Download Self-Assembly at nano-Scale Binary

If I were a PDF in Dr Mirkin’s group
Department of Chemistry and Institute for Nanotechnology,
Northwestern University
Bio-barcode Amplification meets Nanoarray:
High throughput functional genomics and proteomics study in
single cell level
Student: Xu Zhang
3 Projects
Last ten years, our central task was
sequencing.
Manhattan
Project
The Century of the Gene
Apollo
Project
Human Genome
Project
ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCG
TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGT
CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCC
CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACT
ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCA
TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAC
ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAAC
GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGAC
TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCAC
CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCC
ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAA
GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGAC
TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCAC
CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAAC
TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAA
GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGAC
TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCAC
CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAAC
TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTG
CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTG
CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCAT
CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACT
ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCA
ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTG
CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATA
GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTT
ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTG
CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTG
A book of life:
The secret of life is hidden here…
人猿分手，屈指仅数百万年
However, very little difference between Mammalia species was found in genome sequence
In the post-genomic era
The central task for biologists is to decipher the genome
sequence
……a cat at a tag…….
Central dogma
DNA
mRNA
Protein
Gene expression is conditional
• Different tissues
• Different cells
• Different physiologic and pathologic states
• Different development phases.
So studying the conditional cell-specific gene
expression in model organisms is the main area of
interest.
The current techniques for genomics
and proteomics
• Genechip (DNA microarray, protein microarray)
• MALDI-TOF Mass spectrometry
• Polymerase Chain Reaction (PCR) based molecular
biological methods
• Molecular beacon technique
However, all these methods are not applicable for parallel studying
of gene expression in both mRNA and protein level for a single cell,
which requires ultra sensitivity, specificity, massive multiplexing
capability, and quantitative capability.
The objective of this project
Developing a high-throughput screening approach
for genomics & proteomics study in single cell
level
Based on:
• Bio-barcode amplification
• Aptamer sensing
• Fluorescent dye-doped nanoparticle labeling
• Gene Nanochip (DNA nanoarray).
The new system
Includes:
• Magnetic particles functionalized with aptamers for target
separation
• Gold nanoparticle (or polystyrene microparticles) functionalized with
aptamers for target identification
• DNA Nanochip system based on Dip-pen nanolithography and dyedoped nanoparticle probing or AFM scanning for detection
Key words : High throughput (massive multiplexing screening)
Ultra sensitivity (single molecule/cell detection)
What we have done
• Bio-barcode Amplification assay for protein detection
• Bio-barcode Amplification assay for DNA/RNA detection.
• Scanometric Assay with silver amplification
• Dip-pen Lithography (DPN)
• Nanoarray fabricating based on DPN
Bio-barcode Amplification Strategy for Protein
•
•
Each Au nanosphere carries 300 barcode DNA strands, providing amplification.
Sensitivity: Coupled with scanometric assay: 30 aM (200 copies /10 ul sample)
Coupled with PCR assay: 3 aM (20 copies /10 ul sample)
Fluorophore based BCA Strategy for Protein
A schematic of a fluorophore-based bio-barcode amplification assay.
Sensitivity: by fluroscence detection: 7 pM
Simplicity: eliminating scanometric assay, applicable for in situ detection.
Time:
90 min.
Amplification: 102 times of original BCA because 4.3x104 barcode DNA
strands per polystyrene particle.
BCA Strategy for DNA & RNA
Original BCA:
Sensitivity: by scanometric assay, 300 zM
(10 copies in 30µL sample ), comparable to PCR.
Simplicity: need three distinct oligo strands
on a single nanoparticle, which is
synthetically demanding and costly, and
limits its multiplexing capability.
High temperature for barcode DNA release
DTT based BCA:
Sensitivity: by scanometric assay, 7 aM
(60 copies in 10µL sample), less than PCR.
Simplicity: just one kind thiolated oligo
strands immobilized on a NP
Quantitative capability: improved, the
dynamic range is 7 aM- 7 fM
DTT is used for barcode DNA release
Scanometric DNA detection
• The probe strands are arrayed on a solid support and the detection strand is bound to
an Au nanosphere.
• The selectively assembled Au nanospheres then act as nucleation sites for Ag
deposition upon the chemical reduction of Ag+ from solution.
• The resulting Ag deposits can be quantified by a scanner (hence scanometric)
• The scanometric assay provides ~4 orders of magnitude of sensitivity over the
fluorescence
• At the expense of array density and throughput.
Proposed Research 1
Aptamer based nano/micro devices for massive
separation and identification of DNA/RNA/Protein
Aptamers
• synthesized single-stranded DNA or RNA oligo, 25–60 nucleotides in length
• capable of binding to various biomolecules such as amino acids, drugs, proteins, and other
biomolecules with high specificity.
•screened from a randomly generated population of DNA/RNA sequences for their ability to bind
with desired molecular targets (SELEX)
Aptamer can specifically recognize and bind any protein molecule and transforms protein’s
structural information to its sequence information.
Aptamer rivals monoclonal antibody as molecular recognition moiety:
• the hybridization conditions for aptamer- protein can be the same as DNA-DNA, while
protein-protein hybridization is different from DNA-DNA’s
• chemically synthesized, less deviation, less expenditure, easier for modification,
and more thermally stable while mAB is produced by cells, more expensive, more
variation, with no thermal stability, and difficult for modification.
Proposed Research 1
Aptamer based nano/micro devices for massive
separation and identification of DNA/RNA/Protein
Experimental work:
• Using thiolated aptamers as the probes for Au NP functionalization
• Immobilizing the aptamer strands onto the surface of the particles
(magnetic and Au particles). Both directly covalent conjugation and
biotin-avidin mediated coupling should be tried.
• Optimizing the hybridization conditions for aptamer-protein reactions .
• Testing the specificity and separation efficiency of the protein
separation based on aptamer functionalized particles.
Proposed Research 2
DNA Nanoarray based on Direct-Write DNP
•
•
•
•
Prepare the ink (DNA strands)
The paper (silicon slides)
Coat the cantilever with the ink
Scan the area for patterning in
the contact mode.
• Barcode DNA recognition.
• Detect by fluorescence
scanning with a scanner or by
AFM
• Advantages: High throughput
and ultra sensitivity, free label
screening (simplicity and
massive multiplexing)
Proposed Research 2
Nanoarray screening by AFM
Height profiles of TM-AFM cab be used for screening. The most
distinctive advantage is it suggests a label-free massive DNA
screening technique. Moreover, its high sensitivity is also critical for
the single cell detection.
Proposed Research 2
Nanoarray screening based on dye-doped
NPs
Dye-doped silica NPs:
• Uniform and controllable size (10-100 nm)
• Highly fluorescent (104 dye molecules per NP)
• Excellent signaling ability (104 dye molecules to signal a single
hybridization event ), i.e., ultra sensitivity.
• Highly photostable from photobleaching
• No need AFM, and suitable for confocal scanning.
Proposed Research 3
Application of the high throughput system for real
gene expression study in single cell level
• Tumor cell from breast tissue culture with and without the
treatment of one kind of anti-cancer drug is chosen as the
model organism
• Breast cancer related genes and proteins are chosen for
research
• Screening the mRNA profile for a single cell, here, the
condition is provided by the treatment of a special
anticancer drug.
• Screening the cancer related protein expression profile for
the same cell
• comparative study of the information obtained from these
two sets of experiments for the understanding of the
molecular mechanism for the tumor development and how
the drug works in terms of the gene expression
Summary
• This project utilizes bio-barcode amplification, aptamer
sensing, dye-doped NPs labeling, nanofabricating by
DPN, confocal scanning, and AFM for label-free DNA
screening to develop a high throughput approach with
ultra sensitivity for single molecule detection, and
investigates its application in genomics and proteomics
research.
• All these unique techniques involved in this technology
are with high sensitivity, specificity, simplicity, and
quantitative capability, and can be easily integrated to
form the high throughput methodology, which are
promising for both fundamental research and clinical
diagnosis.
Reference
Nam, J. M.; Thaxton, C. S.; Mirkin, C. A. Science, 2003, 301, 1884-1886.
Nam, J. M.; Park, S. J.; Mirkin, C. A. J. Am. Chem. Soc. 2002, 124, 3820-3821.
Nam, J. M.; Stoeva, S. I.; Mirkin, C. A. J. Am. Chem. Soc. 2004, 126, 5932-5933.
Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. Nature, 1996, 382, 607-609.
Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Science, 1997, 277, 1078-1080.
Reynolds, R. A., III; Mirkin, C. A.; Letsinger, R. L. J. Am. Chem. Soc. 2000, 122, 3795-3796.
Park, S.-J.; Lazarides, A. A.; Storhoff, J. J.; Pesce, L.; Mirkin, C. A. J. Phys. Chem. B 2004, 108, 12375-12380.
Taton, T. A.; Mirkin, C. A.; Letsinger, R. L. Science, 2000, 289, 1757-1760.
Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A.; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. Anal.
Chem. 2000, 72, 5535-5541.
Oh, B. K, ; Nam, J. M.; Lee, S. W.; Small, 2006, 2, No.1, 103-108
Thaxton, C. S.; Hill, H. D.; Georganopoulou, D. G., Stoeva, S. I.; Mirkin, C. A. Anal. Chem. 2005, 77 (24), 8174 8178.
Ellington, A.; Szostak, J. W., Nature. 1990, 346, 818–822
Robertson, D. L.; Joyce, G. F., , Nature, 1990, 344, 467–468.
Feigon, J., Dieckmann, T., and Smith, F. W. Chem. Biol. 1996, 3, 611-667
Zhao, X.; Rovelyn T. D.; Tan, W. J. Am. Chem. Soc. 2003, 125, 11474-11475
Ginger, D. S.; Zhang, H.; Mirkin, C. A. Angew. Chem., Int. Ed. 2004, 43, 30.
Demers, L. M.; Ginger, D. S.; Park, S. J.; Li, Z.; Chung, S. W.; Mirkin, C. A. Science 2002, 296, 1836.
Demers, L. M.; Park, S. J.; Taton, T. A.; Li, Z.; Mirkin, C. A. Angew. Chem., Int. Ed. 2001, 40, 3071
Lee, K.-B.; Park, S. J.; Mirkin, C. A.; Smith, J. C.; Mrksich, M. Science, 2002, 295, 1702.
Lee, K.-B.; Lim, J.-H.; Mirkin, C. A. J. Am. Chem. Soc. 2003, 125, 5588.
Lim, J.-H.; Ginger, D. S.; Lee, K. B.; Heo, J.; Nam, J-.M.; Mirkin, C. A. Angew. Chem., Int. Ed. 2003, 42, 2309.
Nam, J.-M.; Han, S. W.; Lee, K. B.; Liu, X. G.; Ratner, M. A.; Mirkin, C. A. Angew. Chem., Int. Ed. 2004, 43, 1246.
Let’s explore the secrets within life
Let’s enjoy the beauty of life sciences
Let’s enjoy the beauty of our lives
Thanks to Dr. Thomas,
Thanks to all of you.