Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
From Gene to Protein: An exercise in breaking the code Genes (DNA) Make copies of itself New copy (RNA) is read and translated www.squidoo.com/geneticsresearch A trait is expressed VC: What is phenotype Amino acids (protein) are formed Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN 1. DNA COPIES ITSELF: Base pairings: A- T DNA molecule unzips breaking the base pairs forming 2 sides VC: DNA Replication VC: How DNA copies itself C–G Given the code of a DNA molecule, what would be the code of the new DNA strand? A: TACCGGATGCCAGATCAAATC What is the other side? __________________________ B: TACGGGGGCGTAACCACAACT What is the other side? __________________________ Given the code of a DNA molecule, what would be the code of the new DNA strand? A: TACCGGATGCCAGATCAAATC What is the other side? ATGGCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACT What is the other side? ATGCCCCCGCATTGGTGTTGA 2. CODE IS READ into RNA. The code of the new strand (DNA copy) is READ with the T replaced with a new base Uracil or U to make RNA. From #1: (DNA copy) ATGGCCTACGGTCTAGTTTAG A: ____________________________________ B: ____________________________________ 2. CODE IS READ. The code of the new strand (DNA copy) is READ with the T replaced with a new base Uracil or U. ATGGCCTACGGTCTAGTTTAG A: ____________________________________ AUGGCCUACGGUCUAGUUUAG ATGCCCCCGCATTGGTGTTGA B: ____________________________________ AUGCCCCCGCAUUGGUGUUGA VC: From DNA to protein 3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). AUGGCCUACGGUCUAGUUUAG A: ____________________________________ B: ____________________________________ 3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). AUGGCCUACGGUCUAGUUUAG A: ____________________________________ AUG GCC UAC GGU CUA GUU UAG AUGCCCCCGCAUUGGUGUUGA B: ____________________________________ AUG CCC CCG CAU UGG UGU UGA Find the Amino Acid sequence that is coded: Use the following guide. AUG GCC UAC GGU CUA GUU UAG A: ____________________________________ AMINO ACID SEQUENCE AUG GCC UAC GGU A: Methionine-Alanine-Tyrosine-GlycineCUA GUU UAG Leucine-Valine-Stop AMINO ACID SEQUENCE AUG GCC UAC GGU CUA GUU UAG A: Methionine-Alanine-Tyrosine-GlycineLeucine-Valine-Stop AUG CCC CCG CAU UGG UGU UGA B: Methionine-Proline-Proline-HistidineTryptophan-Cysteine-Stop Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN Genes( DNA) Make copies of itself New copy (RNA) is read and translated Crossover (mixing of code) www.squidoo.com/geneticsresearch A trait is expressed VC: What is phenotype Amino acids (protein) are formed