Download The Pax-6 homeobox gene is expressed throughout the

The Pax-6 Homeobox Gene Is Expressed Throughout the
Corneal and Conjunctival Epithelia
Barba M. Koroma* Jun-Ming
Yang* and OlofH. Sundin*-\
Purpose. Heterozygous defects in the highly conserved PAX6 homeobox gene are associated
with aniridia, an inherited human disorder affecting several ocular structures, including the
adult cornea. This work establishes the pattern of Pax-6 gene expression in the surface epithelia of the late embryonic and adult eye.
Methods. Chick embryo sections and wholemounts, as well as adult mouse and monkey tissues,
were analyzed by in situ hybridization and immunohistochemistry with probes specific to Pax6. Western immunoblots were used to detect Pax-6 protein, and mRNA expression was analyzed by quantitative reverse transcription-polymerase chain reaction.
Remits. In days 5 and 6 chick embryos, Pax-6 protein is found in the nuclei of all cells within
the corneal epithelium and in the future conjunctiva. Although not detected in the cornea
by in situ hybridization, Pax-6 mRNA is, in fact, present at levels comparable to those observed
in the retina. In the mature mouse, Pax-6 protein was expressed in all cells of the corneal
epithelium, the limbus, and the entire conjunctiva. Similar results were obtained for the
monkey cornea.
Conclusions. These data indicate that in additiontoits role in the embryo, Pax-6 is expressed
strongly in surface epithelia of the adult cornea and conjunctiva. In cells of these tissues, the
gene may function by regulating structural or secretory specializations. Pax-6 might play a
direct role in the maintenance and proliferation of corneal stem cells, a vital process that
appears to be defective in aniridia. Invest Ophthalmol Vis Sci. 1997;38:108-120.
From the * Wilmer Eye Institute and the \Department of Molecular Biology and
Genetics, The Johns Hopkins University School of Medicine, Baltimore, Maryland.
Supported by a grant from the Knights Templar Eye Foundation; a grant from Fight
For Sight (Research Division of Prevent Blindness America) in memory of Mary E.
and Alexander P. Hindi; and National Institutes of Health grant R01 EY10729
(ONS). BMK is supported by an NIH Minority Postdoctoral Training Supplement.
OHS is the recipient of a Research to Prevent Blindness Career Development Award.
Received for publication April 5, 1996; revised August 6, 1996; accepted August
28, 1996.
Proprietary interest category: N.
Reprint requests: OlofH. Sundin, Wilmer Eye Institute, The Johns Hopkins
Institution, 840 Maumenee Building, 600 N. Wolfe Street, Baltimore, MD 21287.
and mouse8 and later was identified as the site of mutations responsible for human aniridia9'10 and the phenotypically similar small eye (Sey) mutant of the
mouse.1112 Individuals heterozygous for mutations in
human PAX6 often develop eyes with a greatly reduced iris and with abnormalities of the retina, lens,
and cornea.91013 Those rare individuals homozygous
for mutations in PAX6 are born without eyes and die
shordy afterward, demonstrating that diis gene is essential to human ocular development.14 In mice12 and
rats,15 viable heterozygous animals show ocular abnormalities, including reduction of the iris, whereas homozygotes are anophthalmic, lack nasal epithelia, and
die shordy after birth. Interestingly, die earliest visible
defect in embryos homozygous for mutations in Pax6 is the absence of a lens placode.11'16 This is consistent
with the observation that lens-competent regions
within the future head ectoderm of the neural-plate
stage embryo are the first sites at which chicken and
mouse Pax-6 are expressed during development and
that the early lens placode strongly expresses Paxg i6,i7 -pjie f a j m r e o f e y e formation in Pax-6 homozygous mutant mice appears direcdy linked to absence
108
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1
Copyright © Association for Research in Vision and Ophthalmology
1 he vertebrate eye develops through a complex series of events, beginning with early embryonic primordia located in the head ectoderm and central nervous
system. ' Insight into the molecular basis of this process has been provided recendy by the study of homeobox genes,3'4 a large family of structurally related
genes that are among the key determinants of cell fate
and body plan in vertebrates and invertebrates.0'6 The
homeobox genes encode transcription factors and
function by regulating the expression of other genes.
Pax-6 is a homeobox gene known to play an especially important role in several aspects of eye development. This gene was cloned originally in zebrafish7
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
Pax-6 in Ocular Surface Epithelia
109
METHODS
of the early lens placode, which plays an essential role
in organizing the optic cup.1'2 During later developIsolation, Fixation of Embryos, and Ocular
ment, Pax-6 continues to be expressed in the proliferTissues
ating anterior lens epithelium. It also is expressed in
the undifferentiated retina and in the differentiating
Day 4 (HH stage 18see 28 ), day 5, and day 6 chick (Gallus
amacrine and ganglion cells, suggesting that it has a
gallus) embryos were fixed overnight in freshly chilled
role in ocular tissues of neural as well as ectodermal
MEMFA (0.1 M MOPS, pH 7.4, 2 mM EGTA, 1 mM
origin.8
MgSO4, 3.7% formaldehyde) ( see29 ). The tissue was
The protein encoded by Pax-6 contains a homeorinsed in 0.9% NaCl, equilibrated in 90% methanoldomain and a paired domain, two DNA-binding motifs
water, and stored at — 20°C. Eyes of embryonic days
required for directing the transcription factor to its
10, 13, and 15 chick were dissected from the head,
target sites in the genome.89'18'19 The structure and
opened, and fixed. Freshly killed 30-day-old mice were
function of these domains has been extremely conprovided by the laboratory of Dr. Ruben Adler of the
served through vertebrate evolution, with near idenWilmer Eye Institute (Baltimore, MD). Each mouse
tity between the human and fish.710'18 These domains
was chilled immediately on ice and the entire orbit,
are highly conserved in eyeless, a homologous Drosoph- attached muscles, and eyelids were dissected from the
ila gene essential for eye development.4 This Drosophila head and placed in ice-cold MEMFA for overnight
gene has the remarkable ability to direct other regions
fixation at 4°C. Tissues were from a young adult male
cynomolgus monkey (weight, 11.5 pounds) killed as
of the insect body to develop complete ommatidial
part of a glaucoma study conducted by Dr. Harry Quigeye structures.20 Concerning its regulatory functions,
ley of the Wilmer Eye Institute. The anterior segment
there is evidence that the vertebrate Pax-6 gene binds
of the control eye, which normally would not have
and activates its own promoter.21 Pax-6 is known to
been used in the glaucoma experiments, was placed
regulate directly the transcription of lens crystallin
immediately into ice-cold MEMFA fixative overnight,
genes, including zeta (guinea pig),22 alpha A
then stored in 90% methanol at -20°C as before. Tis(mouse),23 and delta crystallin (chicken).24 As noted
sues were fixed and stored in the same manner for
earlier, patterns of transcription17 and genetic eviboth in situ hybridization and immunohistochemistry.
dence" 16 implicate Pax-6 in several aspects of lens
The care of experimental animals was in accordance
development or regeneration.25 Because Pax-6 expreswith ARVO Statement for the Use of Animals in Ophsion is first required for lens placode development at
thalmic and Vision Research.
a stage well before the activation of crystallin
1116
genes,
Pax-6 must regulate additional genes required for the formation of the lens.
In Situ Hybridization
The lens is not the only ectodermal structure of
In situ hybridization with digoxigenin-labeled Pax-6
the eye that depends on the Pax-6 gene for its normal
riboprobe was carried out as described earlier.17 The
development. In the early optic vesicle-stage chick em512-bp probe was derived from a chicken Pax-6 cDNA
bryo, Pax-6 is expressed strongly in two bilateral
and encoded the 170 carboxy-terminal amino acids of
patches that include the future lens but that extend
the protein.17 Stage 18 (early day 4) and day 5 chick
17
beyond its boundaries. As the center of the lens placembryos were dissected in ice-cold phosphate-bufode invaginates to form the lens vesicle, the peripheral
fered saline and fixed overnight in MEMFA at 4°C.
ectoderm remaining on the surface shows substantial
Stage 18 embryos were processed for wholemount in
expression of Pax-6 mRNA. This peripheral ectoderm
situ hybridization, and this was followed by embedding
of the lens placode is fated to contribute to the corneal
in JB-4 glycolmethacrylate resin (Polysciences, Warand conjunctival ectoderm.1'2 Given the fact that some
rington, PA) and sectioning at 10 (im.17 Day 5 and
individuals with aniridia develop serious abnormalities
later embryos were equilibrated in a solution of 20%
of the cornea in adulthood, we were interested in
sucrose and 20 mM Tris, pH 7.4; this was followed by
determining whether in animal models, Pax-6 contintransfer to OCT medium (Miles Laboratories, Elkhart,
ues to be expressed in these anterior tissues. One of
IN) and by freezing and cryo-sectioning at — 25°C. In
situ hybridization of sections was carried out with the
these abnormalities is the corneal pannus, a localized
same hybridization and wash times used for the
opacification of the cornea often accompanied by an
wholemount technique. For in situ hybridization of
ingrowth of vascular tissue.13'26 Other problems associwholemounts and sections, all hybridization and strinated with aniridia include cataracts and glaucoma.27
gency washes were performed at 63°C in 50% forIn this study, we report that Pax-6 protein and
mamide containing solutions (see refs. 17, 29 for demRNA are expressed at high levels in the adult corneal
tails). Alkaline phosphatase color reaction was perepithelium. We also show that this domain of expresformed
for 16 hours. Sections were postfixed in
sion includes the conjunctiva, thus marking the entire
MEMFA
for 30 minutes at room temperature, then
compartment of the ocular surface.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
110
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1
rinsed and stored overnight in methanol (90%) at
-20°C.
Immunohistochemical Analysis
Antibodies specific for Pax-6 were generously provided by Drs. Janine Davis and Randall Reed of the
Howard Hughes Medical Institute at Johns Hopkins
University School of Medicine (Baltimore, MD). The
antiserum was prepared by immunizing rabbits with a
bovine serum albumin-conjugated synthetic peptide
corresponding to the 17 carboxy terminal amino acids
of mouse Pax-6. The chick C-terminal sequence is
identical to that of mouse.8'30 The antiserum was affinity purified by binding to immobilized peptide.
Tissue fixation and cryosectioning were as described for in situ hybridization. Six-day chick embryo
heads were fixed, as described, then embedded in 2%
low melting temperature agarose-phosphate-buffered saline and sliced into 100 ^m sections using a
vibratome. Immunohistochemistry was performed in
a basic mixture of 5% nonfat milk dissolved in TST
(10 mM Tris, 150 mM NaCl, 0.1% Tween 20) and
was clarified by centrifugation at 14,000 RPM for 10
minutes, essentially as described earlier.31 Sections
were first blocked in 5% milk-TST for 2 hours at
room temperature, then incubated overnight at 4°C
in the same solution containing a 1:400 dilution of
Pax-6 antibody. Sections were washed three times in
TST (without milk) for 10 minutes each wash and
incubated in a 1:200 dilution of biotinylated goat antirabbit IgG (Vector Laboratories, Burlingame, CA) for
3 hours at room temperature. Sections were washed
three times in TST for 30 minutes each time and incubated in a 1:500 dilution of avidin-horseradish peroxidase-conjugated tertiary antibody solution at 4°C
overnight. Peroxidase color reaction was performed
using the VIP kit (Vector Laboratories) and photographed using a Zeiss SV-11 or Axioskop microscope
(Carl Zeiss, Thornwood, NY).
Western Immunoblot Analysis
Corneal epithelia were isolated from eyes of day 15
chick embryos by microdissection using electrolytically
sharpened tungsten needles. During the dissection,
anterior segments were immersed in ice-cold phosphate-buffered saline containing 20 mM EDTA. EDTA
treatment allowed the corneal epithelium to be peeled
away from the underlying stroma without the use of
proteases. Retina and wing skin from day 15 chick
embryos, as well as from day 4 embryo limb bud tissues, were dissected in the same solution. Corneal epithelium was solubilized on ice using a 1 ml dounce
homogenizer and 1 ml of 2 X protein gel sample buffer
(160 mM Tris-HCl, 4% sodium dodecyl sulfate, 30%
glycerol, 5%-mercaptoethanol, 10 mM dithiothreitol,
0.05% bromophenol blue).32 Other tissues were lysed
in roughly similar proportions. Lysate was immersed
in a boiling water bath for 5 minutes and centrifuged
at 14,000 rpm for 10 minutes. Aliquots of protein supernatant were transferred to fresh microfuge tubes
and stored at — 80°C until ready for use. Protein quantitation was performed after removal of mercaptoethanol and sodium dodecyl sulfate by trichloroacetic acid
precipitation using the BCA (bicinchoninic acid;
Pierce, Rockford, IL) technique. Electrophoresis and
western immunoblot analyses were performed essentially as described previously.32 Equal concentrations
of protein samples were loaded onto a 4% to 20%,
0.75-mm thick precast gradient minigel (Biorad, Melville, NY) and electrophoresed at 2 V/cm. Biotinylated
broad-range (6.5 to 200 kDa; Biorad) molecular
weight markers were run with the samples. Briefly,
proteins were electroblotted onto 0.4-fj.m nitrocellulose membranes (Bioblot, NC; Costar, Cambridge,
MA) using a mini-tankblot (Biorad) apparatus for 1
hour at 100 V. Blots were incubated for 2 hours in
blocking buffer (5% milk-TST) and transferred to
Pax-6 antibody solution diluted 1:200 in blocking
buffer and incubated overnight at 4°C. Blots were
washed in Tris-buffered saline and incubated for 1
hour at room temperature in a double-secondary antibody solution of antirabbit IgG-horseradish peroxidase and Avidin-horseradish peroxidase (Biorad), diluted in blocking buffer at 1:1000 and 1:2500 ratios,
respectively. The blots were washed again in Tris-buffered saline, immersed in ECL reagents as described
in Amersham (Arlington Heights, IL) ECL protocols,
and exposed to x-ray film.
Detection and Quantitation of Pax-6 mRNA by
Reverse Transcription -Polymerase Chain
Reaction
RNA Isolation and cDNA Synthesis. Total RNA was
isolated using the Qiagen (Chatsworth, CA) RNeasy miniprep kit. Briefly, tissues isolated as described for immunoblot analysis were homogenized in guanidine isothiocyanate lysis buffer, bound to a column matrix, washed,
and eluted in 30 //I water. A basic reverse transcription—
polymerase chain reaction protocol33 was modified to
obtain relative quantities of Pax-6 mRNA. Reverse transcription was carried out in a 20-//1 mixture containing 2
fi\ of miniprep RNA, 200 U cloned MuLV reverse transcriptase (Gibco BRL), 100 mM KC1, 5 mM MgCl2, 25
mM Tris-HCl (pH 7.5), 1 mM dithiothreitol, 1 mM of
each dNTP, and 10 /JM of random DNA hexamers (Pharmacia) , and it was incubated at 37°C for 30 minutes. The
cDNA mixture was diluted with water to 100 [A, heat
denatured at 99°C for 90 seconds, and stored at -20°C.
Normalization of Samples to 18s rRNA. Two microliters of each cDNA preparation was added to a standard 20-fA PCR mixture containing 200 mM of each
dNTP, Taq polymerase, and 2 /xM each of the oligonucleotide primers TTGGTGACTCTAGATAACCTC and
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
Pax-6 in Ocular Surface Epithelia
GGCTCCCTCTCCGGA. These primers were derived
from the chicken 18s rRNA sequence under Genbank
accession number D38360. Amplification was carried
out in the presence of 1 /iCi 32P-dCTP for eight cycles
at 94°C for 1 minute, 46°C for 1 minute, and 72°C for
30 seconds. Glycogen carrier was added, and unincorporated nucleotides were removed by precipitation in
ammonium acetate.34 The labeled amplimer was
mixed with unlabeled carrier amplimer and resolved
by agarose gel electrophoresis. Amplimer bands were
visualized by ethidium staining, excised, melted in 10
volumes of water at 70°C, and scintillation counted.
Based on the relative yield of this amplimer, the cDNA
preparations were diluted individually so that they
contained the same concentration of 18s rRNA.
Quantitation of Pax-6 mRNA. Two microliters of each
normalized cDNA solution was added to a 20-fA PCR
mixture containing Taq polymerase (Boehringer Mannheim) and 2 (JM each of CCGTGCGACATCTCCCGAATCCTG (sense) and CACGCAAAGATGGAGGGGCACTCTC (ann'sense). These primer sequences correspond to chicken Pax-6 sequences located in the paired
box coding region and spanning the exon 4/5 splice
junction.30'35 Amplifications were for 16, 25, or 35 cycles
at 94°C for 1 minute, 62°C for 30 seconds, and 72°C for
50 seconds. Gels were stained in SYBR Green I (Molecular Probes, Junction City, OR) and photographed under
254 nm ultraviolet light. Protein quantitation, a PCR
reaction including 1 ^Ci 32P-dCTP, was amplified for 16
cycles. This reaction did not yield enough amplimer to
be visible by SYBR Green staining after electrophoresis
and was well within the exponential phase of the PCR
reaction.33 The PCR was terminated by the addition of
EDTA-containing sample buffer containing unlabeled
amplimer as a carrier and marker, then resolved by electrophoresis in 8% acrylamide. Bands were located by
staining with ethidium, excised, and scintillation
counted. Autoradiography was by exposure to Kodak xray film (Eastman Kodak, Rochester, NY) for 10 days.
Relative molar yield of a given cDNA amplimer was determined by subtracting the raw counts (per minute)
from a control analysis carried out without cDNA template, and then dividing these net counts by the number
of labeled cytosine residues in the amplimer. This relative molar yield of each sample was normalized to the
total Pax-6 mRNA detected in retina (set to equal 1).
RESULTS
Pax-6 mRNA and Protein in the Developing
Chick Eye: Immunohistochemistry
In the stage 19 chick embryo (early day 4), the lens
vesicle has separated fully from the corneal epithelium. At this stage, in situ hybridization demonstrated
expression of Pax-6 mRNA in several ocular sites (Fig.
1A). Expression of mRNA at this stage was most promi-
111
nent in the future retina and in the retinal pigment
epithelium along the margins of the optic cup. In the
lens, signal was detected readily in the anterior lens
epithelial cells and in the bow region, but it was absent
from the elongating fiber cells. The head ectoderm
overlying and surrounding the lens and optic cup also
showed significant expression of Pax-6 mRNA. This
region of surface ectoderm is fated to generate the
corneal ectoderm and conjunctiva. Pax-6 antibody
staining of embryos at the same stage revealed a pattern similar to that obtained by in situ hybridization
(Fig. IB). As expected for a DNA-binding transcription factor,19'2135 the Pax-6 antibody detected a protein
strongly localized to the nucleus. There were, however, differences between the pattern detected with
Pax-6 antibody and in situ hybridization probes. Unlike the pattern seen with mRNA, Pax-6 protein was
detected readily in cells of the central optic cup and
lens fiber layer, although at somewhat lower levels
than in regions that prominently express the mRNA.
In the head ectoderm, Pax-6 protein was clearly visible
in the nuclei of cells in a wider area around the eye
(Fig. IB). In the dorsal head ectoderm and in ectoderm outside the head, neither Pax-6 protein or
mRNA was detected (not shown).
In the anterior segment of a day 5 chick embryo,
substantial Pax-6 expression was observed in the anterior epithelium and bow region of the lens (Fig. 1C).
Pax-6 mRNA was again absent from the lens fiber
layer. When Pax-6 protein was detected using the antibody (Fig. ID), a similar distribution was observed,
but the Pax-6-expressing cells tended to extend further into the lens fiber layer, although they were absent from the nuclei of cells in the center of the lens.
These differences in the lens and retina might reflect
the persistence of Pax-6 protein in the lens fibers and
central retina. These are the same cells that expressed
the mRNA at significant levels during earlier stages of
development.1617'24 Expression of Pax-6 mRNA and
protein was found throughout the retinal and pigment
epithelial layers of the day 5 optic cup, including the
central retina (not shown).
In the corneal epithelium and conjunctiva of the
day 5 chick embiyo, the nuclei of all cells stained
strongly with antibody to Pax-6 protein. It should be
noted that Pax-6-specific signal was observed only in
the epithelial component of the developing cornea,
not in the stroma or endothelium. One striking observation in the examination of the chick embryos between days 4 to 6 is that the domain of Pax-6 expression in the surface ectoderm becomes more sharply
defined during development. In early day 4 embryos,
the dorsal boundary of the Pax-6 domain appeared as
a gradually decreasing gradient, with expressing cells
intermixed with nonexpressing cells (Fig. IB). By day
6, however, (Figs. 2A, 2B) this dorsal boundary had
become sharply defined and coincided with the edge
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
112
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
Pax-6 in Ocular Surface Epithelia
113
FIGURE l. Pax-6 expression in day 3 and day 5 chick embryos, detected by in situ hybridization
and immunohistochemistry. (A,B) Heads of day 3 (HH stage 18) embryos were processed
for wholemount in situ hybridization, followed by embedding in glycolmethacrylate and
preparation of 10-^trn sections (A). Alternately, 14-/zm frozen sections were prepared, and
immunocytochemistry with Pax-6 antibody followed (B). (top) Dorsal edge of optic cup is
up. (left) Ocular surface to the. (C,D) Transverse frozen sections of a day 5 embryo were
processed for Pax-6 mRNA by in situ hybridization (C) or immunohistochemistry (D).
Orientation to that in A and B. (arrows) Surface ectoderm near edge of the future cornea!
ectoderm. Scale bar = 64 /j,m (A,B); 128 ^m (C,D).
of the developing eyelid (arrow). It appeared that all
cells on the conjunctival side of the boundary expressed Pax-6, whereas none in the outer ectoderm
of the eyelid were found to express the gene. Pax6 expression was observed to extend throughout the
developing corneal ectoderm and conjunctiva.
A puzzling observation in the day 5 chick embryo
was that in situ hybridization failed to detect Pax-6
mRNA in the corneal and conjunctival epithelia (Fig.
1C, arrow), although signal was detected readily in
the lens epithelium and retina of the same specimen.
In contrast, the antibody detected high levels of immunoreacu've protein in the nuclei of these cells. Simi-
larly, the nuclei of day 15 chick corneal epithelium
showed strong signal with the antibody, but the cells
gave no signal by in situ hybridization using RNA
probes (not shown). This was surprising because generally we have found in situ hybridization to be a
highly reliable technique. At first, we considered the
possibility that the antibody detected another nuclear
protein. If, on the other hand, the antibody detected
genuine Pax-6 protein, we would have to conclude
that the in situ hybridization method could not detect
Pax-6 mRNA effectively in the day 5 cornea, even
though there was no problem detecting mRNA in the
lens and retina of the same specimen.
Con
2. Pax-6 expression in day 6 chick embryos, detected by immunohistochemistry.
Transverse vibratome sections (100 fjM) were prepared from anterior segments of chick
embryo eyes and stained with Pax-6 antibody. (A) Low-magnification view of vertical section
of (left to right); conjunctiva (con-arrow), underlying scleral mesenchyme, retinal pigment
epithelium and retina. Dorsal is toward top. Arrow indicates edge of upper eyelid. At the
lower edge, the retina and RPE are detached locally. Bright-field optics. (B) Higher magnification view of eyelid and conjunctiva in same specimen. Arrows indicate boundary of Pax6-expressing cells. Nomarski optics. Scale bar =100 //m (A); 50 fim (B).
FIGURE
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
114
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1
1 2
3
4
5
kDa
- 200
-116
-97
-66
46
^
37
•
-45
• •
-31
- 14
- 6.5
B
-200
FIGURE 3. Western blot showing Pax-6 immunoreactive proteins in the chick embryo. Tissues were solubilized in electrophoresis sample buffer, and equal amounts of protein were
loaded in each lane. (A) 5.8 ^g per lane. (B) 15.72 (j,g per
lane. The lanes represent: (1) E15 corneal epithelium; (2)
E15 (embryonic day 15 chick) retina; (3) E15 wing ectoderm; (4) E4 limb bud. Filters were incubated with Pax-6
antibody and visualized by ECL (Methods), with a 1-minute
exposure time. Biotinylated molecular weight markers were
visualized simultaneously by ECL to estimate molecular
weight.
Western Immunoblot Analysis of Pax-6
Expression in the Chick Embryo
To resolve these issues, we dissected corneal ectoderm
from day 15 chick embryos and conducted Western
immunoblot analysis to determine whether the immunoreactive protein had the same apparent molecular
weight as retinal Pax-6 (Figs. 3A, 3B). We found that
a major band was strongly expressed in equivalent
amounts in cornea (lane 1) and retina (lane 2). This
band was absent in skin (lane 3) and day 4 limb bud
(lane 4), tissues that do not express significant
amounts of Pax-6 mRNA.7 The presence of this band
was highly specific for the ocular tissues because it was
not observed in skin and limb after increasing the
sensitivity of detection (Fig. 3B). Comparison with
markers (lane 5) determined its apparent molecular
weight to be 46 kDa. There was a minor band at 37
kDa that was found primarily in retina and at lower
levels in cornea. The 46-kDa band closely matches that
predicted for the full-length protein and that observed
for Pax-6 of quail.36 Weaker bands, apparently unrelated to Pax-6, appeared at higher molecular weights
in all the samples (small arrowheads).
Analysis of Pax-6 Gene Expression by Reverse
Transcription-Polyraerase Chain Reaction
At this point, it was still possible that low levels of Pax-6
mRNA in the corneal epithelium might generate the
Pax-6 protein observed by immunocytochemistry and on
western blots. This could occur if Pax-6 mRNA were
translated more efficiently in the corneal epithelium or
if the protein was much more stable in these cells. To
determine the relative levels of chicken Pax-6 mRNA
in the corneal epithelium and retina, total RNA was
extracted from thesetissues,reverse transcribed by priming with random oligonucleotides, and PCR amplified
with primers specific for chicken Pax-6 (Fig. 4A). Three
bands (a = -400 bp doublet, b = 227 bp, and c = 185
bp) were visible in the retina (Fig. 4A, lane 1) and the
corneal epithelium (lane 2). All three bands were completely absent in skin (lane 3), limb (Fig. 4A, lane 4),
and a control reaction lacking cDNA template (lane 5).
The 400-bp doublet indicated by band a is smaller than
the 1-kb amplimer expected from genomic DNA35 and
may consist of minor splice variants of Pax-6. Band c
corresponds to the predicted 185-bp size for the canonical splice form of chicken17 and quail35 Pax-6. Band b
corresponds to the 227-bp amplimer fragment expected
from a splice form containing the 42-bp 4a exon35 (5a,
in the mouse and human Pax-6 nomenclature37) in
which 14 additional amino acids are inserted into the
paired domain of the protein. The canonical and 4a
splice forms of these mRNAs encode proteins close
enough in size that they run as a single band in the gel
(shown in Fig. 3). We have isolated and sequenced a
chicken cDNA clone corresponding to this 4a mRNA
splice form, and it generates an amplimer of the predicted size (data not shown). When band intensities
were compared, die 4a splice variant appeared to be the
predominant one in retina, but it was less abundant in
cornea. To quantitate the relative amounts of these
mRNA species, the RT-PCR reactions were carried out
with radioactive nucleotides for a limited number of
cycles. Relative molar yields of the excised bands are
shown in Table 1 (see Methods) and an autoradiogram
in Figure 4B. Similar amounts of total Pax-6 mRNA appear to be present in retina and cornea, making it clear
diat we do not have to postulate any differences in trans-
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
Pax-6 in Ocular Surface Epithelia
1 2
3
115
4
5
i
c •
Pax-6 gene expression in chick, analyzed by quantitative reverse transcription-polymerase chain reaction. (A)
Total RNA was isolated from different chick embryo tissues
and reverse transcribed, and cDNAs were normalized to the
levels of 18S-rRNA. This was followed by 25 cycles of polymerase chain reaction (PCR) amplification and electrophoresis (see Methods). Lane 1 = E15 {embryonic day 15 chick)
retina; lane 2 = E15 corneal epithelium; lane 3 = E15 wing
ectoderm; lane 4 = E4 limb bud; lane 5 = PCR without
cDNA template. Markers (PBR 322-MspI digest): 622, 527,
404, 307, 242 + 238, 217, 201, 190, 180, 160, 147, 123, 110
base pairs. The Pax-6-specific amplimer bands are: (a) ~400bp doublet corresponding to minor splice variants; (b) 227
bp: Pax-6 4a splice form, (c) 185 bp: Pax-6 canonical splice
form. (B) Normalized cDNAs were PCR amplified for 16
cycles with 32P-dCTP, followed by electrophoresis and autoradiography. The format is the same as in A.
the mouse. The mouse has a smaller eye that is sectioned easily in its entirety because it lacks the tough
scleral ossicles found in the late embryonic and adult
chick28 The eye of a 30-day mouse was removed with
eyelids attached to the globe and was sectioned in the
transverse plane. Pax-6 protein was detected in the
nuclei of cells throughout the epithelial layer of the
ocular surface, including the cornea, limbus, and entire conjunctiva. This domain extends into the entire
palpebral epithelium of the eyelids, as shown in the
section diagram (Fig. 5 I). A closer view of various
regions (Fig. 5 II), showed that the nuclei of apparently all cells of the corneal epithelium contained Pax6 protein (Fig. 5 IIA). There did not appear to be any
change in the intensity of signal or the frequency of
expressing cells in the transition from cornea to the
limbus and conjunctiva (Fig. 5 IIB). Close to the outer
margin of the palpebral conjunctiva, the intensity of
Pax-6 signal was seen to decrease, ending at a boundary defined by the hairs of the eyelid. The same abrupt
boundary was observed for upper and lower eyelids
(not shown). Among other tissues showing Pax-6 positive nuclei are the iris and ciliary body (Fig. 5 IIB), in
which apparently all cells express the protein. Pax-6
antigen was expressed strongly in the anterior epithelium and bow region of the lens, as well as in the
ganglion and amacrine layers of the retina (Figs. 5 I,
5 IIB).
FIGURE 4.
lational efficiency or protein stability to explain the high
level of Pax-6 protein in the cornea. Both major splice
forms contain the same carboxy terminus and, therefore, should be recognized by the antibody. Although
overall levels are similar, the corneal epithelium and
retina of the day 15 chick embryo have different ratios
of the canonical and 5a splice forms.
Pax-6 in the Adult Mouse Eye and Its Adnexal
Tissues
To determine the expression pattern of Pax-6 in postembryonic stages, it was more convenient to examine
Pax-6 in the Anterior Segment of the Monkey
Pax-6 expression was examined in sections of the anterior segment of an adult cynomolgus monkey. In monkey (Fig. 5 IID), the corneal epithelium was stained
in a pattern similar to mouse, with all other regions
of the cornea, including the stroma, completely negative for Pax-6. The signal was weaker than in the
mouse, possibly because of differences in age, species
differences, or tissue preparation. With the Pax-6 anti-
i. Relative Abundance of Pax-6
mRNA Species in the 15-Day
Chick Embryo*
TABLE
Amplimer (size)
Retina (yield)
Cornea (yield)
404 bp
227 bp (4a Pax-6)
185 bp (canonical Pax-6)
Total Pax-6 mRNA
0.024 ± 0.004
0.796 ± 0.106
0.180 ± 4.0
1.00
0.026 ± 1.2
0.026 ± 4.8
1.092 ± 15.6
1.14
* Values represent the mean of triplicates ± standard error (SE).
Pax-6 cDNA was amplified and radiolabeled with S2P dCTP in a
16-cyde PCR, followed by electrophoresis (see Fig. 4B), excision,
and scintillation counting. Control samples without cDNA
provided background counts, which were subtracted From all
samples. Each cDNA sample was normalized to 18S rRNA, and
the relative molar yield of each amplimer band was obtained.
Relative molar yields for each amplimer band are finally
normalized to the total Pax-6 mRNA found in retina,
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
116
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1
-4
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
Pax-6 in Ocular Surface Epithelia
117
FIGURE 5.
Localization of Pax-6 protein in ocular tissues of mouse and monkey by immunohistochemistry. Vertical cryosections (14 /xm) were prepared from whole eyes and eyelids of a
30-day-old mouse and visualized with Pax-6 antibody and Vector VIP immunoperoxidase
histochemistry. Panel I is a diagram summarizing Pax-6 distribution in the whole eye, and
panel II shows higher magnification micrographs of boxed regions in the diagram. Dorsal
is toward the top, and the exterior of the eye is toward the left. Micrographs show (A)
palpebral conjunctiva and edge of eyelid, (B) fornix, and (C) cornea of mouse. (D) Vertical
10-fjim cryosection of adult cynomolgous monkey cornea, stained for Pax-6 as before, con
= conjunctiva; ce = corneal epithelium; cb = ciliary body; h = hair; s = skin. Scale bar =
263 /urn (panel 1); 66 /zm (panel 2).
body, signal was localized clearly in the epithelial cell
nuclei. In sections incubated with rabbit preimmune
serum to control for immunoglobin binding to the
cornea, background signal was distributed throughout
the specimen, in the cytoplasm, and in the nucleus
(not shown).
DISCUSSION
Pax-6 is known to play an essential role in the establishment and growth of the vertebrate lens.10'12'15 We have
found that the gene is expressed prominently in the
early cellular precursors of the cornea and conjunctiva,8'1617 which are located in the periphery of the
lens placode.2 The fact that human aniridia often is
accompanied by adult corneal abnormalities13 has
raised the question of whether human PAX6 has a
functional role later in life and continues to be expressed at significant levels in the ocular surface. Mutations in Pax-6 have been found to be associated with
other disorders not normally classified as aniridia but
that share some features of the disease. Among these
is autosomal dominant keratitis,38 in which corneal
pannus formation is observed but without iris hypoplasia. Also associated with mutations in PAX6 is Peter's
anomaly,39 a malformation of the cornea and anterior
segment thought to result from a defect in the separation of the lens vesicle from the corneal epithelium.2
Abnormalities of the cornea and the ocular surface
are a common feature of these "non-aniridia" PAX6
disorders, again suggesting the importance of PAX6 in
the proper formation and function of these structures.
The recent availability of antiserum specific for
Pax-6 protein has allowed us to examine the expression of this gene in the late embryonic and mature
ocular surface. This had not been feasible in the chick
because in situ hybridization did not detect Pax-6
mRNA in the differentiated corneal ectoderm, although the technique readily detects mRNA in lens
and retina. The reasons for this are unknown; in situ
hybridization studies of the cornea, therefore, should
be treated with caution. Our results with an antibody
directed to the carboxy terminus of Pax-6 indicate
that genuine Pax-6 protein is produced by the corneal
epithelium at levels comparable to those in the retina.
Further, RT-PCR with Pax-6-specific primers suggests
that the levels of total Pax-6 mRNA in the corneal
epithelium are similar to those in the retina. As far as
we can determine, the corneal stroma and endothelium do not express Pax-6. The failure of in situ hybridization probes to detect Pax-6 mRNA in the day
5 chick embryo corneal epithelium is apparently a
more general phenomenon because beta-actin mRNA
is not detected efficiently in this tissue (data not
shown).
The cornea expresses both major splice forms normally found in the retina, the canonical Pax-68'9 and
the 4a splice form35 (5a, mouse-human nomenclature37). The 4a form introduces an additional exon
that inserts 14 conserved amino acids into the paired
domain.35 Day 15 corneal ectoderm primarily produces the canonical form and much less of the 4a
form, which is the predominant form in the day 15
retina. Earlier, when the retina undergoes rapid
growth on embryonic days 4 and 5, the retinal assortment of these two Pax-6 splice forms is roughly 80%
canonical and 20% 4a form, much closer to the distribution found in cornea (data not shown). The ratios
of splice forms can vary with developmental stage and
are not specific to tissue type. The paired domain of
the 4a counterpart (5a) of human Pax-6 protein has
a different DNA-binding specificity than the canonical
form,37 suggesting that it may act on a different set of
target genes. The relative expression levels of these
two Pax-6 proteins may be of functional significance.
Previous studies17 have shown that Pax-6 expression in the head ectoderm is distributed broadly in
the neural-fold and neural-plate embryos. At later
stages, Pax-6 expression becomes confined to two
comet-shaped patches next to the optic vesicles (day
1.5 to 2 embryo). At this stage, the boundaries of these
patches of Pax-6-positive cells are not sharply defined
and show extensive intermixing of expressing and
nonexpressing cells. In the day 4 and 5 chick embryos,
the center of this patch of tissue has already invaginated to form the lens. The peripheral Pax-6-expressing cells remain on the surface and, at their edges,
still are intermixed extensively with nonexpressing
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
118
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1
cells. By day 6, however, when the eyelids begin to
appear, the boundary between Pax-6 expressing and
nonexpressing cells becomes precisely defined at the
edge of the eyelid. This progressive narrowing and
sharpening of the Pax-6 domains, which happens as
morphologic features appear, follows a general theme
observed for other homeobox genes involved in regulating the development of pattern.3'6'31 It should be
noted that Pax-6-expressing cells are located on the
interior surface of the eyelid but are not found in the
mesoderm or skin, suggesting that the formation of
these structures might not require function of the
gene. This is consistent with the presence of external
eyelid features on anophthalmic mouse11 and human14 newborns that completely lack a functional
PAX6 gene.
In addition to its presence during development,
Pax-6 protein continues to be expressed in cells of
the adult ocular surface. In the corneal epithelium, a
highly specialized tissue designed to maintain a
smooth and transparent surface for the eye, Pax-6
might be involved in regulating the expression of
genes that determine its cellular structure and composition. Because there is evidence that Pax-6 direcdy
regulates the expression of crystallin genes in the
lens22"24 and it is known that the corneal epithelium
contains crystallin-like proteins,40 Pax-6 might regulate
the expression of such crystallin-like proteins in the
adult cornea. We were surprised, however, to find that
Pax-6 expression is not limited to the cornea but that
the entire conjunctival ectoderm expresses the gene,
all the way to the edge of the eyelids. This suggests
that Pax-6 may be required for maintaining adult function of the conjunctiva, possibly the secretory functions in this mucosal ectoderm. It is interesting that
in the embryonic and adult olfactory epithelium, the
mucosal supporting cells express Pax-6. They are the
only other ectodermally derived cells in the body to
express and require Pax-6 for their development.812'16
In the three species we have examined, Pax-6 is
expressed in the corneal epithelium but not in the
stroma, an observation that reflects the fundamentally
different origins of these tissues. Conjunctiva and corneal epithelium are derived from the surface ectoderm of the head, whereas stroma and endothelium
arise from neural crest cells.2'41 Pax-6 expression has
not been observed in neural crest or mesodermal cells
of the mouse or chick embryo and appears restricted
to specific regions of neural, ectodermal, and endodermal tissue.8'17 Although detailed features of the
adult iris are not readily visible in Figure 5 because of
heavy pigmentation, the pattern of Pax-6 expression
appears to follow the same general rule in this structure. The vertebrate iris has a substantial contribution
from neural crest, which generates the stromal cells.
In the newly hatched chick, these stromal cells do
not express Pax-6 protein, whereas the ectodermally
derived posterior iris epithelium clearly expresses the
gene. Islands of cells in the stroma that appear to
correspond to the iris sphincter and dilator muscles
express Pax-6. If confirmed, this observation again
would be consistent with the atypical origin of these
muscles, which derive from the neural ectoderm of
the optic vesicle.41
Evidence of a close functional relationship between corneal and conjunctival cells is found in the
remarkable interaction of these two tissues during the
healing of extensive corneal wounds.42"45 Normally,
cells lost from the corneal surface are replaced by
proliferating cells that originate in a slowly cycling
stem cell population located in the limbus at the corneal margin.46 When limbal stem cells are destroyed,
the corneal epithelium is replaced by an influx of cells
migrating from the conjunctiva.45'47"49 To a surprising
degree, these migrating conjunctival cells can take on
the role of corneal epithelium, and it has been suggested that they have the capability to transdifferentiate fully into this tissue.43'30 However, the persistence
of goblet secretory cells and other features indicate
that this transdifferentiation is incomplete,45'31 although the conjunctival cells can acquire the essentials of corneal structure and function. The expression
of Pax-6 in both these tissues may reflect their close
similarity as ocular structures and possibly serve to
maintain the expression of genes that define their
cellular identity.
A final issue concerns ocular abnormalities observed in patients with aniridia. In cases of aniridia
associated with heterozygous mutations in Pax-6, it is
thought that the disorder is caused by a decrease in
the functional gene dosage from two copies to
one. 91014 In early adulthood, an opaque and vascularized region of the cornea known as a pannus often
develops in these individuals, and there have been few
clues concerning how it arises.13 Recently, the ocular
surfaces of patients with aniridia were visualized by
impression cytology, and considerable numbers of
conjunctival goblet cells were found embedded in the
corneal epithelium.52 The origin of these out-of-place
cells is thought to be an influx of partially transdifferentiated conjunctival cells populating the surface of
the cornea. In addition, the limbal structures that contain the corneal stem cells, known as the Palisades of
Vogt,33 were absent or greatly reduced, suggesting that
corneal stem cell deficiency might be the cause of
conjunctival invasion of the cornea, very much along
the paradigm described earlier for wound healing. We
have shown that mouse Pax-6 protein is expressed at
high levels in adult limbal cells, indicating that it probably has the opportunity of time and place to be involved direcdy in the corneal phenotype of patients
with aniridia. Together, these observations raise the
possibility that high-level expression of Pax-6 is necessary for the maintenance or proliferation of corneal
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
Pax-6 in Ocular Surface Epithelia
stem cells. This notion is supported by the observation
that when mouse Pax-6 protein is expressed from a
powerful promoter in NIH 3T3 fibroblasts, it can induce proliferation strikingly in the manner of an oncogene. 54 The conjunctiva might be dependent on Pax6 for the maintenance of its stem cells, but it appears
that this function is less sensitive to a decrease in Pax6 gene dosage. It is possible, however, that careful
examination of individuals with aniridia will reveal abnormalities in conjunctival structure or function.
119
12.
13.
14.
Key Words
conjunctiva, cornea, homeobox, Pax-6, vertebrate
15.
Acknowledgments
The authors thank Drs. Janine Davis and Randall Reed of
the Howard Hughes Medical Institute for the gift of Pax-6
antiserum, Wing Fun Lau, and Dr. Ruben Adler for the
mice, and Dr. Harry Quigley for the monkey anterior segments. They also thank Dr. Morton Goldberg for valuable
discussions and Dr. Neil Delia for insightful comments on
the manuscript.
References
16.
17.
18.
1. Coulombre AJ. Regulation of ocular morphogenesis.
19.
Invest Ophthalmol. 1969;8:25-31.
2. Schook P. Cell action and cell interaction during ocular morphogenesis. In: Tasman W, Jaeger E, eds.
Duane's Foundations of Clinical Ophthalmology. Philadel-20.
phia: JB Lippincott; 1994.
3. Beebe DC. Homeobox genes and vertebrate eye development. Invest Ophthalmol Visual Sci. 1994; 35:2897- 21.
2900.
4. Quiring R, Walldorf U, Kloter U, Gehring WJ. Homology of the eyeless gene of Drosophila to the Small eye
22.
in mice and Aniridia in humans. Science. 1994;
265:785-789.
5. Lawrence PA, Morata G. Homeobox genes: Their
23.
function in Drosophila segmentation and pattern formation. Cell. 1994; 78:181-189.
6. Krumlauf R. Hox genes in vertebrate development.
Cell. 1994; 78:191-201.
7. Krauss S, Johansen T, Korzh V, Moens U, Ericson JU,
24.
Fjose A. Zebrafish pax[zf-a]: A paired box-containing
gene expressed in the neural tube. EMBO f. 1991;
10:3609-3619.
8. Walther C, Gruss P. Pax-6, a murine paired box gene,
is expressed in the developing CNS. Development. 25.
1991;113:1435-1449.
9. Ton CC, Hirvonen H, Miwa H, et al. Positional cloning
and characterization of a paired-box and homeobox26.
containing gene from the aniridia region. Cell. 1991;
67:1059-1074.
27.
10. Glaser T, Walton DS, Maas RL. Genomic structure,
evolutionary conservation and aniridia mutations in
the human Pax-6 gene. Nature Genet. 1992;2:232-239.
11. Hogan BLM, Horsburgh G, Cohen J, Hetherington
28.
CM, Fisher G, Lyon MF. Small eyes (Sey): A homozygous lethal mutation on chromosome 2 which affects
the differentiation of both lens and nasal placodes in
the mouse. /Embryol Exp Moiphol. 1986;97:95-110.
Hill RE, Favor J, Hogan BLM, et al. Mouse Small eye
results from mutations in a paired-like homeobox-containing gene. Nature. 1991;354:522-525.
Nelson LB, Spaeth GL, Nowinski TS, Margao CE, Jackson L. Aniridia, a review. Surv Ophthalmol. 1984;
28:621-642.
Glaser T, Jepeal L, Edwards JG, Young SR, Favor J,
Maas RL. PAX-6 gene dosage effect in a family with
congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nature Genet. 1994; 7:463471.
Matsuo T, Osumi-Yamashita N, Noji S, et al. A mutation in the Pax-6 gene in rat small eyes is associated
with impaired migration of midbrain crest cells. Nature
Genet. 1993; 3:299-304.
GrindleyJC, Davidson DR, Hill RE. The role of Pax6 in eye and nasal development. Development.
1995; 121:1433-1442.
Li HS, YangJMJacobson RD, Pasko D, Sundin O. Pax6 is first expressed in a region of ectoderm anterior
to the early neural plate: Implications for stepwise
determination of the lens. Dev Biol. 1994; 162:181194.
Chalepakis G, Stoykova A, Wijnholds J, Tremblay P,
Gruss P. Pax: Gene regulators in the developing nervous system (review). / Neurobiol. 1993; 24:1367-1384.
Treisman J, Harris E, Desplan C. The paired box encodes a second DNA-binding domain in the paired
homeo domain protein. GenesDevel. 1991;5:594-604.
Haider G, Callaerts P, Gehring WJ. Induction of ectopic eyes by targeted expression of the eyeless gene
in Drosophila. Science. 1995; 267:1788-1792.
Plaza S, Dozier C, Saule S. Quail Pax-6 (Pax-QNR)
encodes a transcription factor able to bind and transactivate its own promoter. Cell Groiuth Differ. 1993;
4:1041-1050.
Richardson J, Cvekl A, Wistow G. Pax-6 is essential
for lens-specific expression of zeta-crystallin. Proc Natl
AcadSci USA. 1995;92:4676-4680.
Cvekl A, Sax CM, Bresnick EH, Piatigorsky J. A complex array of positive and negative elements regulates
the chicken alpha A-crystallin gene: Involvement of
Pax-6, USF, CREB and/or CREM and AP-1 proteins.
Mol Cell Biol. 1994; 14:7363-7376.
Cvekl A, Sax CM, Li X, McDermott JB, Piatigorsky J.
Pax-6 and lens-specific transcription of the chicken
delta 1-crystallin gene. Proc Natl Acad Sci USA.
1995;92:4681-4685.
Del Rio-Tsonis K, Washabaugh CH, Tsonis PA. Expression of pax-6 during urodele eye development
and lens regeneration. Proc Natl Acad Sci USA.
1995;92:5092-5096.
Grove JH, Shaw MW, Bourge G. A family study of
aniridia. Arch Ophthalmol. 1961;65:81-84.
Grant WM, Walton DS. Progressive changes in the
angle in congenital aniridia, with the development of
glaucoma. Am JOphthalmol. 1974; 78:842-847.
Hamburger V, Hamilton H. A series of normal stages
in the development of the chick embryo. / Morphol.
1951;88:49-92.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017
120
Investigative Ophthalmology & Visual Science, January 1997, Vol. 38, No. 1
29. Harland RM. In situ hybridization: An improved
whole-mount method for Xenopus embryos. Methods
CellBiol. 1991; 36:685-695.
30. Martin P, Carriere C, Dozier C, et al. Characterization
of a paired box and homeobox-containing quail gene
(Pax-QNR) expressed in the neuroretina. Oncogene.
1992;7:1721-1728.
31. Sundin, OH, Eichele GA. homeo domain protein reveals the metameric nature of the developing chick
hindbrain. Genes Dev. 1990; 4:1267-1276.
32. Koroma BM, de Juan E Jr. Phosphotyrosine inhibition
and control of vascular endothelial cell proliferation
by genistein. Biochem Pharmacol. 1994; 48:809-818.
33. Innis MA, Gelfand DH, SninskyJJ, eds. PCRProtocols: A
Guide to Methods and Applications. San Diego: Academic
Press; 1990.
34. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning:
A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press; 1989.
35. Dozier C, Carriere C, Grevin D, et al. Structure and
DNA-binding properties of Pax-QNR, a paired box
and homeobox-containing gene. Cell Growth Differ.
1993;4:281-289.
36. Carriere C, Plaza S, Martin P, et al. Characterization
of quail Pax-6 (Pax-QNR) proteins expressed in the
neuroretina. Mol CellBiol. 1993; 13:7257-7266.
37. Epstein JA, Glaser T, Cai J, Jepeal L, Walton DS, Maas
RL. Two independent and interactive DNA-binding
subdomains of the Pax6 paired domain are regulated
by alternative splicing. Genes Dev. 1994;8:2022-2034.
38. Mirzayans F, Pearce WG, Macdonald IM, Walter MA.
Mutations of the PAX6 gene in patients with autosomal dominant keratitis. Am J Human Genet. 1995;
57:539-548.
39. Hanson IM, Fletcher JM, Jordan T, et al. Mutations in
the PAX6 locus are found in heterogeneous anterior
segment malformations including Peter's anomaly.
Nature Genet. 1994; 6:168-173.
40. Cuthberson RA, Tomarev SI, Piatigorsky J. Taxon-specific recruitment of enzymes as major soluble proteins
in the corneal epithelium of three mammals, chicken,
and squid. Proc Natl Acad Sci USA. 1992; 89:4004-4008.
41. Cook CS, Ozanics V, Jakobiec FA. Prenatal development of the eye and its adnexa. In: Tasman W, Jaeger
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
E, eds. Duane's Foundations of Clinical Ophthalmology.
Philadelphia: JB Lippincott; 1994:1-93.
Maumenee AE, Scholz RO. Histopathology of the ocular lesions produced by sulfur and nitrogen mustard.
Johns Hopkins Hosp Bull. 1948;82:121.
Kinoshita S, Friend J, Thoft RA. Biphasic cell proliferation in transdifferentiation of conjunctival to corneal
epithelium in rabbits. Invest Ophthamol Vis Sci.
1983;24:1008-1014.
Huang AJW, Tseng SCG. Corneal epithelial wound
healing in the absence of limbal epithelium. Invest
Ophthalmol Vis Sci. 1991;32:96-105.
Kruse FE. Stem cells and corneal epithelial regeneration. Eye. 1994; 8:170-183.
Cotsarelis G, Cheng S-Z, Dong G, Sun T-T, Lavker
RM. Evidence of slow-cycling limbal epithelial basal
cells that can be preferentially stimulated to proliferate: Implications for epithelial stem cells. Cell. 1989;
57:201-209.
Wei ZG, Cotsarelis G, Sun T-T, Lavker RM. Labelretaining cells are preferentially located in fornical
epithelium: Implications on conjunctival epithelial
homeostasis. Invest Ophthalmol Vis Sci. 1995; 36:236246.
Wei ZG, Sun T-T, Lavker RM. Rabbit conjunctival and
corneal cells belong to two separate lineages. Invest
Ophthalmol Vis Sci. 1996;37:523-533.
Zieski JD. Perpetuation of stem cells in the eye. Eye.
1994;8:163-169.
Danjo S, Friend J, Thoft RA. Conjunctival epithelium
in healing of corneal epithelial wounds. Invest Ophthalmol Vis Sci. 1987;28:1445-1449.
Chen WY, Mui MM, Kao WW, Liu CY, Tseng SC. Conjunctival epithelial cells do not transdifferentiate in
organotypic cultures: Expression of K12 keratin is restricted to corneal epithelium. Curr Eye Res. 1994;
13:765-778.
Nishida K, Kinoshita S, Ohashi Y, Kuwayama Y, Yamamoto S. Ocular surface abnormalities in aniridia. Am
J Ophthalmol. 1995; 120:368-375.
Goldberg M, Bron AJ. Limbal palisades of Vogt. Trans
Am Ophthalmol Soc. 1982;LXXX:155-171.
Maulbecker CC, Gruss P. The oncogenic potential of
Pax genes. EMBOJ. 1993; 12:2361-2367.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933195/ on 05/05/2017