV, Krasnykh V, Coolidge CJ, Lam JT, Mahasreshti PJ, Barker SD,
Straughn M, Barnes MN, Alvarez RD, Hemminki A, Curiel DT. Targeting adenovirus to the
serotype 3 receptor increases gene transfer efficiency to ovarian cancer cells. Clin Cancer Res
2002, 8: 275-280.
Kanerva A, Nokisalmi P, Diaconu I, Koski A, Cerullo V, Liikanen I, Tähtinen S, Oksanen M,
Heiskanen R, Pesonen S, Joensuu T, Alanko T, Partanen K, Laasonen L, Kairemo K, Pesonen S,
Kangasniemi L, Hemminki A. Antiviral and antitumor T-cell immunity in patients treated with
GM-CSF-coding oncolytic adenovirus. Clin Cancer Res 2013, 19: 2734-2744.
Kanerva A, Zinn KR, Chaudhuri TR, Lam JT, Suzuki K, Uil TG, Hakkarainen T, Bauerschmitz
GJ, Wang M, Liu B, Cao Z, Alvarez RD, Curiel DT, Hemminki A. Enhanced therapeutic efficacy
for ovarian cancer with a serotype 3 receptor-targeted oncolytic adenovirus. Mol Ther 2003, 8:
449-458.
Kanerva A, Zinn KR, Peng KW, Ranki T, Kangasniemi L, Chaudhuri TR, Desmond RA, Wang
M, Takayama K, Hakkarainen T, Alfthan H, Stenman UH, Curiel DT, Hemminki A. Noninvasive
dual modality in vivo monitoring of the persistence and potency of a tumor targeted conditionally
replicating adenovirus. Gene Ther 2005, 12: 87-94.
Kangasniemi L, Kiviluoto T, Kanerva A, Raki M, Ranki T, Sarkioja M, Wu H, Marini F,
Hockerstedt K, Isoniemi H, Alfthan H, Stenman UH, Curiel DT, Hemminki A. Infectivityenhanced adenoviruses deliver efficacy in clinical samples and orthotopic models of disseminated
gastric cancer. Clin Cancer Res 2006, 12: 3137-3144.
73
Kepp O, Senovilla L, Vitale I, Vacchelli E, Adjemian S, Agostinis P, Apetoh L, Aranda F,
Barnaba V, Bloy N, Bracci L, Breckpot K, Brough D, Buque A, Castro MG, Cirone M, Colombo
MI, Cremer I, Demaria S, Dini L, Eliopoulos AG, Faggioni A, Formenti SC, Fucikova J, Gabriele
L, Gaipl US, Galon J, Garg A, Ghiringhelli F, Giese NA, Guo ZS, Hemminki A, Herrmann M,
Hodge JW, Holdenrieder S, Honeychurch J, Hu HM, Huang X, Illidge TM, Kono K, Korbelik M,
Krysko DV, Loi S, Lowenstein PR, Lugli E, Ma Y, Madeo F, Manfredi AA, Martins I, Mavilio
D, Menger L, Merendino N, Michaud M, Mignot G, Mossman KL, Multhoff G, Oehler R,
Palombo F, Panaretakis T, Pol J, Proietti E, Ricci JE, Riganti C, Rovere-Querini P, Rubartelli A,
Sistigu A, Smyth MJ, Sonnemann J, Spisek R, Stagg J, Sukkurwala AQ, Tartour E, Thorburn A,
Thorne SH, Vandenabeele P, Velotti F, Workenhe ST, Yang H, Zong WX, Zitvogel L, Kroemer
G, Galluzzi L. Consensus guidelines for the detection of immunogenic cell death.
Oncoimmunology 2014, 3: e955691.
Kershaw MH, Westwood JA, Parker LL, Wang G, Eshhar Z, Mavroukakis SA, White DE,
Wunderlich JR, Canevari S, Rogers-Freezer L, Chen CC, Yang JC, Rosenberg SA, Hwu P. A
phase I study on adoptive immunotherapy using gene-modified T cells for ovarian cancer. Clin
Cancer Res 2006, 12: 6106-6115.
Khammari A, Nguyen JM, Saint-Jean M, Knol AC, Pandolfino MC, Quereux G, Brocard A,
Peuvrel L, Saiagh S, Bataille V, Limacher JM, Dreno B. Adoptive T cell therapy combined with
intralesional administrations of TG1042 (adenovirus expressing interferon-gamma) in metastatic
melanoma patients. Cancer Immunol Immunother 2015, 64: 805-815.
Kim J, Lee B, Kim JS, Yun CO, Kim JH, Lee YJ, Joo CH, Lee H. Antitumoral effects of
recombinant adenovirus YKL-1001, conditionally replicating in alpha-fetoprotein-producing
human liver cancer cells. Cancer Lett 2002, 180: 23-32.
Kim KH, Dmitriev IP, Saddekni S, Kashentseva EA, Harris RD, Aurigemma R, Bae S, Singh KP,
Siegal GP, Curiel DT, Alvarez RD. A phase I clinical trial of Ad5/3-Delta24, a novel serotypechimeric, infectivity-enhanced, conditionally-replicative adenovirus (CRAd), in patients with
recurrent ovarian cancer. Gynecol Oncol 2013, 130: 518-524.
Kimball KJ, Preuss MA, Barnes MN, Wang M, Siegal GP, Wan W, Kuo H, Saddekni S, Stockard
CR, Grizzle WE, Harris RD, Aurigemma R, Curiel DT, Alvarez RD. A phase I study of a tropismmodified conditionally replicative adenovirus for recurrent malignant gynecologic diseases. Clin
Cancer Res 2010, 16: 5277-5287.
Kleeff J, Ishiwata T, Kumbasar A, Friess H, Buchler MW, Lander AD, Korc M. The cell-surface
heparan sulfate proteoglycan glypican-1 regulates growth factor action in pancreatic carcinoma
cells and is overexpressed in human pancreatic cancer. J Clin Invest 1998, 102: 1662-1673.
Kochenderfer JN, Dudley ME, Feldman SA, Wilson WH, Spaner DE, Maric I, Stetler-Stevenson
M, Phan GQ, Hughes MS, Sherry RM, Yang JC, Kammula US, Devillier L, Carpenter R, Nathan
DA, Morgan RA, Laurencot C, Rosenberg SA. B-cell depletion and remissions of malignancy
along with cytokine-associated toxicity in a clinical trial of anti-CD19 chimeric-antigen-receptortransduced T cells. Blood 2012, 119: 2709-2720.
Kodumudi KN, Siegel J, Weber AM, Scott E, Sarnaik AA, Pilon-Thomas S. Immune Checkpoint
Blockade to Improve Tumor Infiltrating Lymphocytes for Adoptive Cell Therapy. PLoS One
2016, 11: e0153053.
74
Koks CA, Garg AD, Ehrhardt M, Riva M, Vandenberk L, Boon L, De Vleeschouwer S, Agostinis
P, Graf N, Van Gool SW. Newcastle disease virotherapy induces long-term survival and tumorspecific immune memory in orthotopic glioma through the induction of immunogenic cell death.
Int J Cancer 2015, 136: E313-25.
Korkmaz A, Topal T, Oter S. Pathophysiological aspects of cyclophosphamide and ifosfamide
induced hemorrhagic cystitis; implication of reactive oxygen and nitrogen species as well as
PARP activation. Cell Biol Toxicol 2007, 23: 303-312.
Koski A, Bramante S, Kipar A, Oksanen M, Juhila J, Vassilev L, Joensuu T, Kanerva A,
Hemminki A. Biodistribution Analysis of Oncolytic Adenoviruses in Patient Autopsy Samples
Reveals Vascular Transduction of Noninjected Tumors and Tissues. Mol Ther 2015, 23: 16411652.
Koski A, Kangasniemi L, Escutenaire S, Pesonen S, Cerullo V, Diaconu I, Nokisalmi P, Raki M,
Rajecki M, Guse K, Ranki T, Oksanen M, Holm SL, Haavisto E, Karioja-Kallio A, Laasonen L,
Partanen K, Ugolini M, Helminen A, Karli E, Hannuksela P, Pesonen S, Joensuu T, Kanerva A,
Hemminki A. Treatment of cancer patients with a serotype 5/3 chimeric oncolytic adenovirus
expressing GMCSF. Mol Ther 2010, 18: 1874-1884.
Krasnykh VN, Mikheeva GV, Douglas JT, Curiel DT. Generation of recombinant adenovirus
vectors with modified fibers for altering viral tropism. J Virol 1996, 70: 6839-6846.
Kunz AN, Ottolini M. The role of adenovirus in respiratory tract infections. Curr Infect Dis Rep
2010, 12: 81-87.
Kuryk L, Haavisto E, Garofalo M, Capasso C, Hirvinen M, Pesonen S, Ranki T, Vassilev L,
Cerullo V. Synergistic anti-tumor efficacy of immunogenic adenovirus ONCOS-102 (Ad5/3D24-GM-CSF) and standard of care chemotherapy in preclinical mesothelioma model. Int J
Cancer 2016,
Kwon OJ, Kim PH, Huyn S, Wu L, Kim M, Yun CO. A hypoxia- and {alpha}-fetoproteindependent oncolytic adenovirus exhibits specific killing of hepatocellular carcinomas. Clin
Cancer Res 2010, 16: 6071-6082.
Larkin J, Chiarion-Sileni V, Gonzalez R, Grob JJ, Cowey CL, Lao CD, Schadendorf D, Dummer
R, Smylie M, Rutkowski P, Ferrucci PF, Hill A, Wagstaff J, Carlino MS, Haanen JB, Maio M,
Marquez-Rodas I, McArthur GA, Ascierto PA, Long GV, Callahan MK, Postow MA, Grossmann
K, Sznol M, Dreno B, Bastholt L, Yang A, Rollin LM, Horak C, Hodi FS, Wolchok JD. Combined
Nivolumab and Ipilimumab or Monotherapy in Untreated Melanoma. N Engl J Med 2015, 373:
23-34.
Law LK, Davidson BL. What does it take to bind CAR? Mol Ther 2005, 12: 599-609.
Lawler SE, Speranza MC, Cho CF, Chiocca EA. Oncolytic Viruses in Cancer Treatment: A
Review. JAMA Oncol 2016,
Lee DW, Kochenderfer JN, Stetler-Stevenson M, Cui YK, Delbrook C, Feldman SA, Fry TJ,
Orentas R, Sabatino M, Shah NN, Steinberg SM, Stroncek D, Tschernia N, Yuan C, Zhang H,
Zhang L, Rosenberg SA, Wayne AS, Mackall CL. T cells expressing CD19 chimeric antigen
75
receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 doseescalation trial. Lancet 2015, 385: 517-528.
Lee S, Margolin K. Tumor-infiltrating lymphocytes in melanoma. Curr Oncol Rep 2012, 14: 468474.
Lehmberg E, Traina JA, Chakel JA, Chang RJ, Parkman M, McCaman MT, Murakami PK,
Lahidji V, Nelson JW, Hancock WS, Nestaas E, Pungor E,Jr. Reversed-phase high-performance
liquid chromatographic assay for the adenovirus type 5 proteome. J Chromatogr B Biomed Sci
Appl 1999, 732: 411-423.
Lenaerts L, Verbeken E, De Clercq E, Naesens L. Mouse adenovirus type 1 infection in SCID
mice: an experimental model for antiviral therapy of systemic adenovirus infections. Antimicrob
Agents Chemother 2005, 49: 4689-4699.
Letourneur F, Klausner RD. T-cell and basophil activation through the cytoplasmic tail of T-cellreceptor zeta family proteins. Proc Natl Acad Sci U S A 1991, 88: 8905-8909.
Li Y, Chen Y, Dilley J, Arroyo T, Ko D, Working P, Yu DC. Carcinoembryonic antigenproducing cell-specific oncolytic adenovirus, OV798, for colorectal cancer therapy. Mol Cancer
Ther 2003, 2: 1003-1009.
Li Y, Yu DC, Chen Y, Amin P, Zhang H, Nguyen N, Henderson DR. A hepatocellular carcinomaspecific adenovirus variant, CV890, eliminates distant human liver tumors in combination with
doxorubicin. Cancer Res 2001, 61: 6428-6436.
Liang M. Clinical development of oncolytic viruses in China. Curr Pharm Biotechnol 2012, 13:
1852-1857.
Liikanen I, Ahtiainen L, Hirvinen ML, Bramante S, Cerullo V, Nokisalmi P, Hemminki O,
Diaconu I, Pesonen S, Koski A, Kangasniemi L, Pesonen SK, Oksanen M, Laasonen L, Partanen
K, Joensuu T, Zhao F, Kanerva A, Hemminki A. Oncolytic adenovirus with temozolomide
induces autophagy and antitumor immune responses in cancer patients. Mol Ther 2013, 21: 12121223.
Liikanen I, Monsurro V, Ahtiainen L, Raki M, Hakkarainen T, Diaconu I, Escutenaire S,
Hemminki O, Dias JD, Cerullo V, Kanerva A, Pesonen S, Marzioni D, Colombatti M, Hemminki
A. Induction of interferon pathways mediates in vivo resistance to oncolytic adenovirus. Mol Ther
2011, 19: 1858-1866.
Linette GP, Stadtmauer EA, Maus MV, Rapoport AP, Levine BL, Emery L, Litzky L, Bagg A,
Carreno BM, Cimino PJ, Binder-Scholl GK, Smethurst DP, Gerry AB, Pumphrey NJ, Bennett
AD, Brewer JE, Dukes J, Harper J, Tayton-Martin HK, Jakobsen BK, Hassan NJ, Kalos M, June
CH. Cardiovascular toxicity and titin cross-reactivity of affinity-enhanced T cells in myeloma and
melanoma. Blood 2013, 122: 863-871.
Liu Y, Wang H, Yumul R, Gao W, Gambotto A, Morita T, Baker A, Shayakhmetov D, Lieber A.
Transduction of liver metastases after intravenous injection of Ad5/35 or Ad35 vectors with and
without factor X-binding protein pretreatment. Hum Gene Ther 2009, 20: 621-629.
76
Lotze MT, Chang AE, Seipp CA, Simpson C, Vetto JT, Rosenberg SA. High-dose recombinant
interleukin 2 in the treatment of patients with disseminated cancer. Responses, treatment-related
morbidity, and histologic findings. JAMA 1986, 256: 3117-3124.
Luke JJ, Donahue H, Nishino M, Giobbie-Hurder A, Davis M, Bailey N, Ott PA, Hodi FS. Single
Institution Experience of Ipilimumab 3 mg/kg with Sargramostim (GM-CSF) in Metastatic
Melanoma. Cancer Immunol Res 2015, 3: 986-991.
Maher J, Brentjens RJ, Gunset G, Riviere I, Sadelain M. Human T-lymphocyte cytotoxicity and
proliferation directed by a single chimeric TCRzeta /CD28 receptor. Nat Biotechnol 2002, 20: 7075.
Makower D, Rozenblit A, Kaufman H, Edelman M, Lane ME, Zwiebel J, Haynes H, Wadler S.
Phase II clinical trial of intralesional administration of the oncolytic adenovirus ONYX-015 in
patients with hepatobiliary tumors with correlative p53 studies. Clin Cancer Res 2003, 9: 693702.
Malhotra V, Perry MC. Classical chemotherapy: mechanisms, toxicities and the therapeutic
window. Cancer Biol Ther 2003, 2: S2-4.
Markel G, Cohen-Sinai T, Besser MJ, Oved K, Itzhaki O, Seidman R, Fridman E, Treves AJ,
Keisari Y, Dotan Z, Ramon J, Schachter J. Preclinical evaluation of adoptive cell therapy for
patients with metastatic renal cell carcinoma. Anticancer Res 2009, 29: 145-154.
Matthews K, Noker PE, Tian B, Grimes SD, Fulton R, Schweikart K, Harris R, Aurigemma R,
Wang M, Barnes MN, Siegal GP, Hemminki A, Zinn K, Curiel DT, Alvarez RD. Identifying the
safety profile of Ad5.SSTR/TK.RGD, a novel infectivity-enhanced bicistronic adenovirus, in
anticipation of a phase I clinical trial in patients with recurrent ovarian cancer. Clin Cancer Res
2009, 15: 4131-4137.
Miao H, Choi BD, Suryadevara CM, Sanchez-Perez L, Yang S, De Leon G, Sayour EJ, McLendon
R, Herndon JE,2nd, Healy P, Archer GE, Bigner DD, Johnson LA, Sampson JH. EGFRvIIIspecific chimeric antigen receptor T cells migrate to and kill tumor deposits infiltrating the brain
parenchyma in an invasive xenograft model of glioblastoma. PLoS One 2014, 9: e94281.
Mikucki ME, Fisher DT, Matsuzaki J, Skitzki JJ, Gaulin NB, Muhitch JB, Ku AW, Frelinger JG,
Odunsi K, Gajewski TF, Luster AD, Evans SS. Non-redundant requirement for CXCR3 signalling
during tumoricidal T-cell trafficking across tumour vascular checkpoints. Nat Commun 2015, 6:
7458.
Milone MC, Fish JD, Carpenito C, Carroll RG, Binder GK, Teachey D, Samanta M, Lakhal M,
Gloss B, Danet-Desnoyers G, Campana D, Riley JL, Grupp SA, June CH. Chimeric receptors
containing CD137 signal transduction domains mediate enhanced survival of T cells and increased
antileukemic efficacy in vivo. Mol Ther 2009, 17: 1453-1464.
Mittal D, Gubin MM, Schreiber RD, Smyth MJ. New insights into cancer immunoediting and its
three component phases--elimination, equilibrium and escape. Curr Opin Immunol 2014, 27: 1625.
77
Moon EK, Wang LC, Dolfi DV, Wilson CB, Ranganathan R, Sun J, Kapoor V, Scholler J, Pure
E, Milone MC, June CH, Riley JL, Wherry EJ, Albelda SM. Multifactorial T-cell hypofunction
that is reversible can limit the efficacy of chimeric antigen receptor-transduced human T cells in
solid tumors. Clin Cancer Res 2014, 20: 4262-73.
Morgan RA, Chinnasamy N, Abate-Daga D, Gros A, Robbins PF, Zheng Z, Dudley ME, Feldman
SA, Yang JC, Sherry RM, Phan GQ, Hughes MS, Kammula US, Miller AD, Hessman CJ, Stewart
AA, Restifo NP, Quezado MM, Alimchandani M, Rosenberg AZ, Nath A, Wang T, Bielekova B,
Wuest SC, Akula N, McMahon FJ, Wilde S, Mosetter B, Schendel DJ, Laurencot CM, Rosenberg
SA. Cancer regression and neurological toxicity following anti-MAGE-A3 TCR gene therapy. J
Immunother 2013, 36: 133-151.
Muck-Hausl M, Solanki M, Zhang W, Ruzsics Z, Ehrhardt A. Ad 2.0: a novel recombineering
platform for high-throughput generation of tailored adenoviruses. Nucleic Acids Res 2015, 43:
e50.
Nanda R, Chow LQ, Dees EC, Berger R, Gupta S, Geva R, Pusztai L, Pathiraja K, Aktan G,
Cheng JD, Karantza V, Buisseret L. Pembrolizumab in Patients With Advanced Triple-Negative
Breast Cancer: Phase Ib KEYNOTE-012 Study. J Clin Oncol 2016, 34: 2460-2467.
Nemerow GR, Pache L, Reddy V, Stewart PL. Insights into adenovirus host cell interactions from
structural studies. Virology 2009, 384: 380-388.
Nemunaitis J, Senzer N, Sarmiento S, Zhang YA, Arzaga R, Sands B, Maples P, Tong AW. A
phase I trial of intravenous infusion of ONYX-015 and enbrel in solid tumor patients. Cancer
Gene Ther 2007, 14: 885-893.
Nemunaitis J, Tong AW, Nemunaitis M, Senzer N, Phadke AP, Bedell C, Adams N, Zhang YA,
Maples PB, Chen S, Pappen B, Burke J, Ichimaru D, Urata Y, Fujiwara T. A phase I study of
telomerase-specific replication competent oncolytic adenovirus (telomelysin) for various solid
tumors. Mol Ther 2010, 18: 429-434.
Nettelbeck DM, Rivera AA, Balague C, Alemany R, Curiel DT. Novel oncolytic adenoviruses
targeted to melanoma: specific viral replication and cytolysis by expression of E1A mutants from
the tyrosinase enhancer/promoter. Cancer Res 2002, 62: 4663-4670.
Nghiem PT, Bhatia S, Lipson EJ, Kudchadkar RR, Miller NJ, Annamalai L, Berry S, Chartash
EK, Daud A, Fling SP, Friedlander PA, Kluger HM, Kohrt HE, Lundgren L, Margolin K, Mitchell
A, Olencki T, Pardoll DM, Reddy SA, Shantha EM, Sharfman WH, Sharon E, Shemanski LR,
Shinohara MM, Sunshine JC, Taube JM, Thompson JA, Townson SM, Yearley JH, Topalian SL,
Cheever MA. PD-1 Blockade with Pembrolizumab in Advanced Merkel-Cell Carcinoma. N Engl
J Med 2016, 374: 2542-2552.
Nicklin SA, Wu E, Nemerow GR, Baker AH. The influence of adenovirus fiber structure and
function on vector development for gene therapy. Mol Ther 2005, 12: 384-393.
Niewiesk S, Prince G. Diversifying animal models: the use of hispid cotton rats (Sigmodon
hispidus) in infectious diseases. Lab Anim 2002, 36: 357-372.
78
Nishio N, Diaconu I, Liu H, Cerullo V, Caruana I, Hoyos V, Bouchier-Hayes L, Savoldo B, Dotti
G. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T
cells in solid tumors. Cancer Res 2014, 74: 5195-5205.
Nistal-Villan E, Bunuales M, Poutou J, Gonzalez-Aparicio M, Bravo-Perez C, Quetglas JI, Carte
B, Gonzalez-Aseguinolaza G, Prieto J, Larrea E, Hernandez-Alcoceba R. Enhanced therapeutic
effect using sequential administration of antigenically distinct oncolytic viruses expressing
oncostatin M in a Syrian hamster orthotopic pancreatic cancer model. Mol Cancer 2015, 14: 210015-0479-x.
Nomi T, Sho M, Akahori T, Hamada K, Kubo A, Kanehiro H, Nakamura S, Enomoto K, Yagita
H, Azuma M, Nakajima Y. Clinical significance and therapeutic potential of the programmed
death-1 ligand/programmed death-1 pathway in human pancreatic cancer. Clin Cancer Res 2007,
13: 2151-2157.
Obeid M, Tesniere A, Ghiringhelli F, Fimia GM, Apetoh L, Perfettini JL, Castedo M, Mignot G,
Panaretakis T, Casares N, Metivier D, Larochette N, van Endert P, Ciccosanti F, Piacentini M,
Zitvogel L, Kroemer G. Calreticulin exposure dictates the immunogenicity of cancer cell death.
Nat Med 2007, 13: 54-61.
O'Riordan CR, Lachapelle A, Delgado C, Parkes V, Wadsworth SC, Smith AE, Francis GE.
PEGylation of adenovirus with retention of infectivity and protection from neutralizing antibody
in vitro and in vivo. Hum Gene Ther 1999, 10: 1349-1358.
Osaki S, Tazawa H, Hasei J, Yamakawa Y, Omori T, Sugiu K, Komatsubara T, Fujiwara T, Sasaki
T, Kunisada T, Yoshida A, Urata Y, Kagawa S, Ozaki T, Fujiwara T. Ablation of MCL1
expression by virally induced microRNA-29 reverses chemoresistance in human osteosarcomas.
Sci Rep 2016, 6: 28953.
Parviainen S, Ahonen M, Diaconu I, Hirvinen M, Karttunen A, Vaha-Koskela M, Hemminki A,
Cerullo V. CD40 ligand and tdTomato-armed vaccinia virus for induction of antitumor immune
response and tumor imaging. Gene Ther 2014, 21: 195-204.
Parviainen S, Ahonen M, Diaconu I, Kipar A, Siurala M, Vaha-Koskela M, Kanerva A, Cerullo
V, Hemminki A. GMCSF-armed vaccinia virus induces an antitumor immune response. Int J
Cancer 2015, 136: 1065-1072.
Pesonen S, Kangasniemi L, Hemminki A. Oncolytic adenoviruses for the treatment of human
cancer: focus on translational and clinical data. Mol Pharm 2011, 8: 12-28.
Pesonen S, Nokisalmi P, Escutenaire S, Sarkioja M, Raki M, Cerullo V, Kangasniemi L, Laasonen
L, Ribacka C, Guse K, Haavisto E, Oksanen M, Rajecki M, Helminen A, Ristimaki A, KariojaKallio A, Karli E, Kantola T, Bauerschmitz G, Kanerva A, Joensuu T, Hemminki A. Prolonged
systemic circulation of chimeric oncolytic adenovirus Ad5/3-Cox2L-D24 in patients with
metastatic and refractory solid tumors. Gene Ther 2010, 17: 892-904.
Pitt JM, Vetizou M, Daillere R, Roberti MP, Yamazaki T, Routy B, Lepage P, Boneca IG,
Chamaillard M, Kroemer G, Zitvogel L. Resistance Mechanisms to Immune-Checkpoint
Blockade in Cancer: Tumor-Intrinsic and -Extrinsic Factors. Immunity 2016, 44: 1255-1269.
79
Pol J, Buque A, Aranda F, Bloy N, Cremer I, Eggermont A, Erbs P, Fucikova J, Galon J, Limacher
JM, Preville X, Sautes-Fridman C, Spisek R, Zitvogel L, Kroemer G, Galluzzi L. Trial WatchOncolytic viruses and cancer therapy. Oncoimmunology 2015a, 5: e1117740.
Pol J, Vacchelli E, Aranda F, Castoldi F, Eggermont A, Cremer I, Sautes-Fridman C, Fucikova J,
Galon J, Spisek R, Tartour E, Zitvogel L, Kroemer G, Galluzzi L. Trial Watch: Immunogenic cell
death inducers for anticancer chemotherapy. Oncoimmunology 2015b, 4: e1008866.
Postow MA, Chesney J, Pavlick AC, Robert C, Grossmann K, McDermott D, Linette GP, Meyer
N, Giguere JK, Agarwala SS, Shaheen M, Ernstoff MS, Minor D, Salama AK, Taylor M, Ott PA,
Rollin LM, Horak C, Gagnier P, Wolchok JD, Hodi FS. Nivolumab and ipilimumab versus
ipilimumab in untreated melanoma. N Engl J Med 2015, 372: 2006-2017.
Poutou J, Bunuales M, Gonzalez-Aparicio M, Garcia-Aragoncillo E, Quetglas JI, Casado R,
Bravo-Perez C, Alzuguren P, Hernandez-Alcoceba R. Safety and antitumor effect of oncolytic
and helper-dependent adenoviruses expressing interleukin-12 variants in a hamster pancreatic
cancer model. Gene Ther 2015, 22: 696-706.
Preissner S, Simmaco M, Gentile G, Preissner R. Personalized Cancer Therapy Considering
Cytochrome P450 Variability. Adv Pharmacol 2015, 74: 113-130.
Prince GA, Porter DD, Jenson AB, Horswood RL, Chanock RM, Ginsberg HS. Pathogenesis of
adenovirus type 5 pneumonia in cotton rats (Sigmodon hispidus). J Virol 1993, 67: 101-111.
Puyo S, Montaudon D, Pourquier P. From old alkylating agents to new minor groove binders. Crit
Rev Oncol Hematol 2014, 89: 43-61.
Qin XQ, Tao N, Dergay A, Moy P, Fawell S, Davis A, Wilson JM, Barsoum J. Interferon-beta
gene therapy inhibits tumor formation and causes regression of established tumors in immunedeficient mice. Proc Natl Acad Sci U S A 1998, 95: 14411-14416.
Quesada J, Amato R. The molecular biology of soft-tissue sarcomas and current trends in therapy.
Sarcoma 2012, 2012: 849456.
Quetglas JI, Labiano S, Aznar MA, Bolanos E, Azpilikueta A, Rodriguez I, Casales E, SanchezPaulete AR, Segura V, Smerdou C, Melero I. Virotherapy with a Semliki Forest Virus-Based
Vector Encoding IL12 Synergizes with PD-1/PD-L1 Blockade. Cancer Immunol Res 2015, 3:
449-454.
Radvanyi LG, Bernatchez C, Zhang M, Fox PS, Miller P, Chacon J, Wu R, Lizee G, Mahoney S,
Alvarado G, Glass M, Johnson VE, McMannis JD, Shpall E, Prieto V, Papadopoulos N, Kim K,
Homsi J, Bedikian A, Hwu WJ, Patel S, Ross MI, Lee JE, Gershenwald JE, Lucci A, Royal R,
Cormier JN, Davies MA, Mansaray R, Fulbright OJ, Toth C, Ramachandran R, Wardell S,
Gonzalez A, Hwu P. Specific lymphocyte subsets predict response to adoptive cell therapy using
expanded autologous tumor-infiltrating lymphocytes in metastatic melanoma patients. Clin
Cancer Res 2012, 18: 6758-6770.
Rajani K, Parrish C, Kottke T, Thompson J, Zaidi S, Ilett L, Shim KG, Diaz RM, Pandha H,
Harrington K, Coffey M, Melcher A, Vile R. Combination Therapy With Reovirus and Anti-PD-
80
1 Blockade Controls Tumor Growth Through Innate and Adaptive Immune Responses. Mol Ther
2016, 24: 166-174.
Raki M, Kanerva A, Ristimaki A, Desmond RA, Chen DT, Ranki T, Sarkioja M, Kangasniemi L,
Hemminki A. Combination of gemcitabine and Ad5/3-Delta24, a tropism modified conditionally
replicating adenovirus, for the treatment of ovarian cancer. Gene Ther 2005, 12: 1198-1205.
Raki M, Sarkioja M, Desmond RA, Chen DT, Butzow R, Hemminki A, Kanerva A. Oncolytic
adenovirus Ad5/3-delta24 and chemotherapy for treatment of orthotopic ovarian cancer. Gynecol
Oncol 2008, 108: 166-172.
Ranki T, Joensuu T, Jager E, Karbach J, Wahle C, Kairemo K, Alanko T, Partanen K, Turkki R,
Linder N, Lundin J, Ristimaki A, Kankainen M, Hemminki A, Backman C, Dienel K, von Euler
M, Haavisto E, Hakonen T, Juhila J, Jaderberg M, Priha P, Vassilev L, Vuolanto A, Pesonen S.
Local treatment of a pleural mesothelioma tumor with ONCOS-102 induces a systemic antitumor
CD8 T-cell response, prominent infiltration of CD8 lymphocytes and Th1 type polarization.
Oncoimmunology 2014, 3: e958937.
Ranki T, Kanerva A, Ristimaki A, Hakkarainen T, Sarkioja M, Kangasniemi L, Raki M,
Laakkonen P, Goodison S, Hemminki A. A heparan sulfate-targeted conditionally replicative
adenovirus, Ad5.pk7-Delta24, for the treatment of advanced breast cancer. Gene Ther 2007, 14:
58-67.
Ranki T, Pesonen S, Hemminki A, Partanen K, Kairemo K, Alanko T, Lundin J, Linder N, Turkki
R, Ristimaki A, Jager E, Karbach J, Wahle C, Kankainen M, Backman C, von Euler M, Haavisto
E, Hakonen T, Heiskanen R, Jaderberg M, Juhila J, Priha P, Suoranta L, Vassilev L, Vuolanto A,
Joensuu T. Phase I study with ONCOS-102 for the treatment of solid tumors - an evaluation of
clinical response and exploratory analyses of immune markers. J Immunother Cancer 2016, 4: 17016-0121-5. eCollection 2016.
Ratan R, Patel SR. Chemotherapy for soft tissue sarcoma. Cancer 2016,
Reed D, Altiok S. Metastatic soft tissue sarcoma chemotherapy: an opportunity for personalized
medicine. Cancer Control 2011, 18: 188-195.
Reid T, Galanis E, Abbruzzese J, Sze D, Wein LM, Andrews J, Randlev B, Heise C, Uprichard
M, Hatfield M, Rome L, Rubin J, Kirn D. Hepatic arterial infusion of a replication-selective
oncolytic adenovirus (dl1520): phase II viral, immunologic, and clinical endpoints. Cancer Res
2002, 62: 6070-6079.
Reid TR, Freeman S, Post L, McCormick F, Sze DY. Effects of Onyx-015 among metastatic
colorectal cancer patients that have failed prior treatment with 5-FU/leucovorin. Cancer Gene
Ther 2005, 12: 673-681.
Rein DT, Breidenbach M, Nettelbeck DM, Kawakami Y, Siegal GP, Huh WK, Wang M,
Hemminki A, Bauerschmitz GJ, Yamamoto M, Adachi Y, Takayama K, Dall P, Curiel DT.
Evaluation of tissue-specific promoters in carcinomas of the cervix uteri. J Gene Med 2004, 6:
1281-1289.
81
Reynolds PN, Zinn KR, Gavrilyuk VD, Balyasnikova IV, Rogers BE, Buchsbaum DJ, Wang MH,
Miletich DJ, Grizzle WE, Douglas JT, Danilov SM, Curiel DT. A targetable, injectable adenoviral
vector for selective gene delivery to pulmonary endothelium in vivo. Mol Ther 2000, 2: 562-578.
Ribas A, Hamid O, Daud A, Hodi FS, Wolchok JD, Kefford R, Joshua AM, Patnaik A, Hwu WJ,
Weber JS, Gangadhar TC, Hersey P, Dronca R, Joseph RW, Zarour H, Chmielowski B, Lawrence
DP, Algazi A, Rizvi NA, Hoffner B, Mateus C, Gergich K, Lindia JA, Giannotti M, Li XN,
Ebbinghaus S, Kang SP, Robert C. Association of Pembrolizumab With Tumor Response and
Survival Among Patients With Advanced Melanoma. JAMA 2016, 315: 1600-1609.
Riedel S. Edward Jenner and the history of smallpox and vaccination. Proc (Bayl Univ Med Cent)
2005, 18: 21-25.
Rizvi NA, Hellmann MD, Brahmer JR, Juergens RA, Borghaei H, Gettinger S, Chow LQ, Gerber
DE, Laurie SA, Goldman JW, Shepherd FA, Chen AC, Shen Y, Nathan FE, Harbison CT, Antonia
S. Nivolumab in Combination With Platinum-Based Doublet Chemotherapy for First-Line
Treatment of Advanced Non-Small-Cell Lung Cancer. J Clin Oncol 2016,
Robbins PF, Morgan RA, Feldman SA, Yang JC, Sherry RM, Dudley ME, Wunderlich JR, Nahvi
AV, Helman LJ, Mackall CL, Kammula US, Hughes MS, Restifo NP, Raffeld M, Lee CC, Levy
CL, Li YF, El-Gamil M, Schwarz SL, Laurencot C, Rosenberg SA. Tumor regression in patients
with metastatic synovial cell sarcoma and melanoma using genetically engineered lymphocytes
reactive with NY-ESO-1. J Clin Oncol 2011, 29: 917-924.
Robert C, Thomas L, Bondarenko I, O'Day S, Weber J, Garbe C, Lebbe C, Baurain JF, Testori A,
Grob JJ, Davidson N, Richards J, Maio M, Hauschild A, Miller WH,Jr, Gascon P, Lotem M,
Harmankaya K, Ibrahim R, Francis S, Chen TT, Humphrey R, Hoos A, Wolchok JD. Ipilimumab
plus dacarbazine for previously untreated metastatic melanoma. N Engl J Med 2011, 364: 25172526.
Roberts NJ, Zhou S, Diaz LA,Jr, Holdhoff M. Systemic use of tumor necrosis factor alpha as an
anticancer agent. Oncotarget 2011, 2: 739-751.
Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW, Henderson DR. Prostate
attenuated replication competent adenovirus (ARCA) CN706: a selective cytotoxic for prostatespecific antigen-positive prostate cancer cells. Cancer Res 1997, 57: 2559-2563.
Rojas LA, Condezo GN, Olie RM, Fajardo CA, Arias-Badia M, San Martin C, Alemany R.
Albumin-binding adenoviruses circumvent pre-existing neutralizing antibodies upon systemic
delivery. J Control Release 2016, 237: 78-88.
Rosenberg SA. IL-2: the first effective immunotherapy for human cancer. J Immunol 2014, 192:
5451-5458.
Rosenberg SA, Lotze MT, Muul LM, Chang AE, Avis FP, Leitman S, Linehan WM, Robertson
CN, Lee RE, Rubin JT. A progress report on the treatment of 157 patients with advanced cancer
using lymphokine-activated killer cells and interleukin-2 or high-dose interleukin-2 alone. N Engl
J Med 1987, 316: 889-897.
82
Rosenberg SA, Lotze MT, Muul LM, Leitman S, Chang AE, Ettinghausen SE, Matory YL,
Skibber JM, Shiloni E, Vetto JT. Observations on the systemic administration of autologous
lymphokine-activated killer cells and recombinant interleukin-2 to patients with metastatic cancer.
N Engl J Med 1985, 313: 1485-1492.
Rosenberg SA, Spiess P, Lafreniere R. A new approach to the adoptive immunotherapy of cancer
with tumor-infiltrating lymphocytes. Science 1986, 233: 1318-1321.
Rosenberg SA, Yang JC, Sherry RM, Kammula US, Hughes MS, Phan GQ, Citrin DE, Restifo
NP, Robbins PF, Wunderlich JR, Morton KE, Laurencot CM, Steinberg SM, White DE, Dudley
ME. Durable complete responses in heavily pretreated patients with metastatic melanoma using
T-cell transfer immunotherapy. Clin Cancer Res 2011, 17: 4550-4557.
Rosenberg SA, Yannelli JR, Yang JC, Topalian SL, Schwartzentruber DJ, Weber JS, Parkinson
DR, Seipp CA, Einhorn JH, White DE. Treatment of patients with metastatic melanoma with
autologous tumor-infiltrating lymphocytes and interleukin 2. J Natl Cancer Inst 1994, 86: 11591166.
Rosewell Shaw A, Suzuki M. Recent advances in oncolytic adenovirus therapies for cancer. Curr
Opin Virol 2016, 21: 9-15.
Rowe WP, Huebner RJ, Gilmore LK, Parrott RH, Ward TG. Isolation of a cytopathogenic agent
from human adenoids undergoing spontaneous degeneration in tissue culture. Proc Soc Exp Biol
Med 1953, 84: 570-573.
Ruella M, June CH. Chimeric Antigen Receptor T cells for B Cell Neoplasms: Choose the Right
CAR for You. Curr Hematol Malig Rep 2016,
Russell WC. Update on adenovirus and its vectors. J Gen Virol 2000, 81: 2573-2604.
Ruzsics Z, Wagner M, Osterlehner A, Cook J, Koszinowski U, Burgert HG. Transposon-assisted
cloning and traceless mutagenesis of adenoviruses: Development of a novel vector based on
species D. J Virol 2006, 80: 8100-8113.
Saban SD, Silvestry M, Nemerow GR, Stewart PL. Visualization of alpha-helices in a 6-angstrom
resolution cryoelectron microscopy structure of adenovirus allows refinement of capsid protein
assignments. J Virol 2006, 80: 12049-12059.
Salman D, Swinden J, Barton S, Peron JM, Nabhani-Gebara S. Evaluation of the stability profile
of anticancer drugs: A review of Ifosfamide and Mesna regimen for the treatment of metastatic
soft tissue sarcoma. J Oncol Pharm Pract 2016, 22: 86-91.
Schache P, Gurlevik E, Struver N, Woller N, Malek N, Zender L, Manns M, Wirth T, Kuhnel F,
Kubicka S. VSV virotherapy improves chemotherapy by triggering apoptosis due to proteasomal
degradation of Mcl-1. Gene Ther 2009, 16: 849-861.
Schirrmacher V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A
biologic agent with potential to break therapy resistance. Expert Opin Biol Ther 2015, 15: 17571771.
83
Schmitz H, Wigand R, Heinrich W. Worldwide epidemiology of human adenovirus infections.
Am J Epidemiol 1983, 117: 455-466.
Schwartz RN, Stover L, Dutcher J. Managing toxicities of high-dose interleukin-2. Oncology
(Williston Park) 2002, 16: 11-20.
Seiwert TY, Darga T, Haraf D, Blair EA, Stenson K, Cohen EE, Salama JK, Villaflor V, Witt
ME, Lingen MW, Weichselbaum RR, Vokes EE. A phase I dose escalation study of Ad
GV.EGR.TNF.11D (TNFerade Biologic) with concurrent chemoradiotherapy in patients with
recurrent head and neck cancer undergoing reirradiation. Ann Oncol 2013, 24: 769-776.
Sherr CJ, McCormick F. The RB and p53 pathways in cancer. Cancer Cell 2002, 2: 103-112.
Skelding KA, Barry RD, Shafren DR. Enhanced oncolysis mediated by Coxsackievirus A21 in
combination with doxorubicin hydrochloride. Invest New Drugs 2012, 30: 568-581.
Smith JG, Wiethoff CM, Stewart PL, Nemerow GR. Adenovirus. Curr Top Microbiol Immunol
2010, 343: 195-224.
Sonabend AM, Ulasov IV, Han Y, Rolle CE, Nandi S, Cao D, Tyler MA, Lesniak MS.
Biodistribution of an oncolytic adenovirus after intracranial injection in permissive animals: a
comparative study of Syrian hamsters and cotton rats. Cancer Gene Ther 2009, 16: 362-372.
Spain L, Diem S, Larkin J. Management of toxicities of immune checkpoint inhibitors. Cancer
Treat Rev 2016, 44: 51-60.
Spranger S. Mechanisms of tumor escape in the context of the T-cell-inflamed and the non-Tcell-inflamed tumor microenvironment. Int Immunol 2016,
Steel JC, Morrison BJ, Mannan P, Abu-Asab MS, Wildner O, Miles BK, Yim KC, Ramanan V,
Prince GA, Morris JC. Immunocompetent syngeneic cotton rat tumor models for the assessment
of replication-competent oncolytic adenovirus. Virology 2007, 369: 131-142.
Sterman DH, Recio A, Carroll RG, Gillespie CT, Haas A, Vachani A, Kapoor V, Sun J, Hodinka
R, Brown JL, Corbley MJ, Parr M, Ho M, Pastan I, Machuzak M, Benedict W, Zhang XQ, Lord
EM, Litzky LA, Heitjan DF, June CH, Kaiser LR, Vonderheide RH, Albelda SM, Kanther M. A
phase I clinical trial of single-dose intrapleural IFN-beta gene transfer for malignant pleural
mesothelioma and metastatic pleural effusions: high rate of antitumor immune responses. Clin
Cancer Res 2007, 13: 4456-4466.
Sterman DH, Recio A, Haas AR, Vachani A, Katz SI, Gillespie CT, Cheng G, Sun J, Moon E,
Pereira L, Wang X, Heitjan DF, Litzky L, June CH, Vonderheide RH, Carroll RG, Albelda SM.
A phase I trial of repeated intrapleural adenoviral-mediated interferon-beta gene transfer for
mesothelioma and metastatic pleural effusions. Mol Ther 2010, 18: 852-860.
Stevanovic S, Draper LM, Langhan MM, Campbell TE, Kwong ML, Wunderlich JR, Dudley ME,
Yang JC, Sherry RM, Kammula US, Restifo NP, Rosenberg SA, Hinrichs CS. Complete
regression of metastatic cervical cancer after treatment with human papillomavirus-targeted
tumor-infiltrating T cells. J Clin Oncol 2015, 33: 1543-1550.
84
Stewart AK, Lassam NJ, Quirt IC, Bailey DJ, Rotstein LE, Krajden M, Dessureault S, Gallinger
S, Cappe D, Wan Y, Addison CL, Moen RC, Gauldie J, Graham FL. Adenovector-mediated gene
delivery of interleukin-2 in metastatic breast cancer and melanoma: results of a phase 1 clinical
trial. Gene Ther 1999, 6: 350-363.
Tacar O, Sriamornsak P, Dass CR. Doxorubicin: an update on anticancer molecular action,
toxicity and novel drug delivery systems. J Pharm Pharmacol 2013, 65: 157-170.
Tacken PJ, Torensma R, Figdor CG. Targeting antigens to dendritic cells in vivo. Immunobiology
2006, 211: 599-608.
Tähtinen S, Gronberg-Vaha-Koskela S, Lumen D, Merisalo-Soikkeli M, Siurala M, Airaksinen
AJ, Vaha-Koskela M, Hemminki A. Adenovirus Improves the Efficacy of Adoptive T-cell
Therapy by Recruiting Immune Cells to and Promoting Their Activity at the Tumor. Cancer
Immunol Res 2015a, 3: 915-925.
Tähtinen S, Kaikkonen S, Merisalo-Soikkeli M, Gronberg-Vaha-Koskela S, Kanerva A,
Parviainen S, Vaha-Koskela M, Hemminki A. Favorable alteration of tumor microenvironment
by immunomodulatory cytokines for efficient T-cell therapy in solid tumors. PLoS One 2015b,
10: e0131242.
Takasu A, Masui A, Hamada M, Imai T, Iwai S, Yura Y. Immunogenic cell death by oncolytic
herpes simplex virus type 1 in squamous cell carcinoma cells. Cancer Gene Ther 2016, 23: 107113.
Tao N, Gao GP, Parr M, Johnston J, Baradet T, Wilson JM, Barsoum J, Fawell SE. Sequestration
of adenoviral vector by Kupffer cells leads to a nonlinear dose response of transduction in liver.
Mol Ther 2001, 3: 28-35.
Tchitchek N, Safronetz D, Rasmussen AL, Martens C, Virtaneva K, Porcella SF, Feldmann H,
Ebihara H, Katze MG. Sequencing, annotation and analysis of the Syrian hamster (Mesocricetus
auratus) transcriptome. PLoS One 2014, 9: e112617.
Tesniere A, Apetoh L, Ghiringhelli F, Joza N, Panaretakis T, Kepp O, Schlemmer F, Zitvogel L,
Kroemer G. Immunogenic cancer cell death: a key-lock paradigm. Curr Opin Immunol 2008, 20:
504-511.
Thaci B, Ahmed AU, Ulasov IV, Tobias AL, Han Y, Aboody KS, Lesniak MS. Pharmacokinetic
study of neural stem cell-based cell carrier for oncolytic virotherapy: targeted delivery of the
therapeutic payload in an orthotopic brain tumor model. Cancer Gene Ther 2012, 19: 431-442.
Thaci B, Ulasov IV, Wainwright DA, Lesniak MS. The challenge for gene therapy: innate immune
response to adenoviruses. Oncotarget 2011, 2: 113-121.
Thomas MA, Spencer JF, La Regina MC, Dhar D, Tollefson AE, Toth K, Wold WS. Syrian
hamster as a permissive immunocompetent animal model for the study of oncolytic adenovirus
vectors. Cancer Res 2006, 66: 1270-1276.
Thomas MA, Spencer JF, Wold WS. Use of the Syrian hamster as an animal model for oncolytic
adenovirus vectors. Methods Mol Med 2007, 130: 169-183.
85
Toloza EM, Hunt K, Swisher S, McBride W, Lau R, Pang S, Rhoades K, Drake T, Belldegrun A,
Glaspy J, Economou JS. In vivo cancer gene therapy with a recombinant interleukin-2 adenovirus
vector. Cancer Gene Ther 1996, 3: 11-17.
Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, Powderly JD,
Carvajal RD, Sosman JA, Atkins MB, Leming PD, Spigel DR, Antonia SJ, Horn L, Drake CG,
Pardoll DM, Chen L, Sharfman WH, Anders RA, Taube JM, McMiller TL, Xu H, Korman AJ,
Jure-Kunkel M, Agrawal S, McDonald D, Kollia GD, Gupta A, Wigginton JM, Sznol M. Safety,
activity, and immune correlates of anti-PD-1 antibody in cancer. N Engl J Med 2012, 366: 24432454.
Toth K, Spencer JF, Tollefson AE, Kuppuswamy M, Doronin K, Lichtenstein DL, La Regina MC,
Prince GA, Wold WS. Cotton rat tumor model for the evaluation of oncolytic adenoviruses. Hum
Gene Ther 2005, 16: 139-146.
Turcotte S, Gros A, Hogan K, Tran E, Hinrichs CS, Wunderlich JR, Dudley ME, Rosenberg SA.
Phenotype and function of T cells infiltrating visceral metastases from gastrointestinal cancers
and melanoma: implications for adoptive cell transfer therapy. J Immunol 2013, 191: 2217-2225.
Uckert W, Schumacher TN. TCR transgenes and transgene cassettes for TCR gene therapy: status
in 2008. Cancer Immunol Immunother 2009, 58: 809-822.
Uusi-Kerttula H, Hulin-Curtis S, Davies J, Parker AL. Oncolytic Adenovirus: Strategies and
Insights for Vector Design and Immuno-Oncolytic Applications. Viruses 2015, 7: 6009-6042.
Vacchelli E, Aranda F, Bloy N, Buque A, Cremer I, Eggermont A, Fridman WH, Fucikova J,
Galon J, Spisek R, Zitvogel L, Kroemer G, Galluzzi L. Trial Watch-Immunostimulation with
cytokines in cancer therapy. Oncoimmunology 2015, 5: e1115942.
Vacchelli E, Eggermont A, Fridman WH, Galon J, Zitvogel L, Kroemer G, Galluzzi L. Trial
Watch: Immunostimulatory cytokines. Oncoimmunology 2013, 2: e24850.
Wang H, Li ZY, Liu Y, Persson J, Beyer I, Moller T, Koyuncu D, Drescher MR, Strauss R, Zhang
XB, Wahl JK,3rd, Urban N, Drescher C, Hemminki A, Fender P, Lieber A. Desmoglein 2 is a
receptor for adenovirus serotypes 3, 7, 11 and 14. Nat Med 2011, 17: 96-104.
Wang S, Li X, Wang P, Li H, Du X, Liu M, Huang Q, Wang Y. The efficacy of oncolytic
adenovirus is mediated by T cell responses against virus and tumor in Syrian hamster model. Clin
Cancer Res 2016,
Warming S, Costantino N, Court DL, Jenkins NA, Copeland NG. Simple and highly efficient
BAC recombineering using galK selection. Nucleic Acids Res 2005, 33: e36.
Vassilev L, Ranki T, Joensuu T, Jager E, Karbach J, Wahle C, Partanen K, Kairemo K, Alanko
T, Turkki R, Linder N, Lundin J, Ristimaki A, Kankainen M, Hemminki A, Backman C, Dienel
K, von Euler M, Haavisto E, Hakonen T, Juhila J, Jaderberg M, Priha P, Vuolanto A, Pesonen S.
Repeated intratumoral administration of ONCOS-102 leads to systemic antitumor CD8 T-cell
response and robust cellular and transcriptional immune activation at tumor site in a patient with
ovarian cancer. Oncoimmunology 2015, 4: e1017702.
86
Watanabe N, Niitsu Y, Umeno H, Kuriyama H, Neda H, Yamauchi N, Maeda M, Urushizaki I.
Toxic effect of tumor necrosis factor on tumor vasculature in mice. Cancer Res 1988, 48: 21792183.
Vaughan MM, Moore J, Riches PG, Johnston SR, A'Hern RP, Hill ME, Eisen T, Ayliffe MJ,
Thomas JM, Gore ME. GM-CSF with biochemotherapy (cisplatin, DTIC, tamoxifen, IL-2 and
interferon-alpha): a phase I trial in melanoma. Ann Oncol 2000, 11: 1183-1189.
Webb J. Effect of more than one inhibitor, antagonism, summation, and synergism. Enzyme and
metabolic inhibitors New York (NY): Academic Press 1963, p. 488-512.
Weber JS, O'Day S, Urba W, Powderly J, Nichol G, Yellin M, Snively J, Hersh E. Phase I/II study
of ipilimumab for patients with metastatic melanoma. J Clin Oncol 2008, 26: 5950-5956.
Wei X, Liu L, Wang G, Li W, Xu K, Qi H, Liu H, Shen J, Li Z, Shao J. Potent antitumor activity
of the Ad5/11 chimeric oncolytic adenovirus combined with interleukin-24 for acute myeloid
leukemia via induction of apoptosis. Oncol Rep 2015, 33: 111-118.
Weiland T, Lampe J, Essmann F, Venturelli S, Berger A, Bossow S, Berchtold S, Schulze-Osthoff
K, Lauer UM, Bitzer M. Enhanced killing of therapy-induced senescent tumor cells by oncolytic
measles vaccine viruses. Int J Cancer 2014, 134: 235-243.
Venereau E, Casalgrandi M, Schiraldi M, Antoine DJ, Cattaneo A, De Marchis F, Liu J, Antonelli
A, Preti A, Raeli L, Shams SS, Yang H, Varani L, Andersson U, Tracey KJ, Bachi A, Uguccioni
M, Bianchi ME. Mutually exclusive redox forms of HMGB1 promote cell recruitment or
proinflammatory cytokine release. J Exp Med 2012, 209: 1519-1528.
Vera JF, Brenner LJ, Gerdemann U, Ngo MC, Sili U, Liu H, Wilson J, Dotti G, Heslop HE, Leen
AM, Rooney CM. Accelerated production of antigen-specific T cells for preclinical and clinical
applications using gas-permeable rapid expansion cultureware (G-Rex). J Immunother 2010, 33:
305-315.
Verdegaal EM. Adoptive cell therapy: a highly successful individualized therapy for melanoma
with great potential for other malignancies. Curr Opin Immunol 2016, 39: 90-95.
Westphal M, Yla-Herttuala S, Martin J, Warnke P, Menei P, Eckland D, Kinley J, Kay R, Ram Z,
ASPECT Study Group. Adenovirus-mediated gene therapy with sitimagene ceradenovec
followed by intravenous ganciclovir for patients with operable high-grade glioma (ASPECT): a
randomised, open-label, phase 3 trial. Lancet Oncol 2013, 14: 823-833.
Wiemann B, Starnes CO. Coley's toxins, tumor necrosis factor and cancer research: a historical
perspective. Pharmacol Ther 1994, 64: 529-564.
Vigne E, Dedieu JF, Brie A, Gillardeaux A, Briot D, Benihoud K, Latta-Mahieu M, Saulnier P,
Perricaudet M, Yeh P. Genetic manipulations of adenovirus type 5 fiber resulting in liver tropism
attenuation. Gene Ther 2003, 10: 153-162.
Vilgelm AE, Johnson DB, Richmond A. Combinatorial approach to cancer immunotherapy:
strength in numbers. J Leukoc Biol 2016, 100: 275-290.
87
Wilkie S, Picco G, Foster J, Davies DM, Julien S, Cooper L, Arif S, Mather SJ, TaylorPapadimitriou J, Burchell JM, Maher J. Retargeting of human T cells to tumor-associated MUC1:
the evolution of a chimeric antigen receptor. J Immunol 2008, 180: 4901-4909.
Vineis P, Wild CP. Global cancer patterns: causes and prevention. Lancet 2014, 383: 549-557.
Workenhe ST, Mossman KL. Oncolytic virotherapy and immunogenic cancer cell death:
sharpening the sword for improved cancer treatment strategies. Mol Ther 2014, 22: 251-256.
Wright P, Braun R, Babiuk L, Littel-van den Hurk SD, Moyana T, Zheng C, Chen Y, Xiang J.
Adenovirus-mediated TNF-alpha gene transfer induces significant tumor regression in mice.
Cancer Biother Radiopharm 1999, 14: 49-57.
Wu R, Forget MA, Chacon J, Bernatchez C, Haymaker C, Chen JQ, Hwu P, Radvanyi LG.
Adoptive T-cell therapy using autologous tumor-infiltrating lymphocytes for metastatic
melanoma: current status and future outlook. Cancer J 2012, 18: 160-175.
Yan Y, Li S, Jia T, Du X, Xu Y, Zhao Y, Li L, Liang K, Liang W, Sun H, Li R. Combined therapy
with CTL cells and oncolytic adenovirus expressing IL-15-induced enhanced antitumor activity.
Tumour Biol 2015,
Yang Z, Zhang Q, Xu K, Shan J, Shen J, Liu L, Xu Y, Xia F, Bie P, Zhang X, Cui Y, Bian XW,
Qian C. Combined therapy with cytokine-induced killer cells and oncolytic adenovirus expressing
IL-12 induce enhanced antitumor activity in liver tumor model. PLoS One 2012, 7: e44802.
Yao X, Ahmadzadeh M, Lu YC, Liewehr DJ, Dudley ME, Liu F, Schrump DS, Steinberg SM,
Rosenberg SA, Robbins PF. Levels of peripheral CD4(+)FoxP3(+) regulatory T cells are
negatively associated with clinical response to adoptive immunotherapy of human cancer. Blood
2012, 119: 5688-5696.
Ying B, Toth K, Spencer JF, Meyer J, Tollefson AE, Patra D, Dhar D, Shashkova EV,
Kuppuswamy M, Doronin K, Thomas MA, Zumstein LA, Wold WS, Lichtenstein DL. INGN 007,
an oncolytic adenovirus vector, replicates in Syrian hamsters but not mice: comparison of
biodistribution studies. Cancer Gene Ther 2009, 16: 625-637.
Zamarin D, Holmgaard RB, Subudhi SK, Park JS, Mansour M, Palese P, Merghoub T, Wolchok
JD, Allison JP. Localized oncolytic virotherapy overcomes systemic tumor resistance to immune
checkpoint blockade immunotherapy. Sci Transl Med 2014, 6: 226ra32.
Zamarin D, Pesonen S. Replication-Competent Viruses as Cancer Immunotherapeutics: Emerging
Clinical Data. Hum Gene Ther 2015, 26: 538-549.
Zhang R, Baunoch D, DeGroot LJ. Genetic immunotherapy for medullary thyroid carcinoma:
destruction of tumors in mice by in vivo delivery of adenoviral vector transducing the murine
interleukin-2 gene. Thyroid 1998, 8: 1137-1146.
Zitvogel L, Kepp O, Kroemer G. Decoding cell death signals in inflammation and immunity. Cell
2010, 140: 798-804.
88
Zivcec M, Safronetz D, Haddock E, Feldmann H, Ebihara H. Validation of assays to monitor
immune responses in the Syrian golden hamster (Mesocricetus auratus). J Immunol Methods
2011, 368: 24-35.
89
PART C
ORIGINAL PUBLICATIONS
90
71/2016 Aino Salminen
Matrix Metalloproteinase 8: Genetic, Diagnostic, and Therapeutic Approaches
72/2016 Maili Jakobson
Molecular Mechanisms Controlling Neuronal Bak Expression
73/2016 Lukasz Kuryk
Strategies to Enhance Efficacy of Oncolytic Virotherapy
74/2016 Sini Heinonen
Adipose Tissue Metabolism in Acquired Obesity
75/2016 Elina Karhu
Natural Products as a Source for Rational Antichlamydial Lead-Discovery
76/2016 Zhilin Li
Inflammatory Polarization of Immune Cells in Neurological and Neuropsychiatric Disorders
77/2016 Aino Salonsalmi
Alcohol Drinking, Health-Related Functioning and Work Disability
78/2016 Heini Wennman
Physical Activity, Sleep and Cardiovascular Diseases: Person-oriented and Longitudinal
Perspectives
79/2016 Andres Lõhmus
Helper Component-Proteinase and Coat Protein are Involved in the Molecular Processes of
Potato Virus A Translation and Replication
80/2016 Li Ma
Brain Immune Gene Network in Inbred Mouse Models of Anxiety- and Sociability-related
Neuropsychiatric Disorders
81/2016 Finny S. Varghese
Cracking the Code of Chikungunya Virus: Inhibitors as Tools to Explore Alphavirus Biology
82/2016 Vera Shirokova
Transcription Factor Foxi3 in Hair Follicle Development and Homeostasis
83/2016 Daria Bulanova
Novel Genetic Determinants of Breast Cancer Progression
84/2016 Hugh Chapman
The hERG1 (KV11.1) Potassium Channel: Its Modulation and the Functional Characterisation of
Genetic Variants
85/2016 Katja Rosti
Expression and Characterization of Neuronal Membrane Receptor Proteins
86/2016 Irepan Salvador-Martínez
Estimating Complexity and Adaptation in the Embryo: A Statistical Developmental Biology
Approach
1/2017 Essi Havula
Transcriptional Control of Dietary Sugar Metabolism and Homeostasis by Mondo-Mlx
Transcription Factors
2/2017 Satu Massinen
Specific Reading Disorder: Cellular and Neurodevelopmental Functions of
Susceptibility Genes
3/2017 Margarita Andreevskaya
Ecological Fitness and Interspecies Interactions of Food-SpoilageAssociated Lactic Acid Bacteria: Insights from the Genome Analyses and
Transcriptome Profiles
ISSN 2342-3161
ISBN 978-951-51-2834-8
dissertationes scholae doctoralis ad sanitatem investigandam
universitatis helsinkiensis
MIKKO SIURALA
Improving Adenovirus-based Immunotherapies
for Treatment of Solid Tumors
CANCER GENE THERAPY GROUP
DEPARTMENT OF ONCOLOGY
FACULTY OF MEDICINE
DOCTORAL PROGRAMME IN BIOMEDICINE
UNIVERSITY OF HELSINKI
4/2017
Helsinki 2017
MIKKO SIURALA Improving Adenovirus-based Immunotherapies for Treatment of Solid Tumors
Recent Publications in this Series
4/2017
