Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Published Ahead of Print on September 20, 2013, as doi:10.3324/haematol.2013.089888. Copyright 2013 Ferrata Storti Foundation. Glutathione transferase-A2 S112T polymorphism predicts survival, transplant-related mortality, busulfan and bilirubin blood levels after allogeneic stem cell transplantation by Francesca Bonifazi, Gianluca Storci, Giuseppe Bandini, Elena Marasco, Elisa Dan, Elena Zani, Fiorenzo Albani, Sara Bertoni, Andrea Bontadini, Sabrina De Carolis, Maria Rosaria Sapienza, Simonetta Rizzi, Maria Rosa Motta, Martina Ferioli, Paolo Garagnani, Michele Cavo, Vilma Mantovani, and Massimiliano Bonafè Haematologica 2013 [Epub ahead of print] Citation: Bonifazi F, Storci G, Bandini G, Marasco E, Dan E, Zani E, Albani F, Bertoni S, Bontadini A, De Carolis S, Sapienza MR, Rizzi S, Motta MR, Ferioli M, Garagnani P, Cavo M, Mantovani V, and Bonafè M. Glutathione transferase-A2 S112T polymorphism predicts survival, transplant-related mortality, busulfan and bilirubin blood levels after allogeneic stem cell transplantation. Haematologica. 2013; 98:xxx doi:10.3324/haematol.2013.089888 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process. Glutathione transferase-A2 S112T polymorphism predicts survival, transplant-related mortality, busulfan and bilirubin blood levels after allogeneic stem cell transplantation Francesca Bonifazi1, Gianluca Storci2,3, Giuseppe Bandini1, Elena Marasco2, Elisa Dan1, Elena Zani2, Fiorenzo Albani4, Sara Bertoni2, Andrea Bontadini5, Sabrina De Carolis3, Maria Rosaria Sapienza3, Simonetta Rizzi1, Maria Rosa Motta1, Martina Ferioli1, Paolo Garagnani2, Michele Cavo1, Vilma Mantovani2, and Massimiliano Bonafè3 1Institute of Hematology “L. and A. Seràgnoli”, University of Bologna, St. Orsola-Malpighi University Hospital; Bologna, Italy. 2Center for Applied Biomedical Research (CRBA), St. Orsola-Malpighi University Hospital; Bologna, Italy. 3Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna. 4 IRCCS Istituto delle Scienze Neurologiche di Bologna and Department of Biomedical and NeuroMotor Sciences, University of Bologna, Italy. 5 Transfusion Medicine and Immunohematology, S. Orsola-Malpighi Hospital; Bologna, Italy. Statement of equal contribution: FB and GS contributed equally to this manuscript. Running heads: GSTA2 S112T polymorphism in allogeneic HSCT Correspondence Francesca Bonifazi, MD, Institute of Hematology “Seràgnoli”, University-Hospital S. Orsola-Malpighi,, University of Bologna, Bologna, Italy. E-mail: [email protected] Funding This work has been supported by Progetto Università Regione 2008-2011, N. 1412: “HSCT transplant in the elderly” (G. Bandini and M. Bonafè), University of Bologna RFO funds, Cornelia Pallotti and Roberto Pallotti Foundation (M. Bonafè). Acknowledgments We thank Dr. Gabriele Grossi, Daniela Bastia and Dr. Chiara Fazio for technical assistance. Abstract Busulfan liver metabolism depends on glutathione, a crucial mediator of cellular and systemic stress. Here we investigated 40 polymorphisms at 27 loci involved in hepatic glutathione homeostasis, with the aim to test their impact on the clinical outcome of 185 busulfan-conditioned allogeneic transplants. GSTA2 S112T serine allele homozygosity is an independent prognostic factor for poorer survival (RR=2.388), for increased any time- and 100-day Transplant Related Mortality (RR=4.912 and RR=5.185, respectively). The genotype also predicts a wider busulfan area under the concentration-time curve (1214.36+570.06 vs 838.10+282.40 µMol*min) and higher post-transplant bilirubin serum levels (3.280+0.422 vs 1.874+0.197 mg/dL). In vitro, busulfan elicits pro-inflammatory activation (increased NF-KappaB activity and interleukin-8 expression) in human hepatoma cells. At the same time, the drug down-regulates a variety of genes involved in bilirubin liver clearance: constitutive androstane receptor, multidrug resistance-associated protein, solute carrier organic anion transporters, and even GSTA2. Worthy of note, is the fact that GSTA2 also acts as an intra-hepatic bilirubin binding protein. These data underline the prognostic value of GSTA2 genetic variability in busulfan-conditioned allotransplants and suggest a pathophysiological model in which busulfan-induced inflammation leads to the impairment of posttransplant bilirubin metabolism. Keywords: stem cell transplantation, busulfan, GSTA2, bilirubin, NF-KappaB. Introduction Hematopoietic Stem Cell transplantation (HSCT) is a curative procedure for a variety of hematological diseases1. Transplant related mortality (TRM) after HSCT depends mainly on graftversus-host disease (GVHD), infections and preparative regimen toxicity. The assessment of polymorphisms at Major Hystocompatibility Complex (MHC) loci has long been proven to be crucial for successful allogeneic HSCT2. Polymorphisms at non-MHC loci have also been associated with the HSCT outcome3,4. Major attention has been paid to the relationship between genetic variation at innate immunity loci and GVHD5. Up until now, studies on genetic polymorphisms on HSCT have generated contrasting data, likely due to insufficient sample size, selection biases, patient and treatment heterogeneity2. HSCT is a systemic stress: the achievement of a favourable HSCT outcome is attained via the successful functioning of multiple stress response systems, and is likely to be affected by genetic variability over a large array of loci3. Busulfan, a bi-functional alkylating agent, is an alternative to total body irradiation, and it is one of the most widely used drugs in allogeneic HSCT conditioning regimen1. Busulfan is used in association with cyclophosphamide1 and more recently with fludarabine6. Systemic exposure to the drug is an important parameter for monitoring therapeutic efficacy7,8. Large inter-individual variability in busulfan pharmacokinetics has been observed9: the therapeutic window of busulfan, expressed as area under the concentration-time curve (AUC), ranges from 900 to 1500μMol*min. AUC levels lower than 900μMol*min correlate with disease relapse and graft-failure, while values higher than 1500μMol*min are associated with extra-hematological hepatic toxicity10,11. The clearance of the drug occurs in the liver by direct conjugation with glutathione (GSH), as well as via enzymatic GSH conjugation by glutathione-S-transferases12,13 (GST). Liver GST activity, which is mainly due to GSTA1 and GSTA2 iso-enzymes, correlates with busulfan elimination14. Depletion of liver GSH, as consequence of busulfan conjugation, impairs the metabolism of other drugs such as cyclophosphamide15. Plasma GST activity and GSH level associate with the variability in busulfan clearance14,16. In this paper, 40 polymorphisms at 27 loci involved in hepatic glutathione balance17 were studied in a total of 185 patients who underwent allogeneic HSCT from 2005 to 2009, after a busulfan-based preparative regimen (busulfan cohort). The impact of such loci was tested on overall survival, TRM, busulfan AUC and serum liver function tests. The same polymorphisms were also tested on 146 consecutive patients not receiving busulfan in the preparative regimen, concomitantly undergone transplantation at the same Institution (comparator cohort). Methods Patients 185 consecutive patients (busulfan cohort, Table 1) were transplanted at the Institute of Hematology “L. and A. Seràgnoli”, University of Bologna, between 2005 and 2009, using busulfan as a conditioning drug. Myeloablative conditioning (0.8 mg/kg intravenous busulfan, 2h infusions, four times a day, four consecutive days plus cyclophosphamide, 120mg/kg) was administered to 167 patients. Lower (6 patients) or standard busulfan doses plus fludarabine 160mg/m2 (12 patients) were also used. Ideal body weight (IBW) was calculated as 0.91x (height in cm–152) +50 (for men) or +45 (for women). IBW was used when lower than the actual weight and when body mass index (BMI) was lower/equal to 27. When BMI was greater than 27, IBW was adjusted as IBW+ 0.25 x (actual weight – IBW). 146 consecutive patients (comparator cohort, Table 1) transplanted at the same Institution were also studied. In such cohort, the myeloablative conditioning was cyclophosphamide (120mg/kg) plus unfractioned total body irradiation (8Gy). GVHD prophylaxis was Cyclosporin-A and short-term methotrexate plus rabbit anti-thymocyte globulin (3-5 mg/kg/die, Fresenius, Bad-Homburg, Germany), from day -6 to day -2. Patients with acute leukemia in 1st complete remission or with chronic myeloid leukemia in 1st chronic phase were classified as in early phase at transplant, the remaining patients were classified in advanced phase. Written informed consent for the study was obtained from the patients. The study was approved by the Ethics Committee of S. Orsola-Malpighi University Hospital, Bologna, Italy. Busulfan pharmacokinetics Plasma busulfan kinetics (64 patients) was assessed before administration, and at 15, 60, 120, 180, 240 minutes, after dose dose 9 (day 3) 19 . Plasma busulfan concentrations were determined by HPLC (Perkin Elmer, USA)20. The area under the concentration-time curve (AUC) was calculated by Kinetica software (Thermo Scientific, Waltham, MA, USA). Genetic analysis Forty polymorphisms at 27 loci were analyzed (Supplementary Table 1 and 2). 36 were genotyped using MassARRAY high-throughput DNA analysis (Sequenom, Inc., San Diego, CA, US). Three (CBS rs72958776-68bpIns, GST-T1 and GST-M1 null alleles) were genotyped by PCR; GPX1 SNP rs1050450 was assessed by tetra-ARMS PCR. In vitro study Human hepatoma HepG2 cells were grown in DMEM 10% FBS (Life Technologies, Carlsbad, CA, USA). GSTA2-specific siRNA and GC-matched control siRNA were transfected by Lipofectamine 2000 (Life Technologies) to HepG2 cells (10x104/3cm2 well, 72h). Cells were exposed to busulafan (2.5 to 400uM, 96h) and cell death was assessed by Trypan blue. Real-time PCR mRNA was extracted by Trizol (Life Technologies). Real-time PCR primers and probes for GSTA2, interleukin-8 (IL8), constitutive androstane receptor (CAR), multidrug resistanceassociated protein ABCC2, solute carrier organic anion transporters SLCO1B1 and SLCO1B3 and β-glucuronidase mRNAs were from Life Technologies. The amount of the target genes was calculated by the 2-ddcT method. Luciferase assay NF-kappaB luciferase21 reporter activity was assessed in HepG2 (1 µg/well, 24h) by DualLuciferase® Reporter Assay System (Promega, Madison, WI). Statistical analysis Cox-proportional and general linear model (GLM) for repeated measures were employed. p=0.00125 was considered significant in multiple comparisons. The analyses were performed by PASW18 (SPSS-IBM, (http://genecanvas.ecgene.net)22. NY). Haplotypes were estimated by Thesias RESULTS GSTA2 S112T locus impacts TRM and survival, but not GVHD and relapse, in patients receiving busulfan. Clinical characteristics of transplanted patients are reported in Table 1. Multivariate Cox regression was performed using the five clinical variables included in the EBMT score (age, sex mismatch, disease phase, type of donor, interval diagnosis-transplant) plus intensity of conditioning. The analysis revealed that disease phase at transplant (advanced vs early) is a significant prognostic factor for both TRM (advanced vs early, RR= 2.689, 95%CI: 1.078-6.703, p=0.034) and overall survival (OS, advanced vs early, RR= 3.975, 95%CI: 2.262-6.986, p=1.61*10-6). All the genotypes investigated (Supplementary Tables 1 and 2) were singularly tested in a Cox model implementing clinical variables as covariates (Supplementary Table 3). The serine (ser) to threonine (thr) aminoacid substitution at GSTA2 Codon 112 (S112T) was the only locus which remained significant for TRM after adjustment for multiple comparisons (n=40, p=0.001), while the effect on OS was only marginally significant (p=0.005, Supplementary Table 3). GSTA2 is a glutathione transferase, which is expressed in the liver and metabolizes busulfan in cooperation with GSTA113. GSTA2 S112T genotypes were then recoded as dichotomous variables, namely serine homozygotes (ser/ser, n=38) and threonine carriers (thr+, n=142). We observed that GSTA2 S112T locus was predictive of OS (ser/ser vs thr+, RR=2.388, 95%CI: 1.407-4.502, p=0.001), TRM (ser/ser vs thr+, RR=4.912, 95%CI: 2.083-11.563, p=0.0002) and 100-day TRM (ser/ser vs thr+, RR=5.185, 95%CI:1.971-13.641, p=0.001, Table 2). The Kaplan and Meyer plot showed the poorer survival and higher TRM of GSTA2 S112T ser/ser patients (Figure 1A, 1B and 1C). Furthermore, because deaths mostly occurred in the first post-transplant weeks, we also calculated 100-day TRM (Figure 1C). In line with expectations, the analysis of 100-day TRM death causes revealed a significantly higher number of deaths due to conditioning-related toxicity23 in GSTA2 S112T ser/ser patients (6 out of 9, 66.6%), compared to thr+ ones (2 out of 12, 16.6%, p=0.032, Fisher exact test , Figure 1D). Interestingly, GSTA2 S112T locus did not significantly affect either TRM nor OS in the comparator cohort (Supplementary Table 3), even when the analysis was performed separately on the subset of patients receiving myeloablative conditioning regimen (ser/ser, n=9 vs thr+, n=52, OS: RR=0.361 95%CI: 0.115-2.201, p=0.361; TRM: RR=0.558 95%CI: 0.070-4.412, p=0.580) or reduced-intensity conditioning regimen (ser/ser, n=21 vs thr+, n=64; OS: RR=0.891 95%CI: 0.4932.237, p=0.891; TRM: RR=0.797 95%CI: 0.245-2.593, p=0.706). We also observed a weak association between TRM and other polymorphisms located at the GSTA1-GSTA2 genomic region, namely GSTA1 SNPs (rs1051775, rs3957356, rs4715332, Supplementary Table 3). As previously reported24,25, owing to the significant linkage disequilibrium among polymorphisms at GSTA2 and GSTA1 loci (Supplementary Table 4), the two loci haplotype frequency distribution of GSTA2 S112T and GSTA1 loci was estimated: the ser allele was highly associated with the so-called GSTA1*B rs3957356-rs4715332 functional haplotype25,26 (Supplementary Table 5). Nevertheless, survival analysis of GSTA2 S112T-GSTA1*A/B haplotypes reinforced the conclusion that GSTA1*B haplotype does not significantly modify the impact of the GSTA2 S112T locus on TRM and survival in our case set (Table 3 and Supplementary Table 6). Moreover, GSTA2 S112T locus does not affect relapse rate, which was instead associated with the phase at transplant (Supplementary Table 7). Furthermore, incidence of aGVHD III-IV grades and hepatic acute GVHD III-IV stages were similar between GSTA2 S112T ser/ser and thr+ patients (18.9% vs 19.1%, p=0.591, 5.4% vs 5.6%, p=0.472, respectively). Impact of the GSTA2 S112T locus on busulfan-AUC and the post transplant serum bilirubin level. GSTA2 S112T polymorphism is not located in the enzyme catalytic site but it has been supposed to affect protein stability27. Busulfan is almost exclusively metabolized in the liver, where GSTA2 is expressed15,28. Anova analysis implementing age, sex, BMI and source of HSC as covariates, revealed higher systemic exposure to busulfan (day-3 AUC) in GSTA2 S112T ser/ser patients compared to thr+ (1214.36+570.06 vs 838.10+282.40 μMol*min, F=9.185, p=0.001, Figure 2A). Notably, BMI was not affected by S112T GSTA2 polymorphism, given that ser/ser patients show the same BMI distribution as thr+ patients, in each gender group (males: 27.70+2.62 vs 26.5+3.85, females: 21.13+1.51 vs 24,21+4.55, p=0.85, GLM analysis). Moreover, busulfan AUC was not different between patients with BMI lower than/equal to 27 vs those with BMI greater than 27 (mean values: 871.00+343.09 vs 903.96+355.21 μMol*min, p=0.29, adjusted for gender). Because glutathione depletion causes liver damage18, we then evaluated the association between GSTA2 S112T SNP and liver function tests: total bilirubin, alanine transaminase, aspartate transaminase, cholinesterase, alkaline phosphatase and gamma-glutamyl transferase were examined weekly from the day of conditioning, up to the 35th post-transplant day. Higher un-fractioned plasma bilirubin levels for the first five weeks after transplant were found in GSTA2 S122T ser/ser patients compared to thr+ ones (GLM-estimated marginal means: 3.280+0.422 vs 1.874+0.197 mg/dL, F=8.728, p=0.004, Figure 2B). Interestingly, no association was found between GSTA2 S112T locus and all the other liver functional tests (Supplementary Table 8). Exposure of human hepatoma cells to busulfan induces a pro-inflammatory response and reduces the expression of genes involved in bilirubin clearance. The data above suggest that, in patients receiving busulfan, the difference in post-transplant plasma bilirubin level between ser/ser vs thr+ patients is not correlated with the extent of liver necrosis. In this regard, negligible cell death was observed in human hepatoma cells HepG2 exposed to busulfan at concentrations comparable to those occurring in vivo, even when such cells were knocked down by a GSTA2-specific short interfering RNA oligonucleotide (siGSTA2, Figure 3A). In HepG2 cells, busulfan administration elicited the up-regulation of NF-kappaB, the master controller of the inflammatory response29 (Figure 3B). Moreover, siGSTA2 transfected HepG2 cells disclosed the up-regulation of NF-kappaB activity and of the pro-inflammatory cytokine interleukin-8, compared to controls (Figure 3C). At cellular and systemic levels, inflammation reduces the expression of a variety of genes involved in liver bilirubin metabolism29,30, namely constitutive androstane receptor31 (CAR), multidrug resistance associated protein MRP2/ABCC232 and solute organic carriers SLCO1B1 and SCLO1B332 . We also included GSTA2 in this gene set, since it is the intra-hepatic bilirubin ligandin, a function which is independent of its enzymatic activity33. We found that exposure of HepG2 cells to non-cytotoxic concentrations of busulfan elicited a dramatic decrease in GSTA2, CAR, ABCC2, SLCO1B1 and SCLO1B3 expression (Figure 3D). Notably, SLCO1B1 and SCLO1B3 became almost undetectable upon busulfan exposure. Moreover, in siGSTA2-transfected HepG2, we observed a further decrease in CAR and ABCC2 expression compared to controls (Figure 3E). These data led us to argue that the pro-inflammatory activation of busulfan-exposed hepatocytes causes the down-regulation of GSTA2 and of bilirubin-metabolizing enzymes (Figure 3F). This metabolic reshaping is expected to impair bilirubin clearance in the post-transplant phase and to be dependent on the individual genetic landscape. Discussion In this paper we report that the GSTA2 S112T polymorphism affects survival of HSCT patients receiving a busulfan-based conditioning regimen, serine allele homozygotes being more prone to higher transplant-related and overall mortality compared to threonine allele carriers. The frequency of GSTA2 S112T serine homozygotes here reported (21%) is close to that found in the Italian population34 (19.8%) and in Caucasians24 (18.5%), suggesting that the locus does not represent a risk factor for developing hematopoietic malignancies. Interestingly, the association of GSTA2 S112T with TRM and survival is not significant in the cohort of HSCT patients not receiving busulfan (comparator cohort). Therefore, the data suggest that the polymorphism changes the individual response to the drug. In support of this hypothesis, we report that GSTA2 S112T serine homozygotes show higher busulfan plasma levels compared to threonine carriers, indicating that such a group of patients display a reduced busulfan clearance capability. In fact, busulfan metabolism mainly involves its conjugation with GSH in the liver, via alpha class cytosolic GST12,13. Busulfan administration depletes the content of hepatocyte GSH, the cofactor of GST enzymes18,35. Plasma GSH correlates with busulfan clearance capacity16 and hepatic GST activity negatively correlates with plasma busulfan and positively associates with its clearance14. In line with these data, the association between high busulfan plasma levels and post-transplant mortality has already been described7,8,10. Consistent with the above reasoning, we found that the proportion of deaths due to drug toxicity in GSTA2 S112T serine homozygotes is higher than in other patients. Hence, the GSTA2 S112T locus may be regarded as a reliable predictor for individual susceptibility to the adverse effects of busulfan. It might also be argued that GSTA2 S112T locus can be used to tailor busulfan dosages. However,our series is based on the standard association of busulfan and cyclophosphamide, the GSTA2 S112T locus should be assessed in patients receiving other busulfan-based drugs combinations. Our data do not confirm the previously reported association between busulfan AUC and GVHD9. Insufficient power or heterogeneity of patients’ GVHD risk (i.e. type of donor, source of HSC, HLA distance) may explain these findings. The GSTA2 S112T aminoacid change is not located at the enzyme catalytic site36. Moreover, serine and threonine residues are both polar non-charged aminoacids and their reciprocal substitution is not expected to yield any predictable change in the protein structure36. Nevertheless, in the liver, the GSTA2 S112T locus has been found to impact the GSTA2 protein level and themostability24,27. These data suggest that the GSTA2 S112T locus affects the individual capability to metabolize busulfan, independently of the alteration of GSTA2 enzyme activity. GSTA2 and GSTA1 share 95% aminoacid identity but GSTA2 is endowed with lower busulfan-GSH conjugation activity13,28. The GSTA2 S112T locus is closely associated with the functional (rs395376)-52bp GSTA1 polymorphism, which modifies the gene transcription rate34. Consequently, the tight linkage disequilibrium among GSTA1 and GSTA2 polymorphisms24,25,37 might explain the functional association here reported. The GSTA1 promoter hosts functional *A and *B haplotypes25,26,37: the GSTA1*B haplotype has been associated with four-fold reduction of GSTA1 enzyme activity and higher busulfan plasma concentration8,26,37-39. Though the GSTA2 S112T serine allele is in linkages with the GSTA1 *B haplotype24-26, it seems to be the sole cause for the results here obtained. Even the GSTA2 thr-*B haplotype, which is expected to combine the low activity of both isoenzymes24,25, seems not to impact patients’ survival. Intriguingly, the association between the GSTA1*B haplotype and reduced busulfan clearance was observed with oral but not intravenous administration40,41. On the contrary, other authors failed to find any association between GSTA1 polymorphisms and busulfan metabolism42,43. Nevertheless, our data support the role of GSTA1-GSTA2 genomic region in the inter-individual variability in busulfan metabolism. Here we show that 35 days post-transplant serum bilirubin levels are increased in GSTA2 S112T serine homozygotes patients receiving a preparative regimen containing busulfan. Since GSTA2 S112T serine homozygotes do not display significantly different alterations in other liver function tests, we speculate that such patients might undergo specific alterations of bilirubin clearance. In this regard, busulfan is not hepatotoxic itself, at least within the therapeutic concentrations range44. According to this notion, we did not find cell death in human hepatoma cells exposed to therapeutic concentrations of busulfan, even upon siRNA-mediated GSTA2 knockdown. We observed that busulfan triggers the pro-inflammatory activation of human hepatoma cells. At cellular and systemic levels29,30, inflammation has been linked to the down-regulation of a variety of genes involved in bilirubin metabolism. In particular, we show here that busulfan downregulates: i. CAR, the nuclear transcription factor for several liver bilirubin clearance genes32; ii. MRP2/ABCC2, a member of the ATP-binding cassette family of membrane transporters localized at the apical border of hepatocytes, which is involved in the transport of conjugated bilirubin and glutathione trafficking to the bile29; iii. SLCO1B1 and SLCO1B3, trans-membrane transporters at hepatocytes’ baso-lateral border, which control the uptake of conjugated and/or unconjugated serum bilirubin32. Intriguingly, busulfan also downregulates GSTA2 which is part of the bilirubin metabolism, owing to its ability to act as intrahepatocytic ligandin, which prevents the backflow of hepatic bilirubin into blood circulation31. In addition, we found that the exposure of GSTA2 knockdown cells elicits higher inflammatory activation and lower expression of CAR and ABCC2, compared to controls. Since it has been previously reported that post-transplant interleukin-8 serum level is highly correlated with serum bilirubin45 it can be hypothesized that the pro-inflammatory status, which develops in busulfan prepared patients, might be linked to the reduced clearance of un-conjugated bilirubin, as well as to the increase of serum bilirubin. On the basis of this reasoning, these findings lead us to speculate that post transplant hyper-bilirubinemia in GSTA2 S112T serine homozygotes may be the consequence of their peculiar liability to the development of busulfandependent pro-inflammatory liver injury (Figure 3F). In conclusion, our data suggest that the GSTA2 S112T polymorphism is predictive of transplant outcome in patients receiving busulfan in the preparative regimen, at least in association with cyclophosphamide. The study is retrospective and mono-center: this analysis warrants validation by a prospective clinical study to gauge the role of genotyping at GSTA S112T locus in the adjustment of busulfan dosages. Authorship and disclosure FB, GS, GB and MB designed the study; FB, GB, MC and MF recruited patients; GS performed the in vitro studies; EZ and FA assessed busulfan dosage and kinetics; SB, SDC performed cell cultures, Real Time PCR, gene knockdown; EM, PG and VM made genotype design and analysis; AB, SR, ED, MRM MRS were in charge of cell banking, DNA banking and extraction; FB and MB carried out statistical analysis; FB, GS, GB and MB wrote the manuscript; all the authors reviewed and approved the manuscript. The authors report no potential conflicts of interest. References 1. Santos GW, Tutschka PJ, Brookmeyer R, Saral R, Beschorner WE, Bias WB, et al. Marrow transplantation for acute nonlymphocytic leukemia after treatment with busulfan and cyclophosphamide. N Engl J Med. 1983;309(22):1347-53. 2. Hansen JA, Chien JW, Warren EH, Zhao LP, Martin PJ. Defining genetic risk for graft-versushost disease and mortality following allogeneic hematopoietic stem cell transplantation. Curr Opin Hematol. 2010;17(6):483-92. 3. Chien JW, Zhang XC, Fan W, Wang H, Zhao LP, Martin PJ, et al. Evaluation of published single nucleotide polymorphisms associated with acute graft versus host disease. Blood. 2012;119(22):5311-9. 4. Mullally A, Ritz J. Beyond HLA: the significance of genomic variation for allogeneic hematopoietic stem cell transplantation. Blood. 2007;109(4):1355-62. 5. Hansen JA, Petersdorf EW, Lin MT, Wang S, Chien JW, Storer B, et al. Genetics of allogeneic hematopoietic cell transplantation. Role of HLA matching, functional variation in immune response genes. Immunol Res. 2008;41(1):56-78. 6. Ciurea SO, Andersson BS. Busulfan in hematopoietic stem cell transplantation. Biol Blood Marrow Transplant. 2009;15(5):523-36. 7. Slattery JT, Clift RA, Buckner CD, Radich J, Storer B, Bensinger WI, et al. Marrow transplantation for chronic myeloid leukemia: the influence of plasma busulfan levels on the outcome of transplantation. Blood. 1997;89(9):3055-60. 8. Gaziev J, Nguyen L, Puozzo C, Mozzi AF, Casella M, Perrone Donnorso M, et al. Novel pharmacokinetic behaviour of intravenous busulfan in children with thalassemia undergoing hematopoietic stem cell transplantation: a prospective evaluation of pharmacokinetic and pharmacodynamic profile with therapeutic drug monitoring. Blood. 2010;115(22):4597-604. 9. Andersson BS, Thall PF, Madden T, Couriel D, Wang X, Tran HT, et al. Busulfan systemic exposure relative to regimen-related toxicity and acute graft-versus-host disease: defining a therapeutic window for i.v. BuCy2 in chronic myelogenous leukemia. Biol Blood Marrow Transplant. 2002;8(9):477-85. 10. Dix SP, Wingard JR, Mullins RE, Jerkunica I, Davidson TG, Gilmore CE, et al. Association of busulfan area under the curve with veno-occlusive disease following HSCT. Bone Marrow Transplant. 1996;17(2):225–30. 11. McCune JS, Gibbs JP, Slattery JT. Plasma concentration monitoring of busulfan: does it improve clinical outcome? Clin Pharmacokinet. 2000;39(2):155-65. 12. Gibbs JP, Czerwinski M, Slattery JT. Busulfan-glutathione conjugation catalyzed by human liver cytosolic glutathione S-transferases. Cancer Res. 1996;56(16):3678-81. 13. Czerwinski M, Gibbs JP, Slattery JT. Busulfan conjugation by glutathione S-transferases alpha, mu, and pi. Drug Metab Dispos. 1996;24(9):1015-9. 14. Poonkuzhali B, Chandy M, Srivastava A, Dennison D, Krishnamoorthy R. Glutathione Stransferase activity influences busulfan pharmacokinetics in patients with beta thalassemia major undergoing bone marrow transplantation. Drug Metab Dispos. 2001;29(3):264-7. 15. Hassan M, Ljungman P, Ringdén O, Hassan Z, Oberg G, Nilsson C, et al. The effect of busulphan on the pharmacokinetics of cyclophosphamide and its 4-hydroxy metabolite: time interval influence on therapeutic efficacy and therapy-related toxicity. Bone Marrow Transplant. 2000;25(9):915-24. 16. Almog S, Kurnik D, Shimoni A, Loebstein R, Hassoun E, Gopher A, et al. Linearity and stability of intravenous busulfan pharmacokinetics and the role of glutathione in busulfan elimination. Biol Blood Marrow Transplant. 2011;17(1):117-23. 17. Lu SC. Regulation of glutathione synthesis. Mol Aspects Med. 2009;30(1-2):42-59. 18. DeLeve LD, Shulman HM, McDonald GB. Toxic injury to hepatic sinusoids: sinusoidal obstruction syndrome (veno-occlusive disease). Semin Liver Dis. 2002;22(1):27-42. 19. Vaughan WP, Carey D, Perry S, Westfall AO, Salzman DE. A limited sampling strategy for pharmacokinetic directed therapy with intravenous busulfan. Biol Blood Marrow Transplant. 2002;8(11):619-24. 20. Rifai N, Sakamoto M, Lafi M, Guinan E. Measurement of plasma busulfan concentration by high-performance liquid chromatography with ultraviolet detection. Therapeutic Drug Monitoring. 1997;19(2):169-74. 21. Storci G, Sansone P, Mari S, D'Uva G, Tavolari S, Guarnieri T, et al. TNFalpha up-regulates SLUG via the NF-kappaB/HIF1alpha axis, which imparts breast cancer cells with a stem celllike phenotype. J Cell Physio. 2010;225(3):682-91. 22. Tregouet DA, Garelle V. A new JAVA interface implementation of THESIAS: Testing haplotype Effects In Association Studies. BioInformatics. 2007;23(8):1038-9. 23. Bearman SI. Toxicities of stem cell transplantation regimens. In: Atkinson K, Champlin R, Ritz J, Fibbe WE, Ljungman P and Brenner MK, editors. Clinical bone marrow and blood stem cell transplantation. Cambridge: Cambridge University Press; 2004. p.1301-56. 24. Ning B, Wang C, Morel F, Nowell S, Ratnasinghe DL, Carter W, et al. Human glutathione Stransferase A2 polymorphisms: variant expression, distribution in prostate cancer cases/controls and a novel form. Pharmacogenetics. 2004;14(1):35-44. 25. Maekawa K, Hamaguchi T, Saito Y, Tatewaki N, Kurose K, Kaniwa N, et al. Genetic variation and haplotype structures of the glutathione S-transferase genes GSTA1 and GSTA2 in Japanese colorectal cancer patients. Drug Metab Pharmacokinet. 2011;26(6):646-58. 26. Coles BF, Morel F, Rauch C, Huber WW, Yang M, Teitel CH, et al. Effect of polymorphism in the human glutathione S-transferase A1 promoter on hepatic GSTA1 and GSTA2 expression. Pharmacogenetics. 2001;11(8):663-9. 27. Zhang W, Modén O, Mannervik B. Differences among allelic variants of human glutathione transferase A2-2 in the activation of azathioprine. Chem Biol Interact. 2010;186(2):110-7. 28. Hayes JD, Flanagan JU, Jowsey IR. Glutathione transferases. Annu Rev Pharmacol Toxicol. 2005;45:51-88. 29. Pasparakis M. Regulation of tissue homeostasis by NF-kappaB signalling: implications for inflammatory diseases. Nat Rev Immunol. 2009;9(11):778-88. 30. Kawase A, Tsunokuni Y, and Iwaki M. Effects of Alterations in CAR on Bilirubin Detoxification in Mouse Collagen-Induced Arthritis. Drug Metab Dispos. 2007;35(2):256-61. 31. Assenat E, Gerbal-Chaloin S, Larrey D, Saric J, Fabre JM, Maurel P, et al. Interleukin 1beta inhibits CAR-induced expression of hepatic genes involved in drug and bilirubin clearance. Hepatology. 2004;40(4):951-60. 32. van de Steeg E, Stránecký V, Hartmannová H, Nosková L, Hřebíček M, Wagenaar E, et al. Complete OATP1B1 and OATP1B3 deficiency causes human Rotor syndrome by interrupting conjugated bilirubin reuptake into the liver. J Clin Invest. 2012;122(2):519-28. 33. Huang W, Zhang J, Chua SS, Qatanani M, Han Y, Granata R, et al. Induction of bilirubin clearance by the constitutive androstane receptor (CAR). Proc Natl Acad Sci U S A. 2003;100(7):4156-61. 34. Landi S, Gemignani F, Neri M, Barale R, Bonassi S, Bottari F, et al. Polymorphisms of glutathione-S-transferase M1 and manganese superoxide dismutase are associated with the risk of malignant pleural mesothelioma. Int J Cancer. 2007;120(12):2739-43. 35. Goekkurt E, Stoehlmacher J, Stueber C, Wolschke C, Eiermann T, Iacobelli S, et al. Pharmacogenetic analysis of liver toxicity after busulfan/cyclophosphamide-based allogeneic hematopoietic stem cell transplantation. Anticancer Res. 2007;27(6C):4377-80. 36. Tetlow N, Board PG. Functional polymorphism of human glutathione transferase A2. Pharmacogenetics. 2004;14(2):111-6. 37. Morel F, Rauch C, Coles B, Le Ferrec E, Guillouzo A. The human glutathione transferase alpha locus: genomic organization of the gene cluster and functional characterization of the genetic polymorphism in the hGSTA1 promoter. Pharmacogenetics. 2002;12(4):277-86. 38. Kusama M, Kubota T, Matsukura Y, Matsuno K, Ogawa S, Kanda Y, et al. Influence of glutathione S-transferase A1 polymorphism on the pharmacokinetics of busulfan. Clin Chim Acta. 2006;368(1-2):93-8. 39. Johnson L, Orchard PJ, Baker KS, Brundage R, Cao Q, Wang X, et al. Glutathione S-transferase A1 genetic variants reduce busulfan clearance in children undergoing hematopoietic cell transplantation. J Clin Pharmacol. 2008;48(9):1052-62. 40. Kim SD, Lee JH, Hur EH, Lee JH, Kim DY, Lim SN, et al. Influence of GST gene polymorphisms on the clearance of intravenous busulfan in adult patients undergoing hematopoietic cell transplantation. Biol Blood Marrow Transplant. 2011;17(8):1222-30. 41. Abassi N, Vadnais B, Knutson JA, Blough DK, Kelly EJ, O'Donnell PV, et al. Pharmacogenetics of intravenous and oral busulfan in hematopoietic cell transplant recipients. J Clin Pharmacol. 2011;51(10):1429-38. 42. Ansari M, Lauzon-Joset JF, Vachon MF, Duval M, Théoret Y, Champagne MA, et al. Influence of GST gene polymorphisms on busulfan pharmacokinetics in children. Bone Marrow Transplant. 2010;45(2):261-7. 43. Zwaveling J, Press RR, Bredius RG, van Derstraaten TR, den Hartigh J, Bartelink IH, et al. Glutathione S-transferase polymorphisms are not associated with population pharmacokinetic parameters of busulfan in pediatric patients. Ther Drug Monit. 2008;30(4):504-10. 44. DeLeve LD, Wang X. Role of oxidative stress and glutathione in busulfan toxicity in cultured murine hepatocytes. Pharmacology. 2000;60(3):143-54. 45. Ferrà C, de Sanjosé S, Gallardo D, Berlanga JJ, Rueda F, Marìn D, et al. IL-6 and IL-8 levels in plasma during hematopoietic progenitor transplantation. Haematologica. 1998;83(12):1082-7. Tables Table 1. Clinical characteristics of patients Busulfan cohort Comparator cohort (n=185) (n=146) median range Age (years) 41 (18-59) 43 (16-61) Interval diagnosis-transplant (months) 18 (2-128) 20 (2-240) Follow up (months) 31 (1-238.7) 38.9 (1-239.2) § Years of transplant median § range na (2005-2009) na N (%) N (%) Gender (males/females) 110/75 (59.4/60.6) 85/59 (58.2/61.8) Type of donor (Sibling/Unrelated) 97/88 (52.4/47.6) 65/81 (44.5/55.5) Sex mismatch (male recipient/female donor) 39 (21.1) 32 (21.9) Early phase at transplant* 85 (45.9) 47 (32.2) Myeloablative conditioning regimen 179 (96.8) 61 (41.8) Anti-thymocyte globulin 126 (68.1) 99 (67.8) Acute Myeloid Leukemia 90 (48.7) 29 (19.9) Acute Lymphoblastic leukemia 35 (18.9) 23 (15.8) Myelodisplastic syndromes 8 (4.3) 4 (2.7) Multiple Myeloma 9 (4.9) 28 (19.2) Lymphomas 10 (5.4) 50 (34.2) Chronic Myeloid Leukemia 27 (14.6) 10 (6.8) Other 6 (3.2) 2 (1.4) Bone Marrow 78 (42.2) 68 (46.6) Peripheral Blood 101 (54.6) 76 (52.1) Cord Blood 6 (3.2) 2 (1.3) (2005-2009) Diagnosis Source of HSC Footnote: §not applicable; *early phase at transplant: acute leukemia in 1st complete remission or myeloid leukemia in1st chronic phase. Table 2. Multivariate Cox analysis of overall survival (OS), transplant related mortality (TRM) and 100-day TRM. OS [95% CI] TRM Variables RR p Age 1.004 [0.980-1.029] 0.746 Interval diagnosis-transplant RR [95% CI] 100-day TRM p RR [95% CI] p 1.040 [0.996-1.085] 0.074 1.030 [0.982-1.080] 0.226 0.995 [0.981-1.010] 0.525 1.004 [0.983-1.026] 0.716 1.003 [0.980-1.026] 0.801 Sex donor/recipient (female/male vs others) 1.579 [0.834-2.989] 0.161 1.443 [0.475-4.384] 0.518 0.432 [0.096-1.938] 0.273 Type of donor (unrelated vs sibling) 1.467 [0.871-2.470] 0.150 1.173 [0.500-2.571] 0.714 1.010 [0.388-2.631] 0.983 Conditioning regimen (myeloablative vs reduced intensity) 0.216 [0.029-1.597] 0.133 0.522 [0.068-4.020] 0.533 1.665 [0.210-13.172] 0.629 Phase at transplant (advanced vs early) 4.083 [2.295-7.265] 0.0001 3.547 [1.331-9.452] 0.011 6.269 [1.734-22.659] 0.005 GSTA2 S112T (ser/ser vs thr+) 2.388 [1.407-4.052] 0.001 4.912 [2.083-11.583] 0.0002 5.185 [1.971-13.641] 0.001 Footnote: The effect of GSTA2 S112T locus remained significant in multivariate analysis even when patients who received reduced intensity conditioning regimen (n=6) were removed: OS, RR=2.183 95%CI: 1.283-3.716, p=0.004; TRM, RR=3.821 95%CI: 1.645-9.018, p=0.002 Table 3 Multivariate Cox analysis of TRM and OS according to GSTA2 S112T- GSTA1*A/B haplotypes. Haplotype TRM OS RR [95% CI] p RR [95% CI] p Thr- GSTA1*A 1 / / 1 / / Thr- GSTA1*B 1.744 [0.533-5.695] 0.356 1.5428 [0.733-3.243] 0.252 Ser- GSTA1*A 3.081 [1.281-7.431] 0.011 2.3663 [1.348-4.145] 0.002 Ser- GSTA1*B 1.889 [1.046-3.388] 0.034 1.6771 [1.116-2.427] 0.005 25 Figure legends Figure 1. GSTA2 S112T locus affects OS and TRM in patients prepared with busulfan. A, Kaplan-Meyer analysis of OS, B, TRM at any time and C, 100-day TRM according to GSTA2 S112T genotypes (ser/ser, n=38; thr+, n=142); p-values refer to log-rank test; D: pie-chart representation of 100-day TRM causes of death in ser/ser (n=9) and thr+ (n=12) patients. In particular, in serine homozygotes the organ toxicity was: liver (2 patients), liver and renal (1 patient), gut (2 patients), heart (1 patient). In threonine carriers the organ involvement was liver (1 patient), hearth (1 patient). Figure 2. GSTA2 S112T locus impacts serum bilirubin and plasma busulfan levels. A, busulfan AUC in patients receiving busulfan according to GSTA2 S112T genotypes (ser/ser, n=8, thr+, n=56); p values refer to multivariate GLM adjusted for age, sex, BMI and source of HSC. B, bilirubin serum levels according to GSTA2 S112T genotypes (ser/ser, n=20, thr+, n=99) from pre-transplant to 35 days post-transplant; p value is referred to GLM Anova for repeated measures, adjusted for age, sex mismatch, interval from diagnosis to transplant, intensity of conditioning and disease phase at transplant. Figure 3. Exposure to busulfan and GSTA2 knockdown induce a pro-inflammatory response and reduce the expression of CAR, ABCC2, SLCO1B1 and SLCO1B3 in human hepatoma cells (HepG2). A, cell death analysis of HepG2 cells transfected with control (Ctr) or GSTA2 specific siRNA (siGSTA2) exposed to increasing busulfan concentrations; B, NF-kappaB luciferase assay in HepG2 cells exposed to increasing busulfan concentrations; C, NF-kappaB luciferase assay and Interleukin-8 (IL-8) real time PCR analysis in Ctr/siGSTA2 transfected HepG2 cells exposed to increasing busulfan concentrations; D, real-time PCR analysis of GSTA2, CAR, ABCC2 SLCO1B1 26 and SLCO1B3 mRNA level in Ctr/siGSTA2 transfected HepG2 cells exposed to increasing busulfan concentrations; E, real-time PCR analysis of GSTA2, CAR and ABCC2 mRNA level in HepG2 cells exposed to increasing busulfan concentrations; F, descriptive picture of the proposed mechanism: busulfan exposure triggers hepatic inflammatory activation which associates with the down-regulation of genes involved in bilirubin metabolism, namely GSTA2, CAR, ABCC2, SLCO1B1, SCLO1B3. This phenomenon is amplified by decreased levels of GSTA2 and, speculatively, in serine GSTA2S112T allele carriers. 27 Supplementary Table 1. Genotype frequency distributions in the Busulfan and in the Comparator cohort. Busulfan color (n=185) Comparator cohort (n=146) Polymorphism Nucleotide change MAF Region Protein Genotypes N (%) Genotypes N (%) HW (p) ABCB1 rs1045642 T>A 0.43 coding I1145I TT 62 (34) TA 87 (47) AA 36 (19) TT 38 (26) TA 76 (52) AA 32 (22) >0.05 ABCC1 rs45511401 G>T 0.04 coding G671V GG 175 (95) GT 10 (5) TT 0 (0) GG 131 (91) GT 13 (9) TT 0 (0) >0.05 ABCC4 rs2274407 C>A 0.02 coding N304K CC 154 (84) AC 28 (15) AA 1(1) AA 124 (86) AC 21 (14) AA 0 (0) >0.05 ABCC4 rs11568658 G>T 0 coding G187W GG 167 (90) GT 18 (10) TT 0 (0) GG 135 (94) GT 8 (5) TT 1 (1) >0.05 ABCC4 rs9561778 G>T 0.18 intronic --- GG 118 (64) GT 63 (34) TT 3 (2) GG 106 (73) GT 38 (26) TT 2 (1) >0.05 CBS rs5742905 T>C 0.00 coding I278T TT 172 (93) CT 13 (7) CC 0 (0) TT 134 (92) CT 11 (8) CC 0 (0) >0.05 CBS rs234706 C>T 0.33 coding Y233Y CC 87 (47) CT 84 (45) TT 14 (8) CC 74 (51) CT 54 (37) TT 18 (12) >0.05 CBS rs72958776 ins68bp 0.03 intronic/coding --- wt 156 (85) wt/ins 27 (15) - wt 132 (92) wt/ins 11 (8) - -- CTH rs482843 G>A 0.41 upstream gene --- GG 66 (36) AG 96 (52) AA 23 (12) GG 49 (34) AG 62 (43) AA 34 (23) >0.05 CYP2B6 rs8192719 C>T 0.28 intronic --- CC 92 (50) TC 77 (42) TT 16 (8) CC 79 (54) TC 59 (40) TT 8 (6) >0.05 CYP2C9 rs1057910 A>C 0.06 coding I359L AA 177 (96) CA 8 (4) CC 0 (0) AA 137 (94) CA 9 (6) CC 0 (0) >0.05 CYP2C19 rs4244285 G>A 0.16 coding P227P GG 135 (73) AG 46 (25) AA 4 (2) GG 97 (67) AG 45 (31) AA 3 (2) >0.05 GCLM rs2301022 G>A 0.40 intronic --- GG 78 (42) AG 87 (47) AA 20 (11) GG 55 (38) AG 73 (50) AA 18 (12) >0.05 GCLC rs17883901 C>T 0.09 upstream gene --- CC 156 (85) CT 27 (15) TT 0 (0) CC 118 (81) CT 27 (18) TT 1 (1) >0.05 GGT1 rs17004876 A>G 0.11 coding N419D AA 166 (90) AG 19 (10) GG 0 (0) AA 133 (91) AG 13 (9) GG 0 (0) >0.05 GPX1 rs1050450 C>T 0.12 coding P200L CC 82 (44.5) CT 82 (44.5) TT 20 (11) CC 62 (43) CT 59 (41) TT 22 (16) >0.05 GPX2 rs17881652 C>T 0.01 coding P126L CC 180 (97) CT 5 (3) TT 0 (0) CC 143 (98) CT 3 (2) TT 0 (0) >0.05 GPX3 rs3763013 A>G 0.33 upstream gene --- AA 80 (43) AG 77 (42) GG 27 (15) AA 61 (42) AG 70 (48) GG 15 (10) >0.05 GSTA1 rs4715332 T>G 0.41 upstream gene --- TT 53 (29) GT 97 (53) GG 34 (18) TT 47 (32) GT 75 (51) GG 24 (17) >0.05 GSTA1 rs3957356 G>A 0.37 upstream gene --- GG 54 (30) GA 96 (52) AA 33 (18) GG 48 (33) GA 73 (50) AA 24 (17) >0.05 GSTA1 rs1051775 A>G 0.31 coding K125K AA 60 (33) GA 89 (49) GG 34 (18) AA 47 (32) GA 76 (53) GG 22 (15) >0.05 GSTA2 rs2180314 C>G 0.43 coding S112T CC 57 (32) CG 85 (47) GG 38 (21) CC 45 (33) CG 63 (46) GG 30 (23) >0.05 Gene/Locus GSTM1 null allele gene deletion 0.47 coding --- wt/wt or wt/null 77(44) null 99 (56) --- wt/wt or wt/null 67 (49) null 71 (51) --- --- GSTP1 rs1138272 C>T 0.097 coding A114V CC 160 (86) TC 24 (13) TT 1 (1) CC 129 (89) TC 16 (11) TT 0 (0) >0.05 GSTP1 rs1695 A>G 0.41 coding I105V AA 101 (54) AG 66 (36) GG 18 (10) AA 74 (51) AG 56 (39) GG 14 (10) >0.05 null 40 (23) --- wt/wt or wt/null 112 (81) null 26 (19) --- --- GSTT1 null allele gene deletion 0.2 coding --- wt/wt or wt/null 136 (77) MGST1 rs7970208 G>A 0.49 upstream gene --- AA 63 (34) AG 89 (48) GG 33 (18) AA 40 (27) AG 76 (52) GG 30 (21) >0.05 MGST1 rs2239676 C>G 0.08 intronic --- CC 166 (89) CG 18 (10) GG 1 (1) CC 128 (88) CG 16 (11) GG 2 (1) >0.05 MGST1 rs11875 G>A 0.09 3' UTR --- GG 156 (84) AG 27 (15) AA 2 (1) GG 129 (88) AG 16 (11) AA 1 (1) >0.05 MTHFR rs1801131 A>C 0.36 coding E429A AA 95 (51) CA 77 (42) CC 13 (7) AA 73 (50) CA 57 (39) CC 15 (10) >0.05 MTR rs1805087 A>G 0.16 coding D919G AA 129 (70) GA 51 (28) GG 4 (2) AA 103 (71) GA 41 (28) GG 2 (1) >0.05 MTRR rs1532268 C>T 0.31 coding S175L CC 75 (40) CT 83 (45) TT 27 (15) CC 70 (48) CT 62 (42) TT 14 (10) >0.05 MTRR rs1801394 A>G 0.45 coding I22M AA 63 (34) GA 91 (49) GG 31 (17) AA 48 (33) GA 60 (41) GG 37 (26) >0.05 NAT1 rs4986782 G>A 0.01 coding R187Q GG 180 (98) GA 4 (2) AA 0 (0) GG 138 (95) GA 7 (5) AA 0 (0) >0.05 NAT2 rs1801280 T>C 0.44 coding I114T TT 67 (36) CT 88 (48) CC 30 (16) TT 47 (32) CT 71 (49) CC 28 (19) >0.05 NAT2 rs1799930 G>A 0.30 coding R197Q GG 94 (51) AG 71 (38) AA 20 (11) GG 73 (50) AG 59 (40) AA 14 (10) 0.013 PON1 rs854560 T>A 0.38 coding L55M AA 76 (41) TA 77 (42) TT 32 (17) AA 60 (41) TA 59 (41) TT 26 (18) 0.021 TCNI rs34324219 G>T 0.125 coding D301Y GG 141 (77) GT 38 (21) TT 4 (2) GG 113 (77) GT 30 (21) TT 3 (2) >0.05 TCN2 rs1801198 C>G 0.45 coding P259R CC 67 (36) GC 88 (48) GG 30 (16) CC 58 (40) GC 62 (42) GG 26 (18) >0.05 TCN2 rs4820889 G>A 0.042 coding R399Q GG 174 (94) AG 11 (6) AA 0 (0) GG 136 (93) AG 10 (7) AA 0 (0) >0.05 Footnote: MAF: minor allele frequency in Caucasian European (www.ncbi.nlm.nih.gov/snp ); HW: Hardy-Weinberg; ins: insertion; wt: wild-type. Supplementary Table 2. List of primers for SequenomTM analysis. Gene/Locus Polymorphism First Primer Second Primer Extension Primer Multiplex ABCB1 rs1045642 ACGTTGGATGACTGCAGCATTGCTGAGAAC ACGTTGGATGTATGTTGGCCTCCTTTGCTG CTCCTTTGCTGCCCTCAC 1 ABCC1 rs45511401 ACGTTGGATGCGTTTCAGCATCACCTTCTC ACGTTGGATGTGAGAGCAGGGACGACTTTC ccaACGGCCACCAAAGCA 2 ABCC4 rs2274407 ACGTTGGATGTATCTGGTTGACATCACTGC ACGTTGGATGGGCAGGAACTTCTCAGAATC ctaAGAATCTTGGAAATCTCCTT 1 ABCC4 rs11568658 ACGTTGGATGTTTCAGGCACTTCGTCTTAG ACGTTGGATGCAGCAGATTGACTATCTGGC GGCCTGTGGTTGTCTTCC 2 ABCC4 rs9561778 ACGTTGGATGAGTAGGAAGCATAGAGAACG ACGTTGGATGAGCCATAACTGTACTTGGTC CATTCTCCTTCCCTTCC 3 CBS rs234706 ACGTTGGATGACGGGCTCTGCTCTCTTTC ACGTTGGATGGGCAGGAACTTCTCAGAATC gagaATCAGCGGTGGTGTC 1 CBS rs5742905 ACGTTGGATGTCTGCGAGGATGGACCCTTC ACGTTGGATGTTTTGCTGGCCTTGAGCCCT CTGAAGCCGCGCCCTCTGCAGATCA 3 CTH rs482843 ACGTTGGATGGCAATTGAAAAGCTCTTGAC ACGTTGGATGAACATGGAGAATTGCTCCCC CCCCTAAAATGTTTTCTCTCTGATAT 4 CYP2B6 rs8192719 ACGTTGGATGTAAGCTGGACCCACAATTTC ACGTTGGATGGTATCTCTCGTTGTTTTTCTC ccCTCGTTGTTTTTCTCAAGTTG 4 CYP2C19 rs4244285 ACGTTGGATGCACTTTCCATAAAAGCAAGG ACGTTGGATGGCAATAATTTTCCCACTATC CCCACTATCATTGATTATTTCCC 4 CYP2C9 rs1057910 ACGTTGGATGGGCAGGCTGGTGGGGAGAA ACGTTGGATGACATGCCCTACACAGATGCT ttTGGTGCACGAGGTCCAGAGATAC 5 GCLC rs17883901 ACGTTGGATGAGGCGTGTGCAAGGGTGAT ACGTTGGATGTTTGCGTAAAGCGAGGCCGA gTCTCGCGAGCTGCTCCCCTCAACTG 3 GCLM rs2301022 ACGTTGGATGGAAGCACCCTAAATAAAACAC ACGTTGGATGGAGTCACACACCACAGTTTG gggcAAACATTGTTCAAAGGACTA 5 GGT1 rs17004876 ACGTTGGATGATGCTGGGAGAGCTGAAGTC ACGTTGGATGTCTACTTTGGCTCCAAGGTC ggGCGGGATCCTGTTCAAT 1 GPX2 rs17881652 ACGTTGGATGTCTTCGCCTACCTGAAGGAC ACGTTGGATGAATGATGAGCTTGGGATCGG GGGAAAATGGGTCATCATAA 3 GPX3 rs3763013 ACGTTGGATGGTGGACAACTGAGATCAGAG ACGTTGGATGCCAGAGACCTGAGATGCTAC acattCTACCCCTGGATTGCTAC 5 GSTA1 rs1051775 ACGTTGGATGCCACCTGAGGAAAAAGATGC ACGTTGGATGTTCAAAGGCAGGGAAGTAGC AGTAGCGATTTTTTATTTTCTC 6 GSTA1 rs4715332 ACGTTGGATGGAGTGACGCAAAGAGGATAG ACGTTGGATGACATTTAGGTGGGTATCCTG ttTATCCTGTATTTTATCTGACAAATC 5 GSTA1 rs3957356 ACGTTGGATGGCTTTTCCCTAACTTGACTC ACGTTGGATGATAAGCTCTTTGTTCCTCTC CTTTGTTCCTCTCAATAGTTC 7 GSTA2 rs2180314 ACGTTGGATGGAAGGTATAGCAGATTTGGG ACGTTGGATGGCAAGCTTGGCATCTTGTTC gaATCTTGTTCCTCAGGTTGA 8 GSTP1 rs1138272 ACGTTGGATGTGATACATGGTGGTGTCTGG ACGTTGGATGTCAAAAGGCTTCAGTTGCCC ttccCATAGTCATCCTTGCCC 8 GSTP1 rs1695 ACGTTGGATGTGGTGCAGATGCTCACATAG ACGTTGGATGTGGTGGACATGGTGAATGAC ACCTCCGCTGCAAATAC 2 MGST1 rs2239676 ACGTTGGATGCCAAACCCCTCCTCTAAATC ACGTTGGATGAGAAGGGCTCAAAGGGAATC tttgtAATCAGCAGGCGATGGTTACT 5 MGST1 rs11875 ACGTTGGATGGTACAGAATTCTTAAAAAGCC ACGTTGGATGGCTTACAGGTTGCTGAAAAG CCTGTAAAGAAAATCATACAACTCA 5 MGST1 rs7970208 ACGTTGGATGATGGATCTATCTTTCATGGG ACGTTGGATGGAGATATAGCACTAGGAGAG gagACAGAAATCCTTAAACATTTCTC 4 MTHFR rs1801131 ACGTTGGATGTCTCCCGAGAGGTAAAGAAC ACGTTGGATGAGGAGCTGCTGAAGATGTGG ggaGAGCTGACCAGTGAAG 6 MTR rs1805087 ACGTTGGATGCTTTGAGGAAATCATGGAAG ACGTTGGATGTACCACTTACCTTGAGAGAC CCTTGAGAGACTCATAATGG 8 MTRR rs1532268 ACGTTGGATGTGTAGCAGCTCTGACTTCAC ACGTTGGATGACAAGAGGAGATAAGTGGCG CATCACCTGCATCCT 1 MTRR rs1801394 ACGTTGGATGCTATATGCTACACAGCAGGG ACGTTGGATGGCAGAAAATCCATGTACCAC CACAGCTTGCTCACA 1 NAT1 rs4986782 ACGTTGGATGCTGATCTCCTAGAAGACAGC ACGTTGGATGAATCTTCAATTGTTCGAGGC gTAAGAGTAAAGGAGTAGATTTTT 8 NAT2 rs1801280 ACGTTGGATGTCTGGGAGGAGCTTCCAGAC ACGTTGGATGCATGGTTCACCTTCTCCTGC TCCTGCAGGTGACCA 8 NAT2 rs1799930 ACGTTGGATGTCATAGACTCAAAATCTTC ACGTTGGATGCCTGCCAAAGAAGAAACACC tcatcTACTTATTTACGCTTGAACCTC 3 PON1 rs854560 ACGTTGGATGGAGCTAATGAAAGCCAGTCC ACGTTGGATGTTTCTGGCAGAAACTGGCTC cagcAACTGGCTCTGAAGAC 6 TCN2 rs1801198 ACGTTGGATGCCTCACTCTATCACCAGTTC ACGTTGGATGGCCTTGAGACATGCTGTTCC CCCAGTTCTGCCCCA 8 TCN2 rs4820889 ACGTTGGATGCATGACTCACCTTGCAACAG ACGTTGGATGTACTTAACCTCCGTGATGGG ccacGTTCTGGCAGCTTCTCC 1 TCNI rs34324219 ACGTTGGATGAGGTCTTACCTGCCCTGATG ACGTTGGATGTATACCTGAAGCAGAGACGC GACGCAAGAAGAGTCTTTGTTAATAT 1 Supplementary Table 3. Multivariate Cox analysis of TRM and OS in busulfan and comparator cohorts. GENE LOCUS busulfan color Comparator color (n=185) (n=146) TRM OS TRM OS p p p p ABCB1 rs1045642 ns ns ns ns ABCC1 rs45511401 Ns ns ns ns ABCC 4 rs2274407 ns ns ns ns ABCC 4 rs11568658 ns ns ns 0.018 ABCC 4 rs9561778 ns ns ns 0.013 CBS rs5742905 ns ns ns ns CBS rs234706 ns ns ns ns CBS ins 68bp ns ns ns ns CTH rs482843 ns ns ns ns CYP2B6 rs8192719 ns ns ns ns CYP2C9 rs1057910 ns ns ns ns CYP2C19 rs4244285 0.05 ns ns ns GCLM rs2301022 ns ns ns ns GCLC rs17883901 ns ns ns ns GGT 1 rs17004876 ns ns 0.014 ns GPX 1 rs1050450 ns ns ns ns GPX2 rs17881652 ns ns ns 0.014 GPX3 rs3763013 ns ns ns ns GSTA1 rs1051775 0.04 ns ns ns GSTA1 rs4715332 0.05 ns ns ns GSTA1 rs3957356 0.05 ns ns ns GSTA 2 rs2180314 0.001 0.005 ns ns GSTM 1 rs1065410 ns 0.04 ns ns GSTM 1 rs366631 ns ns ns ns GSTP 1 rs1138272 ns ns ns ns GSTP 1 rs1695 ns ns ns 0.014 GSTT 1 rs2266637 ns 0.02 ns ns mGST1 rs7970208 0.01 0.05 ns ns mGST1 rs2239676 ns ns ns ns MGST1 rs11875 ns ns ns ns MTHFR rs1801131 ns ns ns ns MTR rs1805087 ns ns ns ns MTRR rs1532268 ns ns ns ns MTRR rs1801394 ns ns ns ns NAT1 rs4986782 ns ns ns ns NAT2 rs1801280 ns ns ns ns NAT2 rs1799930 ns ns ns ns PON1 rs854560 ns ns ns ns TCN I rs34324219 ns 0.04 ns ns TCN2 rs1801198 ns ns ns ns TCN2 rs4820889 ns ns ns ns Footnote: all p-values are referred to multivariate Cox analysis: for each polymorphism as covariate age, sex mismatch, disease phase, type of donor, interval to transplant and intensity of conditioning were included with covariates. Adjustment for multiple comparisons was made, leading to significant p-value threshold = 0.00125. Supplementary Table 4. GSTA2 S112T-GSTA1 two loci haplotypes frequency estimates and linkage disequilibrium coefficients (D’). GSTA2-GSTA1 S112T-rs1051775 S112T-rs3957356 S112T-rs4715332 Haplotype Estimated frequency Thr-A 0.478 Thr-G 0.072 Ser-A 0.092 Ser-G 0.358 Thr-G 0.485 Thr-A 0.067 Ser-G 0.093 Ser-A 0.355 Thr-T 0.475 Thr-G 0.076 Ser-T 0.077 Ser-G 0.372 Linkage Disequilibrium D’ p 0.70 <0.0001 0.72 <0.0001 0.69 <0.0001 Supplementary Table 5. GSTA2 S112T-GSTA1*A/B haplotype frequency estimation. Haplotype Estimated frequency Thr-GSTA1*A 0.485 Thr-GSTA1*B 0.062 Ser-GSTA1*A 0.057 Ser-GSTA1*B 0.354 Others 0.042 Footnote: GSTA1*A haplotype is set up by the G allele at rs3957356 locus and the T allele at rs4715332 locus; GSTA1*B haplotype is set up by the A allele at rs3957356 locus and the G allele at rs4715332 locus, as previously reported26. Supplementary Table 6 Multivariate Cox analysis of TRM and OS according to two loci GSTA2-GSTA1 haplotypes. TRM OS GSTA2-GSTA1 Haplotype RR [95% CI] p RR [95% CI] p S112T-rs1051775 Thr-A 1 / / 1 / / Thr-G 2.271 [0.635-8.116] 0.206 1.529 [0.724-3.232] 0.265 Ser-A 3.076 [1.305-7.248] 0.010 2.320 [1.312-4.104] 0.003 Ser-G 2.187 [1.163-4.113] 0.015 1.630 [1.129-2.354] 0.009 Thr-G 1 / / 1 / / Thr-A 1.936 [0.563-6.654] 0.297 1.454 [0.693-3.053] 0.321 Ser-G 3.083 [1.387-6.851] 0.006 2.502 [1.268-3.787] 0.006 Ser-A 1.884 [1.016-3.492] 0.044 1.569 [1.063-2.221] 0.022 Thr-T 1 / / 1 / / Thr-G 2.271 [0.635-8.117] 0.206 1.525 [0.722-3.220] 0.268 Ser-T 3.076 [1.305-7.248] 0.010 2.433 [1.403 -4.217] 0.001 Ser-G 2.187 [1.163-4.113] 0.015 1.529 [1.058 -2.211] 0.023 S112T-rs3957356 S112T-rs4715332 Supplementary Table 7. Multivariate Cox analysis of Relapse in Busulfan cohort. Variables RR [95% CI] p Age 0.986 0.959-1.013 0.312 Interval diagnosis- transplant 0.989 0.972-1.007 0.233 Sex donor/recipient (female/male vs others) 0.939 0.472-1.867 0.857 Type of donor (unrelated vs sibling) 0.708 0.381-1.317 0.276 Conditioning regimen (myeloablative vs reduced-intensity) 3.315 0.436-25.219 0.247 Phase at transplant (advanced vs early*) 3.3976 2.111-7.491 0.0001 GSTA2 S112T (ser/ser vs thr+) 1.332 0.672-2.641 0.411 Supplementary Table 8. Multivariate analysis of GSTA2 S112T locus on liver function tests. Liver function tests Anova for repeated measures F-statistics p Aspartate transaminase (AST) 0.002 0.957 Alanine transaminase (ALT) 0.095 0.759 Alkaline phosphatase (ALP) 1.050 0.309 Gamma-glutamyl transferase (GGT) 0.118 0.732 Cholinesterase (AChE) 0.285 0.598 Footnote: ANOVA for repeated measures, adjusted for age, phase at transplant, intensity of conditioning, interval between diagnosis and transplant and sexmismatch. Time points for plasma liver function tests were: baseline (day of admittance at BMT Unit), day 0, +7, +14, +21, +28 and +35 after transplant.