Download embj201490350-sup-0010

SUPPLEMENTARY INFORMATION
Supplementary Methods
Construction of modified MultiBac transfer vector pFBDM4. In order to adjust the original MultiBac
transfer vector pFBDM (Berger et al, 2004) to the used cloning strategy, both multiple cloning sites were
exchanged. Single-stranded DNA oligomers MCS1-BamHI-HindIII-F and MCS1-BamHI-HindIII-R as well as
MCS2-Acc65I-SmaI-F and MCS2-Acc65I-SmaI-R (for sequences see below) were synthesized by Biomers.
Lyophilized DNA was resuspended in ddH2O and complementary DNA oligomers were diluted in 10 mM
Tris, pH 7.4, to a final concentration of 10 µM each, incubated at 70°C for 10 min and cooled down at RT
for 30 min. Five micrograms of pFBDM vector DNA was hydrolyzed using 10 units of BamHI and HindIII
(Fermentas) at 37°C for 1 h. DNA fragments were separated by agarose gel electrophoresis and purified
using the DNA extraction kit from Macherey-Nagel. The previously prepared double-stranded modified
MCS1 was then introduced into 100 ng of linearized pFBDM vector. Likewise, restriction enzymes Acc65I
and SmaI (Fermentas) were applied to exchange MCS2 with a modified one. The resulting pFBDM4 vector
was verified by DNA sequencing (GATC).
MCS1-BamHI-HindIII-F/MCS1-BamHI-HindIII-R oligo pair:
5'-GATCCCGGTCCGAAGCGCGCGAATTCCATATGAAAGGCCTACGCTTTCGAATCTAGAGCCTGCAGTCTCGAGA
- 3'
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'GGCCAGGCTTCGCGCGCTTAAGGTATACTTTCCGGATGCGAAAGCTTAGATCTCGGACGTCAGAGCTCTTCGA-5'
MCS2-Acc65I-SmaI-F/MCS2-Acc65I-SmaI-R oligo pair:
5'-GTACCGCGGCCGCGTCGACCAGCTGCTAGCACCATGGAATCCC-3'
|||||||||||||||||||||||||||||||||||||||
3'GCGCCGGCGCAGCTGGTCGACGATCGTGGTACCTTAGGG-5'
Quantification of Sm protein methylation. X-ray films of methylation reactions were scanned and band
intensities were determined using the software ImageJ. In order to correlate the band intensity obtained
in densitometry with the number of actually transferred methyl groups, excess of pICln-D1/D2 and cofactor was incubated with increasing amounts of His6-PRMT5/WD45 for 60 min at 37°C. The reaction was
1
split and identical amounts were loaded onto an SDS-gel. Whereas the first gel was processed in
autoradiography and densitometry, the second gel was Coomassie-stained and the modified protein
bands were excised. After dissolving the gel slice in 30% (v/v) H2O2 and 30% (v/v) NH2OH (99:1) at 70°C for
16 h, the amount of radioactivity was determined by liquid scintillation counting (LSC). Finally, increasing
amounts of co-factor were directly measured in LSC and correlated to the radioactive signal detected in
the dissolved gel slices. These values could then be associated with the band intensities observed in the
densitometric analysis.
Detection of mono- (MMA) and symmetrically dimethylated arginine residues (sDMA). In order to
determine the formation of MMA and sDMA, the methylated proteins were supplemented with 1 volume
of 10 µM bovine serum albumin (BSA) and precipitated by the addition of 3 volumes of 25% (v/v)
trichloroacetic acid (TCA) at 4°C overnight. After centrifugation at 13,000 ×g for 30 min at 4°C, the
supernatant containing the not incorporated co-factor was removed and the precipitated protein was
washed once in ice-cold acetone. Dried protein samples were resuspended in 100 µl 6 N HCl, transferred
into micro reaction vials (Pierce) and boiled at 110°C for 20 h. Hydrolyzed amino acids were dried in a
SpeedVac Concentrator (Savant) and resuspended in 50 µl ddH2O. Three microliters of the hydrolyzed
protein sample were mixed with 1 µl of arginine standards (0.1 mM final concentration of L-arginine,
MMA, aDMA and sDMA) and loaded onto a Cellulose DEAE/HR-Mix-20 thin layer chromatography (TLC)
plate (20×40 cm; Macherey-Nagel). Individual amino acids were separated for 8–10 h using 75% (v/v)
ethanol and 25% (v/v) ammonium hydroxide as a running buffer. Arginine standards were visualized by
spraying a 0.5% (w/v) ninhydrin solution onto the dried TLC plate.
Reconstitution of wild-type and mutant SMN complexes lacking individual subunits. Wild-type
SMNΔGemin3–5 and SMN(E134K)ΔGemin3–5 were expressed and purified in bacterial cells and His6tagged Gemin5 in insect cells as described above. His6-tagged Gemin3 and Gemin4 were co-expressed in
Sf21 insect cells applying individual baculoviruses. Expression and purification were identical to the one
of obtaining His6-tagged Gemin5 alone, yet, using a pH of 8.5. Fifty picomoles of wild-type and mutant
SMNΔGemin3–5 complexes were then combined with buffer alone (20 mM Hepes-NaOH (pH 7.5), 1 M
NaCl and 5 mM DTT), a 2–fold excess of the heterodimeric His6-Gemin3/His6-Gemin4, His-Gemin5 alone
or a combination of His-tagged Gemin3–5. Subsequently, buffer or a 3–fold excess of 6S or both 6S and
2
pICln-D3/B were added to the previous complexes and incubated in 20 mM Hepes-NaOH (pH 7.5), 200
mM NaCl and 5 mM DTT at 4°C overnight. Reconstituted protein complexes were further dialyzed against
the same buffer lacking DTT for 3h at 4°C. Then, protein complexes were incubated with 7B10 (anti-SMN)
antibody coupled to sepharose beads on an orbital shaker for 60 min at 4°C and 600 rpm. Sepharose beads
were washed sequentially two times in 20 mM Hepes-NaOH (pH 7.5), 200 mM NaCl and 0.01% (vol/vol)
NP40 and three times in the same buffer lacking NP40. Complex formation and Sm protein transfer onto
the SMN complex was performed by SDS-PAGE and subsequent silver staining. Removal of pICln was
verified by Western blotting using anti-pICln antibody.
3
Supplementary Figure Legends
Supplementary Figure 1. Schematic of early and late phase of U snRNP assembly.
Sm proteins form heterooligomers comprising D1/D2, D3/B and F/E/G. These Sm protein
heterooligomers then interact with pICln and associate with the PRMT5 complex. During this step, the
type II methyltransferase PRMT5 causes symmetrical demethylation of arginine residues in Sm proteins
B, D1 and D3. Both pICln-Sm protein constructs 6S (pICln-D1/D2/F/E/G) and pICln-D3/B are incapable of
snRNA binding. Upon interaction of 6S and pICln-D3/B with the SMN complex, pICln is expelled. Sm
proteins associated with the SMN complex are consequently able to specifically interact with snRNA but
not with random RNA sequences.
Supplementary Figure 2. Recombinant PRMT5/WD45 symmetrically dimethylates arginine residues in
the Sm protein B, D1 and D3.
(A) Protein arginine methyltransferases (PRMTs) belong to either of three different types and utilize Sadenosylmethionine (SAM) as a methyl group donor. Whereas all three types catalyze the formation of
monomethylated arginine (MMA, -NG-Monomethyl-L-arginine), type I enzymes also generate
asymmetrically dimethylated arginines (aDMA, -NG,NG-Dimethyl-L-arginine). Type II enzymes
additionally mediate the symmetrical dimethylation of arginines (sDMA, -NG,N’G-Dimethyl-L-arginine).
(B) In the cytoplasm, Sm proteins specifically interact with pICln and occur in two distinct protein
complexes. While the 20S complex consists of PRMT5, WD45 (= MEP50), pICln and the Sm proteins B, D1,
D2 and D3 (left panel), the 6S complex forms a heterohexameric ring comprising pICln and the Sm proteins
D1, D2, F, E and G (right panel). PRMT5 exclusively methylates Sm proteins B, D1 and D3 in their C-terminal
arginine/glycine (RG)-rich domains. (C) His6-PRMT5/WD45 was co-expressed in insect cells (lane 3) and
sequentially purified by metal ion affinity chromatography (IMAC, Ni-NTA, lane 6), anion exchange (HiTrap
Q, lane 7) and gel filtration chromatography (Superose6, lane 8). (D) Methylated proteins were hydrolyzed
to individual amino acids, mixed with arginine standards (L-Arg, MMA, sDMA, aDMA) and applied to thin
layer chromatography. Modified amino acids were visualized by autoradiography (lanes 1–5; exposure
time: 3 weeks) and correlated to the ninhydrin-stained arginine standards (lanes 6–12). The yellow
staining results from the di(p-hydroxyazobenzene-p'-sulfonate) salt which is contained in the sDMA
standard (Sigma-Aldrich).
4
Supplementary Figure 3. Sm protein heterooligomers and pICln-Sm protein complexes.
(A-C) Recombinantly expressed Sm protein heterooligomers. Heterooligomeric complexes were
expressed in bacterial cells and applied to gel filtration chromatography (Superose6 10/300GL): (A) D1/D2,
(B) F/E/G, (C) D3/B. (D-G) In vitro reconstituted pICln-Sm protein complexes. pICln alone or protein
complexes containing a mixture of pICln and Sm proteins were applied to gel filtration chromatography
(Superose6 10/300GL). (D) pICln, (E) pICln-D1/D2, (F) 6S complex (pICln-D1/D2/F/E/G), (G) pICln-D3/B.
Left panel: schematic depiction of protein complex composition, middle panel: SDS-PAGE of gel filtration
samples, right panel: elution profile of gel filtration runs. The red line above the elution profile indicates
the range of elution samples applied to SDS-PAGE.
Supplementary Figure 4. Kinetic analysis of Sm protein methylation by PRMT5/WD45.
(A) Increasing amounts of PRMT5/WD45 were treated with pICln-Sm protein complexes as well as SAM
co-factor. Subsequently, the methylation was analyzed by SDS-PAGE, autoradiography and densitometry.
(B) Constant amounts of pICln-Sm protein complexes were methylated for 0–90 min. The reaction rate
corresponds to the slope during the initial linear increase of methylation. (C) Reaction rates of D1containing substrates were fitted to the Michaelis-Menten equation using non-linear regression. (D)
Reaction rates of D3/B-containing substrates were obtained likewise. Values represent the average of two
separate experiments. Error bars show the standard error of the mean. (D1 in D1/D2: ; D1 in pIClnD1/D2: ; D1 in 6S: ; D3 in D3/B: ; B in D3/B: ; D3 in pICln-D3/B: ; B in pICln-D3/B: )
Supplementary Figure 5. Total reconstitution of the human wild-type and mutant SMN(E134K)
complexes from recombinant sources.
(A) Schematic of the experimental outline. (B) Recombinant SMNΔGemin3–5 was incubated with buffer
alone (lanes 2–4), with Gemin3/Gemin4 (lanes 6–8), Gemin5 (lanes 10–12) or Gemin3/Gemin4/Gemin5
(lanes 14–17) at 4°C overnight. Additionally, no Sm proteins (lanes 2, 6, 10, 14), 6S (lanes 3, 7, 11, 15) or
6S + pICln-D3/B (lanes 4, 8, 12, 16) were added. Protein complexes containing SMN were
immunoprecipitated using the 7B10 antibody (anti-SMN) and applied to SDS-PAGE. Asterisks indicate
degradation products. HC and LC indicate the heavy and the light chain of the antibody, respectively. The
exclusion of pICln from the SMN complex was determined by Western blotting (lower panel, WB). (C)
Reconstitution of the mutant SMN(E134K) complex analogous to B.
5
Supplementary Figure 6. Recombinant SMN(E134K) complex shows defects in snRNP assembly.
(A) Transfer of Sm proteins from pICln complexes to the wild-type and mutant SMN(E134K) complex
consisting of SMN and all seven Gemins 2-8. The respective, immunoprecipitated complexes (labeled on
top) were incubated with either the 6S complex alone (lane 2 and 6), 6S and pICln-D3/B (lane 3 and 7), or
treated with buffer only (lanes 1 and 5). Retained proteins were detected by a SDS-PAGE. (B) Immobilized
complexes from A were subsequently used for EMSA with U1 snRNA. SnRNP formation was analyzed by
native gel electrophoresis (1-3 and 4-7, respectively). Lane 4 shows RNA only.
Supplementary Table 1. Kinetic parameters for the methylation of pICln-Sm protein complexes by
recombinant PRMT5/WD45.
Km and kcat values for pICln-Sm protein complex methylation by PRMT5 were determined by MichaelisMenten analysis, with 1 μM of PRMT5/WD45 following SDS-PAGE, autoradiography and densitometry. All
reported values are the average of two measurements ± s.d. (n = 2 technical repeats).
Substrate
CH3-recipient
Vmax
Km
kcat
kcat Km-1
(pmol CH3 h-1pmol enzyme-1)
(μM)
(s-1)
(s-1 μM-1)
D1/D2
D1
48.531 (+/- 0.81%)
0.238 (+/- 6.73%)
0.013
0.057
pICln-D1/D2
D1
41.786 (+/- 0.75%)
0.358 (+/- 5.86%)
0.012
0.032
6S
D1
37.857 (+/- 1.28%)
0.347 (+/- 4.04%)
0.011
0.03
D3/B
D3
29.997 (+/- 2.99%)
0.29 (+/- 12.74%)
0.008
0.029
D3/B
B
2.301 (+/- 2.52%)
0.142 (+/- 7.72%)
0.001
0.004
pICln-D3/B
D3
57.804 (+/- 1.52%)
0.701 (+/- 3.14%)
0.016
0.023
pICln-D3/B
B
11.381 (+/- 5.7%)
0.359 (+/- 17.26%)
0.003
0.009
References
Berger I, Fitzgerald DJ, Richmond TJ (2004) Baculovirus expression system for heterologous multiprotein
complexes. Nat Biotechnol 22: 1583-1587
6