Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Niedokończone tematy
Włodzisław Duch
Department of Informatics,
Nicolaus Copernicus University, Toruń, Poland
Google: W. Duch
KIS, 25/04/2016
Projekty na inne tematy
Neurocognitive Informatics: understanding complex cognition
=> creating algorithms that work in similar way.
•
•
•
•
•
•
•
•
•
•
Computational creativity, insight, intuition, imagery.
Imagery agnosia, amusia, musical talent.
Neurocognitive approach to language, word games.
Brain stem models & consciousness in artificial systems.
Medical information retrieval, analysis, visualization.
Comprehensive theory of autism, ADHD, phenomics, education.
Understanding neurodynamics, EEG signals, neurofeedback.
Geometric theory of brain-mind processes.
Infants: observation, guided development.
Neural determinism, free will & social consequences.
Projekty CI
Google Duch W => List of projects, talks, papers
Computational intelligence (CI), main themes:
• Understanding of data: visualization, prototype-based rules.
• Foundations of computational intelligence: transformation
based learning, k-separability, learning hard boole’an problems.
• Novel learning: projection pursuit networks, QPC (Quality of
Projected Clusters), search-based neural training, transfer
learning or learning from others (ULM), aRPM, SFM ...
• Similarity based framework for metalearning, heterogeneous
systems, new transfer functions for neural networks.
• Feature selection, extraction, creation of enhanced spaces.
• General meta-learning, or learning how to learn, deep learning.
NN - wizualizacja
28. Visualization of the hidden node activity, or hidden secrets of neural
networks. (PPT, 2.2 MB),
ICAISC Zakopane, Poland, June 2004
1. Wizualizacja funkcji NN w przestrzeni – dane + szum dają obraz w p-nie
wyjściowej, ocena wiarygodności mapowania, zbieżności, wpływu
regularyzacji, typu sieci itp. (WD).
•
•
Duch W, Internal representations of multi-layered perceptrons.
Issues in Intelligent Systems: Paradigms. 2005, pp. 49-62.
•
Duch W, Visualization of hidden node activity in neural networks: I.
Visualization methods. ICAISC 2004, LN in AI Vol. 3070 (2004) 38-43; 44-49
Cyt. 32
Więcej: http://www.is.umk.pl/projects/nnv.html
Scatterograms for hypothyroid
Shows images of training vectors mapped by
neural network; for more than 2 classes
either linear projections, or several 2D
scatterograms, or parallel coordinates.
Good for:
•
analysis of the learning process;
•
comparison of network solutions;
•
stability of the network;
•
analysis of the effects of regularization;
•
evaluation of confidence by perturbation of
the query vector.
...
Details: W. Duch, IJCNN 2003
What NN really do?
• Common opinion: NN are black boxes.
NN provide complex mappings that may involve various kinks
and discontinuities, but NN have the power!
•
Solution 1 (common): extract rules approximating NN mapings.
•
Solution 2 (new): visualize neural mapping.
RBF network for fuzzy XOR, using 4
Gaussian nodes:
rows for s=1/7,1 and 7
left column: scatterogram of the hidden
node activity in 4D.
middle columns: parallel coordinate view
right column: output view (2D)
Wine example
• MLP with 2 hidden nodes, SCG training, regularization a=0.5
•
After 3 iterations: output, parallel, hidden.
After convergence + with noise var=0.05 added
NN - wizualizacja
2. Zbieganie f. błędu w p-ni PCA dla parametrów sieci (+MK), głównie na
numerycznej wersji MLP.
• Kordos M, Duch W, Variable Step Search Training for Feedforward Neural
Networks. Neurocomputing 71(13-15), 2470-2480, 2008
• Kordos M, Duch W, A Survey of Factors Influencing MLP Error Surface.
Control and Cybernetics 33(4): 611-631, 2004
3. SVM, QPC, P-rules i inne – wizualizacje granic decyzji w 1 i 2D (+TM),
wzdłuż i ortogonalnie do hiperpłaszczyzny W.
• Duch W, Maszczyk T, Grochowski M, Optimal Support Features for MetaLearning. In: Meta-learning in Computational Intelligence, Springer 2011,
pp. 317-358.
• Maszczyk T, Duch W, Support Feature Machine for DNA microarray data.
Lecture Notes in Artificial Intelligence Vol. 6086, pp. 178-186, 2010.
Learning trajectories
• Take weights Wi from iterations i=1..K; PCA on Wi covariance
matrix captures 95-95% variance for most data, so error
function in 2D shows realistic learning trajectories.
Papers by
M. Kordos
& W. Duch
Instead of local minima large flat valleys are seen – why?
Data far from decision borders has almost no influence, the main
reduction of MSE is achieved by increasing ||W||, sharpening
sigmoidal functions.
P - rules
35. Probabilistic distance measures for prototype-based rules (PPT 0.7 MB)
Talk presented at the International Conference on Neural Information
Processing, ICONIP2005, Tipei, Taiwan, 1.11.2005
60. Computational intelligence for data understanding.
Tutorial presented at the BEST 2008 School. Warsaw, Poland, 7.07, 2008
Więcej: http://www.is.umk.pl/projects/pbr.html
Reguły oparte na prototypach są bardziej ogólne i często łatwiejsze w
interpretacji niż reguły rozmyte.
F-rules => P-rules, ale nie zawsze P-rules=>F-rules.
W szczególności jeśli mamy nieaddytywne funkcje podobieństwa, lub różne
metryki probabilistyczne VDM, i inne.
FSM to realizacja Separable Function Network.
Prototype-based rules
C-rules (Crisp), are a special case of F-rules (fuzzy rules).
F-rules (fuzzy rules) are a special case of P-rules (Prototype).
P-rules have the form:
IF P = arg minR D(X,R) THAN Class(X)=Class(P)
D(X,R) is a dissimilarity (distance) function, determining decision
borders around prototype P.
P-rules are easy to interpret!
IF
X=You are most similar to the P=Superman
THAN You are in the Super-league.
IF
X=You are most similar to the P=Weakling
THAN You are in the Failed-league.
“Similar” may involve different features or D(X,P).
P-rules
Euclidean distance leads to a Gaussian fuzzy membership functions +
product as T-norm.
D X, P d X i , Pi Wi X i - Pi
i
mP X e
- D X ,P
2
i
e
-
d X i ,Pi
i
e
-Wi X i - Pi
2
i
mi X i , Pi
i
Manhattan function => m(X;P)=exp{-|X-P|}
Various distance functions lead to different MF.
Ex. data-dependent distance functions, for symbolic data:
DVDM X, Y p C j | X i - p C j | Yi
i j
DPDF X, Y p X i | C j - p C j | Yi
i j
Promoters
DNA strings, 57 aminoacids, 53 + and 53 - samples
tactagcaatacgcttgcgttcggtggttaagtatgtataatgcgcgggcttgtcgt
Euclidean distance, symbolic
s =a, c, t, g replaced by x=1, 2, 3, 4
PDF distance, symbolic
s=a, c, t, g replaced by p(s|+)
P-rules
New distance functions from info theory => interesting MF.
MF => new distance function, with local D(X,R) for each cluster.
Crisp logic rules: use Chebyshev distance (L norm):
DCh(X,P) = ||X-P|| = maxi Wi |Xi-Pi|
DCh(X,P) = const => rectangular contours.
Chebyshev distance with thresholds P
IF DCh(X,P) P THEN C(X)=C(P)
is equivalent to a conjunctive crisp rule
IF X1[P1-P/W1,P1+P/W1] …XN [PN -P/WN,PN+P/WN]
THEN C(X)=C(P)
Decision borders
D(P,X)=const and decision borders D(P,X)=D(Q,X).
Euclidean distance from 3
prototypes, one per class.
Minkovski a=20 distance from
3 prototypes.
P-rules for Wine
Manhattan distance:
6 prototypes kept,
4 errors, f2 removed
Chebyshev distance:
15 prototypes kept, 5 errors, f2,
f8, f10 removed
Euclidean distance:
11 prototypes kept,
7 errors
Many other solutions.
SVNT
31. Support Vector Neural Training (PPT 1137 kB), ICANN'2005, September 1115, 2005
Duch W, Support Vector Neural Training. Lecture Notes in Computer Science, Vol
3697, 67-72, 2005
Selecting Support Vectors
Active learning: if contribution to the parameter change is
negligible remove the vector from training set.
Wij -
E W
Wij
K
= - Yk - M k X; W
2
M k X; W
k 1
Wij
K
If the difference e W X Yk - M k X; W
k 1
is sufficiently small the pattern X will have negligible influence on
the training process and may be removed from the training.
Conclusion: select vectors with eW(X)>emin, for training.
2 problems: possible oscillations and strong influence of outliers.
Solution: adjust emin dynamically to avoid oscillations;
remove also vectors with eW(X)>1-emin =emax
SVNT algorithm
Initialize the network parameters W,
set e=0.01, emin=0, set SV=T.
Until no improvement is found in the last Nlast iterations do
• Optimize network parameters for Nopt steps on SV data.
• Run feedforward step on T to determine overall accuracy
and errors, take SV={X|e(X) [emin,1-emin]}.
• If the accuracy increases:
compare current network with the previous best one,
choose the better one as the current best
• increase emin=emin+e and make forward step selecting SVs
• If the number of support vectors |SV| increases:
decrease eminemin-e;
decrease e = e/1.2 to avoid large changes
XOR solution
Satellite image data
Multi-spectral values of pixels in the 3x3 neighborhoods in section
82x100 of an image taken by the Landsat Multi-Spectral Scanner;
intensities = 0-255, training has 4435 samples, test 2000 samples.
Central pixel in each neighborhood is red soil (1072), cotton crop
(479), grey soil (961), damp grey soil (415), soil with vegetation
stubble (470), and very damp grey soil (1038 training samples).
Strong overlaps between some classes.
System and parameters
Train accuracy Test accuracy
SVNT MLP, 36 nodes, a=0.5
96.5
91.3
kNN, k=3, Manhattan
-90.9
SVM Gaussian kernel (optimized)
91.6
88.4
RBF, Statlog result
88.9
87.9
MLP, Statlog result
88.8
86.1
C4.5 tree
96.0
85.0
Satellite image data – MDS outputs
Hypothyroid data
2 years real medical screening tests for thyroid diseases, 3772 cases
with 93 primary hypothyroid and 191 compensated hypothyroid, the
remaining 3488 cases are healthy; 3428 test, similar class distribution.
21 attributes (15 binary, 6 continuous) are given, but only two of the
binary attributes (on thyroxine, and thyroid surgery) contain useful
information, therefore the number of attributes has been reduced to 8.
Method
C-MLP2LN rules
MLP+SCG, 4 neurons
SVM Minkovsky opt kernel
MLP+SCG, 4 neur, 67 SV
MLP+SCG, 4 neur, 45 SV
MLP+SCG, 12 neur.
Cascade correlation
MLP+backprop
SVM Gaussian kernel
% train
99.89
99.81
100.0
99.95
100.0
100.0
100.0
99.60
99.76
% test
99.36
99.24
99.18
99.01
98.92
98.83
98.5
98.5
98.4
Hypothyroid data
Discussion
SVNT is very easy to implement, here only batch version
with SCG training was used.
First step only, but promising results.
Found smaller support vector sets than SVM;
may be useful in one-class learning;
speeds up training.
Problems:
possible oscillations, selection requires more careful analysis –
but oscillations help to explore the MSE landscape;
additional parameters – but rather easy to set;
More empirical tests needed.
NN - uczenie
31. Support Vector Neural Training (PPT 1137 kB),
ICANN'2005, September 11-15, 2005
74b. Almost Random Projection Machine with Margin Maximization and
Kernel Features (PPTX 1.0 MB).
Presented at: Talk presented at the International Conference on Artificial
Neural Networks (ICANN'10), Thessaloniki, Greece, 15.09.2010.
Paper: Maszczyk T, Duch W, Almost Random Projection Machine with Margin
Maximization and Kernel Features.. Lecture Notes in Computer Science Vol.
6353, pp. 40-48, 2010
Add new kernel feature to ensure wide classification margin.
NN - uczenie
31. Support Vector Neural Training (PPT 1137 kB),
ICANN'2005, September 11-15, 2005
74b. Almost Random Projection Machine with Margin Maximization and
Kernel Features (PPTX 1.0 MB).
Presented at: Talk presented at the International Conference on Artificial
Neural Networks (ICANN'10), Thessaloniki, Greece, 15.09.2010.
Paper: Maszczyk T, Duch W, Almost Random Projection Machine with Margin
Maximization and Kernel Features.. Lecture Notes in Computer Science Vol.
6353, pp. 40-48, 2010
Maszczyk T, Duch W, Locally Optimized Kernels. LNCS 7267, pp. 412–420, 2012.
(ICAISC 2012).
Replacing the input space by a kernel-based feature space allows for mixing
various kernels and adding new types of features. We show here how to
generate locally optimized kernels that facilitate multi-resolution and can
handle complex data distributions using simpler models than the standard data
formulation may provide.
Goal of learning
If simple topological deformation of decision borders is sufficient
linear separation is possible in higher dimensional spaces,
“flattening” non-linear decision borders; this is frequently the case
in pattern recognition problems.
RBF/MLP networks with one hidden layer solve the problem.
For complex logic this is not sufficient; networks with localized
functions need exponentially large number of nodes.
Such situations arise in AI problems, real perception, object
recognition, text analysis, bioinformatics ...
Linear separation is too difficult, set an easier goal.
Linear separation: projection on 2 half-lines in the kernel space:
line y=WX, with y<0 for class – and y>0 for class +.
Simplest extension: separation into k-intervals.
For parity: find direction W with minimum # of intervals, y=W.X
k-separability
Can one learn all Boolean functions?
Problems may be classified as 2-separable (linear separability);
non separable problems may be broken into k-separable, k>2.
s(by+1)
X1
X2
y=W.X
X3
X4
Blue: sigmoidal
neurons with threshold,
brown – linear neurons.
+
1
1
s(by+2)
+
1
+
1
+
1
+
1
+
1
1
s(by+4)
Neural architecture for
k=4 intervals, or
4-separable problems.
k-sep learning
Try to find lowest k with good solution:
• Assume k=2 (linear separability), try to find a good solution;
•
MSE error criterion
E W, y X; W - C X
2
X
• if k=2 is not sufficient, try k=3; two possibilities are C+,C-,C+ and
C-, C+, C- this requires only one interval for the middle class;
• if k<4 is not sufficient, try k=4; two possibilities are C+, C-, C+, Cand C-, C+, C-, C+ this requires one closed and one open interval.
Network solution to minimization of specific cost function.
E W, 1 , 2 y X; W - C X + 1 1 - C X y X; W
2
X
X
-2 C X y X; W
X
First term = MSE, second penalty for “impure” clusters, third term =
reward for the large clusters.
A better solution?
What is needed to learn data with complex logic?
• cluster non-local areas in the X space, use W.X
• capture local clusters after transformation, use G(W.X-)
SVMs fail because the number of directions W that should be
considered grows exponentially with the size of the problem n.
What will solve it?
1. A class of constructive neural network solution with G(W.X-)
functions.
2. Maximize the leave-one-out error after projection: take localized
function G, count in a soft way cases from the same class as X.
Q W
G y X; W C X - y X '; W C X '
X ,X '
Examples: parity, monks.
Learning hard functions
Training almost perfect for parity, with linear growth in the number of
vectors for k-sep. solution created by the constructive neural algorithm.
Real data
Simple data – similar results, but much simpler models.
Locally Optimized Kernels
LOK Algorithm
LOK
Results,
simplest
version
Neurocognitive informatics
Use inspirations from the brain, derive practical algorithms!
My own attempts - see my webpage, Google: W. Duch
1. Mind as a shadow of neurodynamics: geometrical model of mind
processes, psychological spaces providing inner perspective as an
approximation to neurodynamics.
2. Intuition: learning from partial observations, solving problems without
explicit reasoning (and combinatorial complexity) in an intuitive way.
3. Neurocognitive linguistics: how to find neural pathways in the brain.
4. Creativity in limited domains + word games, good fields for testing.
Duch W, Intuition, Insight, Imagination and Creativity,
IEEE Computational Intelligence Magazine 2(3), August 2007, pp. 40-52
Intuition
Intuition is a concept difficult to grasp, but commonly believed to play
important role in business and other decision making; „knowing
without being able to explain how we know”.
Sinclair Ashkanasy (2005): intuition is a „non-sequential information-processing
mode, with cognitive & affective elements, resulting in direct knowing without any
use of conscious reasoning”.
3 tests measuring intuition: Rational-Experiential Inventory (REI), Myers-Briggs
Type Inventory (MBTI) and Accumulated Clues Task (ACT).
Different intuition measures are not correlated, showing problems in constructing
theoretical concept of intuition. Significant correlations were found between REI
intuition scale and some measures of creativity.
ANNs evaluate intuitively? Yes, although intuition is used also in reasoning.
Intuition in chess has been studied in details (Newell, Simon 1975).
Intuition may result from implicit learning of complex similarity-based evaluation
that are difficult to express in symbolic (logical) way.
Intuitive thinking
Question in qualitative physics (PDP book):
if R2 increases, R1 and Vt are constant, what will
happen with current and V1, V2 ?
Learning from partial observations:
Ohm’s law V=I×R; Kirhoff’s V=V1+V2.
Geometric representation of qualitative facts:
+ increasing, 0 constant, - decreasing.
True (I-,V-,R0), (I+,V+,R0), false (I+,V-,R0).
5 laws: 3 Ohm’s 2 Kirhoff’s laws.
All laws A=B+C, A=B×C , A-1=B-1+C-1, have
identical geometric interpretation!
13 true, 14 false facts; simple P-space, but
complex neurodynamics.
Geometric model of mind
Objective Subjective.
Brain Mind.
Neurodynamics describes state of
the brain activation measured using
EEG, MEG, NIRS-OT, PET, fMRI or
other techniques.
How to represent mind state?
In the space based on dimensions
that have subjective interpretation:
intentions, emotions, qualia.
Mind state and brain state
trajectory should then be linked
together by transformations (BCI).
Neurocognitive reps.
How to approach modeling of word (concept) w representations in the brain?
Word w = (wf,ws) has
• phonological (+visual) component wf, word form;
• extended semantic representation ws, word meaning;
• is always defined in some context Cont (enactive approach).
(w,Cont,t) evolving prob. distribution (pdf) of brain activations.
Hearing or thinking a word w , or seeing an object labeled as w adds to the
overall brain activation in a non-linear way.
How? Spreading activation in neural spaces, maximizing overall self-consistency,
mutual activations, meanings that don’t fit to current context are automatically
inhibited. Result: almost continuous variation of this meaning.
This process is rather difficult to approximate using typical knowledge
representation techniques, such as connectionist models, semantic networks,
frames or probabilistic networks.
Approximate reps.
States (w,Cont) lexicographical meanings:
• clusterize (w,Cont) for all contexts;
• define prototypes (wk,Cont) for different meanings wk.
A1: use spreading activation in semantic networks to define .
A2: take a snapshot of activation in discrete space (vector approach).
Meaning of the word is a result of priming, spreading activation to speech, motor
and associative brain areas, creating affordances.
(w,Cont) ~ quasi-stationary wave, with phonological/visual core activations wf
and variable extended representation ws selected by Cont.
(w,Cont) state into components, because the semantic representation
E. Schrödinger (1935): best possible knowledge of a whole does not include the
best possible knowledge of its parts! Not only in quantum case. Left semantic
network LH contains wf coupled with the RH.
QM-like formalism is useful for any probability waves.
Semantic => vector reps
Some associations are subjective, some are universal.
How to find the activation pathways in the brain? Try this algorithm:
•
•
•
•
•
•
Perform text pre-processing steps: stemming, stop-list, spell-checking ...
Map text to some ontology to discover concepts (ex. UMLS ontology).
Use relations (Wordnet, ULMS), selecting those types only that help to
distinguish between concepts.
Create first-order cosets (terms + all new terms from included relations),
expanding the space – acts like a set of filters that evaluate various aspects of
concepts.
Use feature ranking to reduce dimensionality of the first-order coset space,
leave all original features.
Repeat last two steps iteratively to create second- and higher-order enhanced
spaces, first expanding, then shrinking the space.
Result: a set of X vectors representing concepts in enhanced spaces, partially
including effects of spreading activation.
Creativity with words
The simplest testable model of creativity:
• create interesting novel words that capture some features of products;
• understand new words that cannot be found in the dictionary.
Model inspired by the putative brain processes when new words are being
invented starting from some keywords priming auditory cortex.
Phonemes (allophones) are resonances, ordered activation of phonemes will
activate both known words as well as their combinations; context + inhibition in
the winner-takes-most leaves only a few candidate words.
Creativity = network+imagination (fluctuations)+filtering (competition)
Imagination: chains of phonemes activate both word and non-word
representations, depending on the strength of the synaptic connections. Filtering:
based on associations, emotions, phonological/semantic density.
discoverity = {disc, disco, discover, verity} (discovery, creativity, verity)
digventure ={dig, digital, venture, adventure} new!
Server: http://www.braingene.yoyo.pl
DREAM top-level architecture
Web/text/
databases interface
NLP
functions
Natural input
modules
Cognitive
functions
Text to
speech
Behavior
control
Talking
head
Control of
devices
Affective
functions
Specialized
agents
DREAM project is focused on perception (visual, auditory, text inputs), cognitive
functions (reasoning based on perceptions), natural language communication in
well defined contexts, real time control of the simulated/physical head.
DREAM/HIT – larger view …
T-T-S synthesis
Affective
computing
Learning
Brain models
Behavioral
models
Speech recognition
HIT projects
Talking heads
Cognitive Architectures
AI
Robotics
Graphics
Lingu-bots
A-Minds
VR avatars
Info-retrieval
Cognitive
science
Knowledge
modeling
Semantic
memory
Episodic
Memory
Working
Memory