Download mRNA_Proverbs

Name_______________________
mRNA Proverbs
The genetic code is written in units called codons. Each codon stands for one of the 20 amino acids that the body needs to make
specific proteins that perform a specific function.
In this exercise, we will be making sentences using the same principles of genetic coding.
1. Given the list of mRNA Codons and the letters or punctuation they represent, figure out the proverb that is written by the codons.
Note: The string of letters represents the way information may be stored on the chromosome and the way mRNA may leave the
nucleus. Between ‘sentences’ there is junk code. Be sure to find a start codon BEFORE you start reading, and after a stop codon,
don’t keep reading until you find another start codon. Don’t read triplets until you find a start codon!
2. Choose a sentence and write the DNA strand that the mRNA was transcribed from. (Do this on back. The last line will be easiest.)
3. For the alphabet, write the tRNA anticodons. (Do this on the back.)
AUG-start codon (signals that the mRNA strand should start being read at the next codon)
AAA- a
UCU- b
CCC- c
UGU- d
UAU- e
UUC- f
GGG- g
UAC- h
AUA- i
UGC- j
UUA- k
UCA- l
UGG- m
CUU- n
AUU- o
CCU- p
CAU- q
CGU- r
CUC- s
CAC- t
UUU- u
CGC- v
CAG- w
CGG- x
GUU- y
GCU- z
GAG- space
GGA- apostrophe
UAA- STOP with a period
UAG- STOP with a question mark
UGA- STOP with an exclamation point
(stop codons signal that the genetic sentence has ended)
Here goes…
UGUAUUCUUGGACACGAGCUCCACAAACGUCACGAGGUUUAUCACAUGCCUUAUAUUCCU
UCAUAUGAGAUACUUGAGGGGUCAAAACUCCUCGAGUACAUUUUUCUCUAUCUCGAGCUC
UACAUUUUUUCAUGUCUUGGACACGAGCGUUUUCUUGAGAAACGUAUUUUUCUUUGUGAG
CUUAAAUUAUAUUGUUGAUUUGGGCCCAAACCCCCCCCCCCCCAUGUGUAUUCUUGGACAC
GAGUCUAUACACUAUGAGCACUACUAUGAGUACAAACUUUGUGAGCACUACAAACACGAG
UCAAUUAUUUUACUCGAGUGUAUACGUCACGUUUAAUGGGGGGGGAAAAAAAAAAAAAUG
AUACACGGACUCGAGAAAUCACAGAAAGUUCUCGAGUGUAAACGUUUAUAUCUCCACGAG
UCUUAUUUCAUUCGUUAUGAGUGUAAAGUUUCAAUAGGGUACCACGAGCUCAAACGCAUA
CUUGGGCUCGAGCACAUAUGGUAUUAAGGCGGGGGGGGGGGGAUUUUUCUUUGUUGAUUU
UUUUUUUUUUUUUUUUUAUCAAGAUAUAUAUAUAAUGGUUAUUUUUGAGCCCAAACUC
GAGUCAUAUAAAUGUGAGAAAGAGUACAUUCGUCUCUAUGAGCACAUUGAGCAGAAACAC
UAUCGUGAGUCUUUUCACGAGCACUACUAUCUUGAGCAGUACAAACACUAGGAGGAGAGA
GAGAGGAGAGAGAGUUGUUGGUUGGUUAUGAAAGAGCCUUAUCUUCUUGUUGAGCUCAAA
CGCUAUUGUGAGAUACUCGAGCUUAUUCACGAGUGGUUUCCCUACUAAAGAGAGAGAAUG
AAACUUGAGAUAUGUUCAUAUGAGUGGAUACUUUGUGAGAUACUCGAGCACUACUAUGAG
UCUUAUCUCCACGAGCAGAAAGUUGAGCACAUUGAGCGUUAUUCAAAACGGUAAGGGGGG
GGGGGGGGGGGGGGGGGGGGAUGGGGAUUAUUUGUGAGUGCAUUUCUUGAAAAAAAAAA
Name_______________________
Perform #2 and #3 from the directions on the front in the space provided:
2)
3) Write the tRNA anti-codons for the alphabet underneath the mRNA codons:
AUG-start codon (signals that the mRNA strand should start being read at the next codon)
AAA- a
UCU- b
CCC- c
UGU- d
UAU- e
UUC- f
GGG- g
UAC- h
AUA- i
UGC- j
UUA- k
UCA- l
UGG- m
CUU- n
AUU- o
CCU- p
CAU- q
CGU- r
CUC- s
CAC- t
UUU- u
CGC- v
CAG- w
CGG- x
GUU- y
GCU- z
GAG- space
GGA- apostrophe
UAA- STOP with a period
UGA- STOP with an exclamation point
UAG- STOP with a question mark
(stop codons signal that the genetic sentence has ended)
Thought questions:
4) What is the advantage of having meaningless code at the beginning and the end of a strand of DNA or RNA?
5) Why is the DNA code stored in groups of three nucleotides instead of groups of one or two or four or more?