Download Random Design Building Bridges Between Science and Faith

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Fisher–Yates shuffle wikipedia, lookup

Hardware random number generator wikipedia, lookup

Randomness wikipedia, lookup

Transcript
Random Design
Building Bridges Between
Science and Faith
Higher Order Thinking
in Biology Education
Science
Communication
Language
Mathematics
Music
Religion
Culture
History
Art
Connecting the Dots
Information
Science
Higher Order in Biology
Molecules to Mankind
I think
I am
I believe
Higher Order Thinking Requires:
• Openness/receptive to new dots
• Acquisition of new Dots
• Dots accurate and well-defined
• Processing Time
Barriers to Higher Order Thinking
•
•
•
•
Limiting input of new dots
Misunderstanding dots
Focusing on wrong dots
Language and Communication
– Personal
– Community/Transferance
Language Problem!
Modern Day ‘Tower of Babel’
Examples:
• Science
• Evolution
• Creationist
• Random
• Naturalism
• Christian
• Mutation
* Emotional obstacles
Coming to Terms with Terms
Definitions of Evolution
•
•
•
•
Evolution, change through time (generic)
Evolution, (genetic mechanisms and development)
Evolution, (atheistic)
Chemical evolution (first life)
Is evolution a theory or a fact?
Evolution is a theory AND a fact!
Fact - biological evolution has, and is occurring.
Theory – explains many diverse facts from different
scientific disciplines.
Science and Faith
The Crux of the Issue:
 Scientists are suspicious that Christians
want to insert religious beliefs into science
 Christians fear that science seeks to
remove God from the picture altogether.
Are these suspicions and fears warranted?
Who will stop the cycle?
Understanding Randomness
• Apparent random processes are biological
realities.
– Sperm/egg
– Biochemical/physical reactions
– Immunity
– Random Mutation and Selection (Evolution)
DNA
Sugar
Hemoglobin
Cells
Antibodies
Genetic Record: Chromosome
Comparisons of Humans and Apes
Understanding Randomness
 Haphazard, coincidence, chance,
purposeless.
 Equal opportunity of occurrence! Biology as
an equal opportunity process.
If random is defined as purposeless, then
connecting this dot to a purposeful God is
IMPOSSIBLE!
Is Anything Truly Random?
21344321143223411342
21344321143223411342
21344321143223411342
Is Anything Truly Random?
01123581321345589
(Fibonacci Numbers)
Is Anything Truly Random?
213313424413241441323323223131
213313424413241441323323223131
Adenine = 1 Thymine = 2 Cytosine = 3 Guanine = 4
TACCACGTGGATGAGGACTCCTCTTCAGA
AUGGUGCACCUGACUCCUGAGGAGAAGUCU
Met - Val - His - Leu -Thr - Pro - Glu - Glu - Lys –Ser
(Hemoglobin gene codes for Hemoglobin Protein)
It is music to the ear! Listen!
A Super Intelligence Would Know
No True Randomness
• EVERYTHING, regardless of deep complexity
and apparent random nature, would actually
possess logical, orderly, and purposeful
connections.
**Randomness and evolution need not
detract from belief in God: They can be
viewed as part of a purposeful plan.
Fundamental Questions:
--Does the creative logic revealed by
science demonstrate the existence of a
Creator?
OR
--Does the existence of innately creative
natural laws eliminate God from the picture
altogether?
Honest answers to honest questions…
Random (Equal Opportunity) Design
A New Model for Science Education
Building Bridges Instead of Barriers
A New Direction Needed:
•
•
•
•
•
Win/Win: Each side granted core needs
Commit to solutions - Set positive examples.
Strengthen/affirm science and religious belief.
Recognize role of language/emotions.
Embrace and respect student diversity
Random (Equal Opportunity) Design
A New Model for Science Education
Random Design - a powerful process for creating
higher order, especially in living beings. Harnessing
the laws of randomness, it functions by first generating
large arrays of potential building blocks from which the
most suitable candidates are sequentially incorporated
into an ever-advancing architectural design.
Random (Equal Opportunity) Design
A New Model for Science Education
How does Random Design Work?
Random Design has three components:
1. The Driver imparts directionality to the world.
2. The Mixer uses combinatorial mathematics to
create infinite new possibilities for diversity –
the raw material for extending order and structure.
3. The Selector.
Random (Equal Opportunity) Design
A New Model for Science Education
How does Random Design Work?
Question:
Presented with a problem to solve and no limitations of
time and resources, which of the following approaches
would most likely arrive at the best solution?
A.
B.
C.
Think the problem through as best as possible, then try
what seems to be the one best idea.
Think the problem through as best as possible, then try
the best 10 ideas.
Try all potential possibilities.
This expansive approach is biology’s solution as
well. In short, it is Random Design.
Examples:
• Four chemical bases of DNA -- infinite # of genes.
• Infinite genes -- infinite # of proteins.
• Infinite # of proteins -- infinite diversity of life.
Key Point: Random Design has virtually no Limits!
The magic of combinatorial mathematics continuously searches
for the very best solutions to life’s dynamic and never-ending
challenges - the best, and perhaps only creative process up to the
task of beginning, nurturing, and sustaining life on earth.
Random (Equal Opportunity) Design
A New Model for Science Education
Strengthening Science:
 Recognizes that science must be free to pursue
truth wherever it leads.
 Refuses to redefine or compromise integrity of
science to meet religious standards.
 Does not explain biological processes and
mechanisms in supernatural terms.
Random (Equal Opportunity) Design
A New Model for Science Education
Strengthening Religious Faith:
• Permanent secure place for plausibility of
Creator.
• Ecumenical, offering a larger more expansive
vision of God as Creator.
• Restores credibility of religious
representatives.
• Viable platform to restore trust and
relationships.
The Alpha and the Omega