Download - Wiley Online Library

GENES, CHROMOSOMES & CANCER 46:118–129 (2007)
RESEARCH ARTICLES
Profiling Genomic Copy Number Changes
in Retinoblastoma Beyond Loss of RB1
Ella Bowles,1–3{ Timothy W. Corson,1,4{ Jane Bayani,1 Jeremy A. Squire,1,3,5 Nathalie Wong,6
Paul B.-S. Lai,7 and Brenda L. Gallie1,3,4,8*
1
Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital,
University Health Network,Toronto,ON,Canada
2
Department of Zoology,University of British Columbia,Vancouver,BC,Canada
3
Department of Medical Biophysics,University of Toronto,Toronto,ON,Canada
4
Department of Molecular and Medical Genetics,University of Toronto,Toronto,ON,Canada
5
Department of Laboratory Medicine and Pathobiology,University of Toronto,Toronto,ON,Canada
6
Department of Anatomical and Cellular Pathology,Chinese University of Hong Kong, Shatin,N.T., SAR Hong Kong,China
7
Department of Surgery,Chinese University of Hong Kong, Shatin,N.T., SAR Hong Kong,China
8
Department of Ophthalmology,University of Toronto,Toronto,ON,Canada
Loss of both RB1 alleles is rate limiting for development of retinoblastoma (RB), but genomic copy number gain or loss may
impact oncogene(s) and tumor suppressor genes, facilitating tumor progression. We used quantitative multiplex polymerase
chain reaction to profile "hot spot" genomic copy number changes for gain at 1q32.1, 6p22, and MYCN, and loss at 16q22 in 87
primary RB and 7 cell lines. Loss at 16q22 (48%) negatively associated with MYCN gain (18%) (Fisher’s exact P 5 0.031), gain at
1q32.1 (62%) positively associated with 6p "hot spot" gain (43%) (P 5 0.033), and there was a trend for positive association
between 1q and MYCN gain (P 5 0.095). Cell lines had a higher frequency of MYCN amplification than primary tumors (29%
versus 3%; P5 0.043). Novel high-level amplification of 1q32.1 in one primary tumor, confirmed by fluorescence in situ hybridization, strongly supports the presence of oncogene(s) in this region, possibly the mitotic kinesin, KIF14. Gene-specific quantitative multiplex polymerase chain reaction of candidate oncogenes at 1q32.1 (KIF14), 6p22 (E2F3 and DEK), and tumor suppressor genes at 16q22 (CDH11) and 17q21 (NGFR) showed the most common gene gains in RB to be KIF14 in cell lines (80%)
and E2F3 in primary tumors (70%). The patterns of gain/loss were qualitatively different in 25 RB compared with 12 primary
hepatocellular carcinoma and 12 breast cancer cell lines. Gene specific analysis of one bone marrow metastasis of RB, prechemotherapy and postchemotherapy, showed the typical genomic changes of RB pretreatment, which normalized after chemoC 2006 Wiley-Liss, Inc.
therapy. V
INTRODUCTION
Retinoblastoma (RB) is a rare childhood eye cancer initiated by biallelic loss (mutational events M1
and M2) of the RB susceptibility gene, RB1, as predicted by Knudson’s two-hit model (Knudson,
1971). However, further genomic changes, termed
M3-Mn, present in most RB, may support tumor
growth by activating oncogenes and inactivating tumor suppressor genes (Gallie et al., 1999a). The
most common chromosomal changes in RB tumors,
detected by comparative genomic hybridization
(CGH), are gains around 1q31-1q32, 2p24, and
6p22, and losses at 16q22 (Mairal et al., 2000; Chen
et al., 2001; Herzog et al., 2001; Lillington et al.,
2003; van der Wal et al., 2003; Zielinski et al., 2005).
Previously, we used quantitative multiplex polymerase chain reaction (QM-PCR) and loss of heterozygosity analyses to narrow further three of these
regions to ‘‘hot spot’’ sequence tagged sites (STS) at
1q32.1 (Corson et al., 2005), 6p22 (Chen et al.,
2002), and 16q22 (Marchong et al., 2004). The 2p24
C
V
2006 Wiley-Liss, Inc.
region is occasionally amplified in RB, and includes
the MYCN oncogene, the assumed target of the
amplification (Lee et al., 1984; Squire et al., 1986;
Godbout et al., 1998; Lillington et al., 2002).
Subsequent expression analyses have led to the
identification of candidate cancer genes at or near
each genomic ‘‘hot spot.’’ KIF14 is a mitotic kinesin
and candidate oncogene encoded near the 1q32.1
‘‘hot spot’’ (Corson et al., 2005). It is highly
Supported by: National Cancer Institute of Canada, the Canadian
Retinoblastoma Society, funds from the Blind Ball, Canadian
Genetic Diseases Network, University of Toronto Department of
Medical Biophysics, University of Toronto Vision Science Research
Program Studentship and Canadian Institutes for Health Research
Canada Graduate Scholarship.
{These authors contributed equally to this work.
*Correspondence to: Brenda L. Gallie, Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, University Health Network, Room 8-415, 610 University Avenue, Toronto, ON M5G 2M9, Canada. E-mail: [email protected]
Received 7 July 2006; Accepted 31 August 2006
DOI 10.1002/gcc.20383
Published online 10 November 2006 in
Wiley InterScience (www.interscience.wiley.com).
GENOMIC EVENTS IN RETINOBLASTOMA PROGRESSION
overexpressed in RB compared with normal retina,
and in medulloblastoma, breast, and lung cancer
samples (Corson et al., 2005; Corson and Gallie,
2006). The 6p22 ‘‘hot spot’’ overlaps the gene for
another kinesin, RBKIN (KIF13A), initially posited
as a candidate oncogene (Chen et al., 2002). However, more recent work suggests that the DNA-binding protein and leukemia oncogene DEK and/or the
transcription factor E2F3, both overexpressed in RB,
are more promising RB oncogene candidates at 6p22
(Grasemann et al., 2005; Orlic et al., 2006). The
16q22 ‘‘hot spot’’ overlaps the CDH11 gene
(Marchong et al., 2004), which encodes the cell adhesion molecule and candidate tumor suppressor
cadherin-11, expression of which is lost in RB
(Marchong et al., 2004). Finally, on the basis of loss
of expression, we have identified the anti-apoptotic
neurotrophin receptor p75NTR (encoded by NGFR
at 17q21) as another candidate tumor suppressor
gene in RB (Dimaras et al., 2006); the genomic status of this gene in RB is unknown.
We hypothesized that patterns of genomic
change may be important in the molecular progression of RB. Using the ‘‘hot spot’’ STSs defining
each minimal region of gain/loss, in addition to primers for MYCN, we developed one QM-PCR assay
to evaluate rapidly genomic copy number in 87 RB
tumors and 7 cell lines. We show associations
between specific genomic gains/losses, MYCN
amplification, and a novel 1q amplification that we
confirmed by interphase fluorescence in situ
hybridization (FISH). In a separate assay, the qualitative patterns of gains/losses in RB for the candidate oncogenes and tumor suppressor genes were
similar to those in ‘‘hot spot’’ profiles of RB, but
distinct from patterns in primary hepatocellular
carcinoma and breast cancer cell lines. The
genomic signature characteristic of RB was detectable in bone marrow containing metastatic RB, and
cleared with chemotherapy.
MATERIALS AND METHODS
DNA Samples
DNA was extracted from 87 primary RB, 7 RB
cell lines for which primary tumor was no longer
available (RB247C, RB267, RB355, RB383,
RB409, WERI-Rb1, Y79) (Gallie et al., 1999b), and
lymphocytes of seven unaffected relatives, as
described (Richter et al., 2003). All samples were
received for RB1 gene diagnostic testing and were
used for research when these studies were complete (Richter et al., 2003). The Research Ethics
Boards of the Wellesley Hospital, the Hospital for
119
Sick Children, the University Health Network, and
the University of Toronto approved research use of
blood and tumor material with parental consent.
Clinical details of extent of intraocular RB were not
available for the majority of these samples.
Liver tumors were collected from 12 patients
who underwent curative surgery for hepatocellular
carcinoma at the Prince of Wales Hospital, Hong
Kong, China. Informed consent was obtained from
all patients. DNA was extracted from these hepatocellular carcinoma specimens using the QIAamp1
DNA kit (Qiagen, Hong Kong, China) according
to the manufacturer’s instructions. DNA was obtained from 12 breast cancer cell lines (BT-474,
BT-483, Hs578T, MCF7, MDA-MB-231, MDAMB-415, MDA-MB-468, UACC-812, UACC-893,
T-47D, ZR-75-1, and ZR-75-30) as described
(Corson et al., 2005).
Quantitative Multiplex Polymerase Chain Reaction
We combined three previously identified ‘‘hot
spot’’ STS markers of genomic gain/loss (SHGC154194 at 1q32.1, SHGC-103950 at 6p22, and WI5835 at 16q22) into a single multiplex PCR along
with custom-designed primers for MYCN (Table 1;
STS primer sequences are available through
UniSTS, http://www.ncbi.nlm.nih.gov/entrez/query.
fcgi?db ¼ unists). In the gene-specific QM-PCR we
combined primers for KIF14, DEK, E2F3, CDH11,
and NGFR (Table 1). As in our previous studies
(Chen et al., 2002; Marchong et al., 2004; Corson
et al., 2005), the internal control for two copies was
STS WI-7221 (335 bp) at 10q21, a region rarely
gained or lost in RB (Chen et al., 2001), breast, or
liver cancer (Baudis and Cleary, 2001). The STSs
used had no known polymorphisms and did not lie
in duplicated regions (Bailey et al., 2001). The forward primers were 50 -Cy5-labeled (Integrated DNA
Technologies, Coralville, IA).
The total reaction volume of 10 ll consisted
of 13 Multiplex PCR Master Mix (includes Taq
polymerase, buffer, 3 mM MgCl2, and dNTPs;
Qiagen, Burlington, ON, Canada) and 200 ng of
genomic DNA for the ‘‘hot spot’’ assay and 100 ng
in the gene-specific assay. Primers in the ‘‘hot
spot’’ assay consisted of 2 pmol for SHGC-103950,
WI-5835 and MYCN, and 1 pmol for SHGC-154194
and WI-7221; and in the gene-specific experiments, 4 pmol for WI-7221, and 2 pmol for all
others. PCR for 20 cycles was confirmed in pilot
experiments to maintain linearity of generation of
the PCR products. PCR conditions, PAGE, and
the QM-PCR assay spanning a 26 Mbp region of
1q were performed as described (Corson et al.,
Genes, Chromosomes & Cancer DOI 10.1002/gcc
120
BOWLES ET AL.
TABLE 1. Gene-Specific QM-PCR Primers Used in this Study, Written 50 to 30
Gene symbola
KIF14
MYCN
DEK
E2F3
CDH11
NGFR
Band
Primer location
PCR product (bp)
Forward PCR primer
Reverse PCR primer
1q32.1
2p24.1
6p22
6p22
16q22
17q21
Intron 11-Exon 12
Intron 2
Exon 6
Intron 2-Exon 3
Intron 1
Intron 2
212
252
235
260
293
315
TGGAGGATTATGCTTACTGTGGA
CCAAAGAGTGGCATTGCCTTGT
GAGCATCTGTGAGGTTCTTG
AACGACAGCCTTGCTTCAGA
TACTGCCCATCAAATCCACCCT
AGACCACCACTGTAAGGTCA
TGCCATGTCTCTCTCCTGTTGA
TGCCAAGAAGACAGCTGTTGGA
CGTCAACAGAAGGTATAGTC
AGCACTTCTGCTGCCTTGTT
TGAGGCTGGATACCTACACTTG
TCAGGGCAGCCAGGATTTGAT
Full gene names: KIF14, kinesin family member 14; MYCN, v-myc myelocytomatosis viral related oncogene, neuroblastoma derived; DEK, DEK oncogene
(DNA binding); E2F3, E2F transcription factor 3; CDH11, cadherin 11, type 2, OB-cadherin; NGFR, nerve growth factor receptor (TNFR superfamily,
member 16).
a
2005). Positive controls were RB of known DNA
copy number for each of the STSs used in previous
studies (Chen et al., 2002; Marchong et al., 2004;
Corson et al., 2005). When amplification, rather
than low level gain, was detected, QM-PCR assays
were repeated without primers for the amplicon,
to enable accurate quantitation of the other
markers.
Copy number for each ‘‘hot spot’’ STS or gene
was calculated using the OpenGene system and
Gene Objects 3.1 software (Visible Genetics) as
described (Corson et al., 2005). The minimum
value for gain was the mean copy number +3 SD of
seven normal samples in the ‘‘hot spot’’ assay and
six normal samples in the gene-specific assay.
Amplification was defined as copy number 10.
For loss, the cutoff was 1.2, the mean of the overlap between samples of known one copy and
known two copies of the RB1 gene (Richter et al.,
2003). The coefficient of variance for each mean
copy number was <20%.
Paraffin FISH
A bacterial artificial chromosome (BAC) clone
containing the KIF14 and DDX59 genes, RP1192G12, and an adjacent intergenic BAC clone,
RP11-121P12 (Centre for Applied Genomics, Toronto, ON, Canada) were directly labeled with
Rhodamine-dUTP (Roche, Laval, QC, Canada) by
PCR as described (Stoecklein et al., 2002). FISH
to normal human lymphocytes confirmed the
genomic location of the BACs. Heparinized whole
blood was cultured with phytohemagglutinin for
72 hr in a CO2 incubator in RPMI 1640 containing
20% FCS, 1% (v/v) L-glutamine, and 1% (v/v) penicillin/streptomycin (Invitrogen, Burlington, ON,
Canada). The cells were harvested for cytogenetic
preparations as previously described (Bayani and
Squire, 2004). Metaphase slides were prepared and
aged for at least 1 week before use. Approximately
Genes, Chromosomes & Cancer DOI 10.1002/gcc
300 ng of labeled probes were precipitated in
excess human Cot-1 (Invitrogen) and sonicated
salmon sperm DNA (Roche) and resuspended in a
50% formamide, 10% dextran sulfate, and 23 SSC
hybridization buffer (DAKO, Mississauga, ON,
Canada). The probes were heat denatured and
hybridized to pepsin-treated and denatured normal
human metaphase slides as described previously
(Bayani and Squire, 2004). Following a rapid-wash
protocol of 0.43 SSC and 0.3% NP-40 at 728C for
3 min, then 23 SSC and 0.1% NP-40 at room temperature for 5 min, slides were mounted in DAPI/
Antifade (Vector Laboratories, Burlington, ON,
Canada) and visualized with a Zeiss Axioskop fluorescent microscope.
Unstained 6 lm paraffin embedded sections of
RB2306 were dewaxed in xylene and dehydrated
in 100% ethanol. The sections were incubated in
23 SSC at 758C for 20 min, followed by proteinase
K (0.25 mg/ml in 23 SSC) at 458C for 30 min. The
slides were passed through a dehydration series
and air-dried. Rhodamine-labeled RP11-92G12
and RP11-121P12 and FITC-labeled centromere 1
probes (Roche) were added to the processed paraffin sections and codenatured using the HybRite
System (Vysis, Downers Grove, IL) at 808C for
6 min and hybridized overnight at 378C. The slides
were rapidly washed as described above. To
confirm MYCN amplification, digoxigenin-labeled
probes for MYCN (Oncor, Gaithersburg, MA) and
FITC-labeled centromere 2 probes (Roche) were
hybridized to paraffin sections as described above.
Digoxigenin-labeled probes were detected with
an anti-digoxigenin antibody conjugated to FITC
(Roche). Slides were visualized using a motorizedstaged Zeiss Axioskop fluorescent microscope and
imaged using Z-stacking (AxioVision software). Copy
number changes were assessed by the number of
signals found within a nucleus above the cell ploidy
as determined by the number of centromeric
signals.
GENOMIC EVENTS IN RETINOBLASTOMA PROGRESSION
Statistical Analysis
Two-tailed Fisher’s exact test was used to analyze associations between regions of genomic
change, unilateral/bilateral diagnosis, cell line versus primary tumor, and sex, for the ‘‘hot spot’’
assay. Associations between regions of genomic
change and RB1 mutation type were analyzed by
the v2 test. P values of 0.05 were considered significant. Only 93 of the 94 RB studied were
included in the statistical analysis. RB2306 was
excluded since we could not obtain accurate copy
number estimates for all markers, possibly owing
to high-level amplification of both 1q (KIF14) and
MYCN.
RESULTS
"Hot Spot" QM-PCR Identifies
Gain/Loss Associations
To evaluate patterns of genomic gain and loss in
RB, we examined copy number by QM-PCR at
three gain/loss ‘‘hot spots’’ and MYCN simultaneously, in 87 primary tumors and 7 cell lines. This
patient cohort included 51 females and 43 males;
24 individuals were bilaterally and 70 were unilaterally affected. The genomic changes in 20 of
these samples were previously analyzed by CGH
(Chen et al., 2001).
Frequencies of genomic gain and loss were consistent with those shown previously by karyotype
(Squire et al., 1985; Potluri et al., 1986), CGH
(Mairal et al., 2000; Chen et al., 2001; Herzog et al.,
2001; Lillington et al., 2003; van der Wal et al.,
2003; Zielinski et al., 2005), and QM-PCR (Chen
et al., 2002; Marchong et al., 2004; Corson et al., 2005).
Overall, 1q32.1 gain was most common at 62%, followed by 16q22 loss (48%), 6p22 gain (43%), and
MYCN gain or amplification (18%) (Fig. 1). The
most common gains were low-level: marker copy
numbers for 1q32.1 averaged 2.60 6 0.66 (range:
0.86–4.84); for MYCN, 2.01 6 0.91 (range: 0.96–
5.70); and for 6p22, 2.51 6 1.02 (range: 0.77–5.60).
Loss at 16q22 was always single-copy loss, averaging
1.32 6 0.70 (range: 0.19–3.76) (Fig. 1A). No tumors
were nullizygous for the 16q22 STS. In 15% of samples, no genomic copy number changes at any of
the examined loci were detected.
RB cell lines showed a higher frequency of genomic changes (gain in 71% at 1q32.1 and 6p22, 57%
at 16q22 and MYCN) compared with primary tumors
(Table 2), although the differences were only significant for high level MYCN amplification (Fisher’s
exact P ¼ 0.043), which was present in 29% of cell
lines, compared with only 3% of primary RB. In
121
comparison with the 16% of primary tumors that
showed no copy number change at any of the loci
examined, beyond biallelic inactivation of RB1, all
cell lines showed at least two genomic changes (Fig.
1B, Table 2).
Considering cell lines and primary tumors together, we observed significant associations between
genomic changes (Fig. 1B). Gain at 1q and 6p positively associated (P ¼ 0.033) and 1q gain showed a
trend toward association with gain at MYCN (P ¼
0.095). MYCN gain and 16q22 loss were negatively
associated (P ¼ 0.031). Genomic changes did not associate with sex, type of RB1 mutations in the tumors,
or unilateral/bilateral diagnosis (data not shown).
Large copy number amplification was suggested
in QM-PCR by very large signals for some PCR
products, and failure of other low-copy number
products to amplify as expected, including the internal control. High-level amplification of MYCN was
observed in 5/94 RB samples, with a mean copy
number of 23.02 6 17.70 (range: 11–53) (Fig. 1A).
Since QM-PCR does not provide accurate numerical estimates of high-level amplification, these copy
numbers are approximations. These five samples
included two RB cell lines (Y79 and RB355) with
amplification at the MYCN locus previously identified by Southern blot (Squire et al., 1986), and three
primary tumors. Amplification of MYCN never
occurred with 16q22 loss (Fig. 1B). In one RB with
MYCN amplification, RB2306, a novel amplification
of SHGC-154194 at 1q32.1 was also detected, with
a mean copy number of 13.55 (Figs. 1A and 4A; see
below).
Gene-Specific QM-PCR for Candidate Oncogenes
and Tumor Suppressors
To ascertain whether gains of the ‘‘hot spot’’
STSs reflect gains of candidate oncogenes and tumor suppressor genes identified after the ‘‘hot
spot’’ study was initiated, we assembled a genespecific QM-PCR for KIF14 at 1q32.1, DEK and
E2F3 at 6p22, CDH11 at 16q22, NGFR at 17q21
(Table 1), and the 10q21 internal control. We compared genomic copy number profiles of 25 RB
(20 primary RB and five cell lines) with 12 primary
hepatocellular carcinomas and 12 breast cancer cell
lines.
Gene-specific gain and loss fractions in 20 primary RB were similar to those determined by ‘‘hot
spot’’ STSs. E2F3 and KIF14 were most commonly altered (Fig. 2A, Table 2). Percentage of primary RB showing gain was 70% for E2F3, 52% for
KIF14, 40% for DEK; and showing loss was 45%
for CDH11. No tumors showed gain or loss of
Genes, Chromosomes & Cancer DOI 10.1002/gcc
122
BOWLES ET AL.
Figure 1. Genomic copy number of "hot
spots" in 94 RB by QM-PCR. (A) Gain is scored
for tumors showing copy numbers 3 SD (red
line) above the average (black line) of normal
samples (black-filled circles). Loss is copy number 1.2 (blue line). Low-level gain (pink-filled
circles) and single-copy loss (blue-filled circles)
are the most common genomic changes seen in
RB. Amplification (10 copies) (green-filled
circles) is observed for MYCN (5/94 RB) and
1q32.1 (1/94 RB). The copy numbers for these
amplicons are estimates, since QM-PCR is
imprecise for quantitation of large amplicons.
Cell lines are indicated by orange bordered
circles. (B) Associations between genomic
changes. The most common gain in RB is
1q32.1, followed by 16q22 loss, 6p22 gain, and
MYCN gain. Gain at 1q32.1 occurs commonly
with 6p22 gain (Fisher’s exact P 5 0.033) and
MYCN gain (P 5 0.095). MYCN gain and 16q22
loss rarely occur together (P 5 0.031). Each
row represents an individual tumor or cell line,
while each column is the indicated marker. Pink
indicates gain; green, amplification; blue, loss;
white, no change; and gray, copy number not
determined. Cell lines are separated and
marked in orange.
NGFR. Again, the 5 RB cell lines included in this
assay (Fig. 2B; Table 2) showed a greater frequency of genomic gain than the primary tumors:
80% for KIF14, 60% for E2F3 or DEK. Every cell
line showed some genomic gain, but no cell line
showed CDH11 genomic loss.
The breast cancer and liver samples showed different patterns of genomic changes for these genes
than RB (Fig. 2). The percentage of breast cancer
cell lines showing gain was 50% for KIF14, 42% for
E2F3, 33% for NGFR, 17% for CDH11, and 8% for
DEK; and showing loss was 25% for NGFR and 8%
for CDH11 (Fig. 2C).
Genes, Chromosomes & Cancer DOI 10.1002/gcc
The percentage of hepatocellular carcinomas
showing gain was 58% for KIF14, 33% for E2F3,
17% for DEK, 17% for CDH11, and 8% for NGFR;
and E2F3, CDH11, and NGFR showed loss in one
sample each (Fig. 2D). While the cohort of each
cancer type was too small for statistical evaluation of
associated changes, qualitative patterns of changes
appeared different for the three types of tumor.
Gain of KIF14 and E2F3 Detected in Retinoblastoma
Bone Marrow Metastasis
We examined bone marrow containing metastatic RB prior to and after systemic chemotherapy.
123
GENOMIC EVENTS IN RETINOBLASTOMA PROGRESSION
TABLE 2. Gain/Loss Breakdown in "Hot Spot" and Gene-Specific QM-PCR Analyses of
Retinoblastoma Primary Tumors and Cell Lines
"Hot spot" QM-PCR
Primary
Cell lines
Gene-specific QM-PCR
Primary
53
33
62
5
2
71
11
10
52
35
51
41
5
2
71
Amp
No amp
%
41
45
48
4
3
57
a
3
2
60
9
11
45
8
12
40
13
73
15
3
2
60
8
12
40
3
2
60
0
5
0
4
3
57
14
73
16
4
3
57
MYCN amplification
MYCN amplification
overalla
2
84
2
3
84
3
73
14
84
E2F3 & DEK
MYCN overalla
2
5
29
7
0
100
2
5
29
P ¼ 0.043b
Any gain/loss
P ¼ 0.024b
Any gain/loss
Gain/loss
No gain/loss
%
Cell lines
CDH11
MYCN
Gain
No gain
%
Primary
DEK
14
6
70
16q
Loss
No loss
%
Cell lines
4
1
80
E3F3
6p
Gain
No gain
%
Primary
KIF14
1q
Gain
No gain
%
Cell lines
a
16
4
80
5
0
100
Including RB2306 data for KIF14 and MYCN, determined by FISH.
Statistically significant (Fisher’s exact test) differences in proportion of gain/loss (primary tumors versus cell lines) are indicated.
b
Prior to treatment, histopathology and RB1 mutant
allele-specific PCR (data not shown) demonstrated
RB in bone marrow, and QM-PCR showed gain of
both KIF14 (mean copy number 2.56) and E2F3
(mean copy number 2.85) (Fig. 3). After treatment,
bone marrow copy numbers of these genes were
normal (mean copy numbers 1.75 and 1.79, respectively).
A Novel 1q Amplicon Detected by QM-PCR
In the initial ‘‘hot spot’’ assay of primary tumor
RB2306, amplification of 1q32.1 and MYCN ablated peaks for 16q22 and 6p22, and reduced the
control 10q21 peak (Fig. 4A). Therefore, the
observed 1q32.1 and MYCN amplifications were
not artifacts of a deletion of the internal control
STS at 10q21, which would lead to artificially high
copy number estimates for all other STSs. Given
the novelty of this finding, we examined the
1q32.1 amplicon further with QM-PCRs spanning
a 26 Mbp region of chromosome arm 1q (Corson
et al., 2005) (Figs. 4B–4D). The internal control
peak (10q21) was vanishingly small, while amplification of 7–75 copies was seen for 13 of the 15 STSs,
spaced across the 26 Mbp region. STSs located
188.9 and 192.4 Mbp from 1pter were the only
STSs that did not show amplification; perhaps the
larger STSs are more sensitive than smaller PCR
products to depletion of reagents in a multiplex
containing amplified STSs.
To confirm amplification of 1q32.1 in RB2306,
we performed FISH with two BAC clones spanning approximately 232 kbp of 1q31-32 containing
KIF14 and one other gene, DDX59. The BAC
Genes, Chromosomes & Cancer DOI 10.1002/gcc
124
BOWLES ET AL.
Figure 2. Patterns of copy number
change of candidate oncogenes and tumor suppressors by QM-PCR in (A) RB
primary tumors, (B) RB cell lines, (C)
breast cancer cell lines, and (D) primary
hepatocellular carcinoma. Each tumor
type shows a qualitatively distinct ‘‘signature’’ of genomic changes. Each row
represents an individual tumor or cell
line, while each column is the indicated
gene. Color coding as in Fig. 1B.
Figure 3. Clearance of metastatic
RB shown by QM-PCR. The genomic
changes characteristic of RB are recognizable in bone marrow which contains
10% metastatic RB, as quantitated by
PCR for the specific mutant RB1 alleles
of the primary RB (not shown). By QMPCR, gain of KIF14 (1q32.1) and E2F3
(6p22) is apparent. After treatment,
when no signal was detectable for the
RB1 mutant alleles of the RB in bone
marrow and stem cells harvested for autologous stem cell rescue, genomic gain
of KIF14 and E2F3 was no longer evident.
clones mapped correctly to 1q31-32 in human lymphocytes (data not shown). Hybridization of the
BAC probes to formalin-fixed, paraffin embedded
Genes, Chromosomes & Cancer DOI 10.1002/gcc
tumor revealed amplification greater than ploidy
(Fig. 5). A region of normal retinal cells served as a
technical control for overall hybridization effi-
GENOMIC EVENTS IN RETINOBLASTOMA PROGRESSION
125
Figure 4. Tumor RB2306 shows 1q and
MYCN amplification. (A) QM-PCR "hot
spot" assay shows vanishingly small internal
control (10q21), 6p22, and 16q22 peaks in
comparison with the normal sample, while
the 1q32.1 and MYCN peaks in RB2306 are
large. (B–D) QM-PCR output of 15 STSs in
three multiplexes spanning a 26 Mbp region
of 1q (Corson et al., 2005). Amplification
was identified by the vanishingly small internal control peak (10q21) in RB2306 compared with the normal sample. Peaks are
indicated by the chromosome 1 location of
the STS (in Mbp from 1pter, based on NCBI
human genome build 36.1). Calculated copy
numbers for each STS in RB2306 are given;
nonamplified STSs are italicized.
ciency and scoring (Fig. 5A). In all tumor cells analyzed, at least 5–7 BAC signals were evident, with
centromere 1 showing 2–3 signals per cell (Fig. 5B).
There was little cell-to-cell variation in copy number of BAC and centromere signals throughout the
tumor specimen.
To confirm MYCN amplification in RB2306, we
performed FISH with a MYCN-specific probe,
which showed a mean of 5–7 signals per cell (Fig. 5D)
across the tumor specimen. The FISH signals in
tumor cells (Figs. 5B and 5D) were of variable
intensity compared with the more consistent intensity in adjacent normal retina (Figs. 5A and 5C),
suggesting that there might be multiple, variably
sized, contiguous amplicons. KIF14 and MYCN
probes were cohybridized and localized independently, indicating that these genes do not reside
within the same amplicon in RB2306 (Fig. 5D).
DISCUSSION
A Molecular Model of Retinoblastoma Progression
Nearly all RB tumors analyzed molecularly show
additional genomic changes (Squire et al., 1985;
Mairal et al., 2000; Chen et al., 2001; Herzog et al.,
2001; Lillington et al., 2003; van der Wal et al.,
2003; Zielinski et al., 2005) besides the initiating
M1 and M2 events, loss of both RB1 alleles. Our
present work represents the largest series to date
of RB characterized for genomic changes beyond
RB1. We examined RB for gain and loss of
genomic ‘‘hot spots’’ suggested by previous studies
(Chen et al., 2002; Marchong et al., 2004; Corson et
al., 2005), which may reflect the further mutational
events necessary for RB progression (M3 to Mn).
On the basis of the frequency of the genomic
changes and patterns of association between
Genes, Chromosomes & Cancer DOI 10.1002/gcc
126
BOWLES ET AL.
Figure 5. FISH analysis on paraffin sections of RB2306. (A) Normal
retinal cells hybridized with FITC-labeled (light blue) centromere 1 and
rhodamine-labeled (red) KIF14 show normal diploid hybridization patterns. Truncation of the cells due to sectioning results in loss of signals
in some cells. (B) Adjacent RB cells show additional copies of the
KIF14-containing BAC probe (red) over ploidy established by the centromere 1 probe (light blue). (C) Normal retinal cells hybridized with
FITC-detected (light blue) MYCN and rhodamine-labeled (red) KIF14
show diploid hybridization. (D) Adjacent RB cells show multiple signals
for MYCN (light blue) and KIF14 (red). MYCN and KIF14 do not co-localize within the cells, suggesting independent amplifications. Inset: A single
tumor cell shows at least six signals for KIF14 (red) and six signals for
MYCN (light blue). Original magnification 363.
Figure 6. Potential molecular model for RB progression, based on frequencies of gain/loss and associations
of genomic ‘‘hot spots.’’ Loss of each RB1 allele is shown as the M1 and M2 events, leading to the benign retinoma. 1q32.1 and 6p22 gain are the most common genomic changes, shown as M3 and M4. 16q22 loss and
MYCN gain negatively associate, so are shown as alternate M5 events. Note that this model only incorporates
‘‘hot spot’’ copy number changes, and not other molecular events in RB progression.
genomic regions in individual tumors (Fig. 1B), we
propose that the most common genomic changes in
RB, which may represent the M3 and M4 events,
are chromosome 1q32.1 and 6p22 gain (Figs. 1 and
6). These gains commonly occur together, further
supporting their shared role as early genomic
events in progression. 16q22 loss showed a negaGenes, Chromosomes & Cancer DOI 10.1002/gcc
tive association with MYCN gain, suggesting that
these might be alternate M5 events (Fig. 6).
Interestingly, in this cohort, we did not see the
positive association between 1q gain and 16q loss
noted in two previous studies (Oliveros and Yunis
1995; Herzog et al., 2001), possibly since these
studies considered whole chromosome arms, rather
GENOMIC EVENTS IN RETINOBLASTOMA PROGRESSION
than the ‘‘hot spots’’ studied here. This association
is consistent with our model (Fig. 6), however. The
lack of association between genomic changes and
unilateral/bilateral diagnosis, RB1 mutation type,
or gender (data not shown) suggests that once RB
is initiated, progression follows common pathways,
as previously observed (Chen et al., 2002; Marchong et al., 2004; Corson et al., 2005).
We observed a novel amplification at 1q32.1 in
one RB, RB2306 (Figs. 1, 4, and 5). There were no
unusual clinical features of this bilateral RB in a
female, although the tumor also showed MYCN
amplification. FISH for KIF14 and MYCN suggested independent amplicons (Fig. 5D). Highlevel amplification on 1q has been observed by
CGH in RB (Mairal et al., 2000; Lillington et al.,
2003), but not around 1q32.1, and has not previously been confirmed by FISH. We confirmed that
the novel 1q32.1 amplicon spans at least 26 Mbp
(Fig. 4). This strongly suggests the presence of an
oncogene(s) in this region; full definition of the
amplified genes is important. A possible candidate
oncogene in this amplicon is KIF14, which is
highly overexpressed in RB and other tumors
(Corson et al., 2005), and predicts outcome in
breast cancer (Corson and Gallie, 2006). The
1q32.1 BAC probes used in FISH span KIF14 and
one other gene, DDX59, which is not overexpressed in RB (Corson et al., 2005). The 1q32.1
oncogene could also be one of the 1q32 candidate
RB oncogenes proposed by Gratias et al. (2005).
Interphase FISH suggested 5–7 independent
KIF14 and MYCN signals per cell for each probe,
without evidence of colocalized FISH signals.
QM-PCR suggested overall higher copy numbers,
suggesting that there might be more than one gene
copy per FISH signal.
After we initiated the ‘‘hot spot’’ study, we identified candidate oncogenes and tumor suppressor
genes within the minimal regions of gain/loss in RB
that may be driving the genomic change. Gain/loss
fractions of the putative target oncogenes or tumor
suppressor genes in each genomic region (Fig. 2A)
were similar to the results of the ‘‘hot spot’’ QMPCR (Fig. 1B, Table 2). Interestingly, E2F3 showed
a much higher proportion of gain (70% of primary
tumors) than the 6p22 ‘‘hot spot’’ (41%), supporting
recent findings that the oncogene at 6p22 may not lie
within the previously determined minimal region of
gain (Grasemann et al., 2005; Orlic et al., 2006).
E2F3 is *2 Mbp removed from the ‘‘hot spot’’
marker used in the first QM-PCR.
Genomic gain/loss is not the only mechanism
dysregulating gene expression in RB. Although
127
p75NTR expression is lost (Dimaras et al., 2006),
we saw no gross NGFR genomic copy number
changes in RB (Fig. 2A). Loss of p75NTR expression may occur by mutations that do not affect
copy number, or via epigenetic or transcriptional
events. Aberrant methylation of genes (Choy et al.,
2002, 2004, 2005) and other unidentified genomic
events may also contribute to RB progression. Our
model of the molecular progression of RB (Fig. 6)
only incorporates data on the copy number changes
at specific ‘‘hot spots’’ presented in this paper.
Pattern of Genomic Changes Reflects Tumor Types
To demonstrate the utility of the QM-PCR
approach beyond RB, and to investigate in other
cancers the genomic status of the candidate cancer
genes identified in RB, we examined breast cancer
cell lines and primary hepatocellular carcinomas
(Fig. 2), two cancers also characterized by 1q gain,
6p gain, and 16q loss. KIF14 and E2F3 showed
high frequency gain in all three tumor types, suggesting that these might be ‘‘common’’ cancer
genes, likely owing to their roles in proliferation.
DEK genomic gain and CDH11 loss appeared to be
more restricted to RB. Interestingly, DEK gene
expression is increased in hepatocellular carcinoma
(Kondoh et al., 1999; Lu et al., 2005), and CDH11
expression is increased, not decreased, in breast
cancer (Pishvaian et al., 1999; Feltes et al., 2002).
Our findings suggest that the increases in expression seen in these two cancers are largely not mediated by genomic copy number change. The NGFR
gene shows both genomic gain and loss in breast
cancer cell lines, consistent with reports of variable
expression (Aragona et al., 2001; Sakamoto et al.,
2001; Davidson et al., 2004; Popnikolov et al.,
2005; Reis-Filho et al., 2006).
Genomic Copy Number Change Suggests
Proliferative Status
Amplification of a genomic region strongly suggests the presence of an oncogene, and MYCN has
been well characterized as such by amplification in
neuroblastoma (Schwab 2004) and less commonly
in RB (Lee et al., 1984; Squire et al., 1986; Sakai
et al., 1988; Choi et al., 1993; Doz et al., 1996;
Mairal et al., 2000; Herzog et al., 2001; Lillington
et al., 2002; Zielinski et al., 2005). Based on data
from 87 tumors, we provide a robust estimate that
MYCN amplification occurs in only 3% of primary
RB. The previous studies cited above have estimated a MYCN amplification frequency of 0–30%.
MYCN copy number gain and amplification in neuroblastoma and rhabdomyosarcoma are strongly
Genes, Chromosomes & Cancer DOI 10.1002/gcc
128
BOWLES ET AL.
associated with aggressive disease and poor prognosis (Chan et al., 1997; George et al., 2005; Williamson et al., 2005). We cannot examine the relationship of genomic changes to clinical prognosis
since all of the RB samples were obtained from
eyes removed in treatment that was curative, as is
usual for RB. We do not have clinical details of intraocular disease for most samples, since they were
submitted primarily for RB1 mutation identification; the samples were only used for research after
the clinical studies were complete. However, the
rare RB that grow in tissue culture (Gallie et al.,
1999b) do so because they have acquired autonomous features that may be a surrogate for more
aggressive tumors, consistent with our observation
of higher frequency of genomic change and MYCN
amplification in cell lines.
While MYCN gain or amplification were much
more common in cell lines than primary RB, loss of
the candidate tumor suppressor gene CDH11
(Marchong et al., 2004) was documented in 0% of 5
cell lines, compared with 45% in primary RB, suggesting that tumors with CDH11 loss do not have a
propensity for growth in culture. Of the primary
RB studied, 16% showed no genomic copy number
changes in the regions studied. We speculate that
these may be poorly proliferative tumors, akin to a
distinct nonproliferative retinal tumor consistent
with the benign precursor, retinoma (Gallie et al.,
1982). We have recently shown that retinoma
underlies proliferative RB in 15% of eyes removed
for treatment (Dimaras et al., submitted). Although
both alleles of RB1 were mutated in retinoma, as
in RB, retinoma expressed low levels of KIF14
and E2F3 that were highly expressed in the adjacent RB.
QM-PCR: A Rapid, Flexible, Screening Technique
with Diagnostic Potential
Genomic rearrangements and copy number
changes are irreversible indicators of tumor status.
Conversely, mRNA and protein expression are
influenced by numerous environmental factors,
such as hypoxia, in addition to cell of origin and
differentiation. Our data suggest that a genomic
profile might distinguish tumor types and subtypes
that might be relevant to treatment and prognosis.
Detection of metastatic RB in bone marrow by
QM-PCR for common genomic copy number
changes also indicates diagnostic potential. We
have used allele-specific PCR in surveillance for
RB1 mutant alleles in bone marrow and cerebrospinal fluid (Gallie et al., unpublished data), but we
were surprised that the genomic copy number
Genes, Chromosomes & Cancer DOI 10.1002/gcc
changes of metastatic RB were readily detectable
in untreated bone marrow. These genomic gains
ceased to be evident after chemotherapy, suggesting that this QM-PCR could be developed for clinical use.
We routinely use QM-PCR in the efficient clinical identification of RB1 mutations, where optimization of copy number detection is subjected to
regular audit (Richter et al., 2003). Here, we used
QM-PCR to generate a possible model of genomic
progression in RB, to identify a novel amplicon,
and to assess the genomic status of candidate oncogenes and tumor suppressors not only in RB but
also in breast and liver cancers. QM-PCR is thus
rapid, sensitive, and cost effective for simultaneous
analysis of defined genomic regions in large numbers of samples. Cumulatively, our results provide
insight into the order and diagnostic value of specific, key genomic changes in RB, and the potential
general importance of these changes in cancer.
ACKNOWLEDGMENTS
The authors thank Professors Michael O’Keefe
and Susan Kennedy of Dublin, Ireland, for providing DNA and sections for FISH analysis, Solutions
by Sequence for DNA samples and QM-PCR
equipment, and advice, and members of the Gallie
laboratory for their input.
REFERENCES
Aragona M, Panetta S, Silipigni AM, Romeo DL, Pastura G, Mesiti
M, Cascinu S, La Torre F. 2001. Nerve growth factor receptor
immunoreactivity in breast cancer patients. Cancer Invest 19:
692–697.
Bailey JA, Yavor AM, Massa HF, Trask BJ, Eichler EE. 2001. Segmental duplications: Organization and impact within the current
human genome project assembly. Genome Res 11:1005–1017.
Baudis M, Cleary ML. 2001. Progenetix.net: An online repository
for molecular cytogenetic aberration data. Bioinformatics 17:1228–
1229.
Bayani J, Squire J. 2004. Fluorescence in situ hybridization. In:
Bonifacino JS, Dasso M, Lippincott-Schwartz J, Yamada KM, editors. Current Protocols in Cell Biology. Hoboken, NJ: Wiley, Unit
22.4.
Chan HS, Gallie BL, DeBoer G, Haddad G, Ikegaki N, Dimitroulakos J, Yeger H, Ling V. 1997. MYCN protein expression as a predictor of neuroblastoma prognosis. Clin Cancer Res 3:1699–1706.
Chen D, Gallie BL, Squire JA. 2001. Minimal regions of chromosomal imbalance in retinoblastoma detected by comparative
genomic hybridization. Cancer Genet Cytogenet 129:57–63.
Chen D, Pajovic S, Duckett A, Brown VD, Squire JA, Gallie BL.
2002. Genomic amplification in retinoblastoma narrowed to 0.6
megabase on chromosome 6p containing a kinesin-like gene,
RBKIN. Cancer Res 62:967–971.
Choi SW, Lee TW, Yang SW, Hong WS, Kim CM, Lee JO. 1993.
Loss of retinoblastoma gene and amplification of N-myc gene in
retinoblastoma. J Korean Med Sci 8:73–77.
Choy KW, Lee TC, Cheung KF, Fan DS, Lo KW, Beaverson KL,
Abramson DH, Lam DS, Yu CB, Pang CP. 2005. Clinical implications of promoter hypermethylation in RASSF1A and MGMT in
retinoblastoma. Neoplasia 7:200–206.
Choy KW, Pang CP, Fan DS, Lee TC, Wang JH, Abramson DH, Lo
KW, To KF, Yu CB, Beaverson KL, Cheung KF, Lam DS. 2004.
Microsatellite instability and MLH1 promoter methylation in
human retinoblastoma. Invest Ophthalmol Vis Sci 45:3404–3409.
GENOMIC EVENTS IN RETINOBLASTOMA PROGRESSION
Choy KW, Pang CP, To KF, Yu CB, Ng JS, Lam DS. 2002. Impaired
expression and promotor hypermethylation of O6-methylguanineDNA methyltransferase in retinoblastoma tissues. Invest Ophthalmol Vis Sci 43:1344–1349.
Corson TW, Gallie BL. 2006. KIF14 mRNA expression is a predictor of grade and outcome in breast cancer. Int J Cancer 119:1088–
1094.
Corson TW, Huang A, Tsao MS, Gallie BL. 2005. KIF14 is a candidate oncogene in the 1q minimal region of genomic gain in multiple cancers. Oncogene 24:4741–4753.
Davidson B, Reich R, Lazarovici P, Ann Florenes V, Nielsen S, Nesland JM. 2004. Altered expression and activation of the nerve
growth factor receptors TrkA and p75 provide the first evidence
of tumor progression to effusion in breast carcinoma. Breast Cancer Res Treat 83:119–128.
Dimaras H, Coburn B, Pajovic S, Gallie BL. 2006. Loss of p75 neurotrophin receptor expression accompanies malignant progression
to human and murine retinoblastoma. Mol Carcinogen 45:333–
343.
Doz F, Peter M, Schleiermacher G, Vielh P, Validire P, Putterman
M, Blanquet V, Desjardins L, Dufier JL, Zucker JM, Mosseri V,
Thomas G, Magdelenat H, Delattre O. 1996. N-MYC amplification, loss of heterozygosity on the short arm of chromosome 1 and
DNA ploidy in retinoblastoma. Eur J Cancer 32A:645–649.
Feltes CM, Kudo A, Blaschuk O, Byers SW. 2002. An alternatively
spliced cadherin-11 enhances human breast cancer cell invasion.
Cancer Res 62:6688–6697.
Gallie BL, Campbell C, Devlin H, Duckett A, Squire JA. 1999a.
Developmental basis of retinal-specific induction of cancer by RB
mutation. Cancer Res 59:1731s–1735s.
Gallie BL, Ellsworth RM, Abramson DH, Phillips RA. 1982. Retinoma: Spontaneous regression of retinoblastoma or benign manifestation of the mutation? Br J Cancer 45:513–521.
Gallie BL, Trogadis J, Han L-P. 1999b. Retinoblastoma. In: Masters
JR, Palsson B, editors. Human Cell Culture. Dordrecht: Springer,
pp. 361–374.
George RE, London WB, Cohn SL, Maris JM, Kretschmar C, Diller
L, Brodeur GM, Castleberry RP, Look AT. 2005. Hyperdiploidy
plus nonamplified MYCN confers a favorable prognosis in children
12 to 18 months old with disseminated neuroblastoma: A pediatric
oncology group study. J Clin Oncol 23:6466–6473.
Godbout R, Packer M, Bie W. 1998. Overexpression of a DEAD box
protein (DDX1) in neuroblastoma and retinoblastoma cell lines.
J Biol Chem 273:21161–21168.
Grasemann C, Gratias S, Stephan H, Schuler A, Schramm A, KleinHitpass L, Rieder H, Schneider S, Kappes F, Eggert A, Lohmann
DR. 2005. Gains and overexpression identify DEK and E2F3 as
targets of chromosome 6p gains in retinoblastoma. Oncogene
24:6441–6449.
Gratias S, Schuler A, Hitpass LK, Stephan H, Rieder H, Schneider S,
Horsthemke B, Lohmann DR. 2005. Genomic gains on chromosome 1q in retinoblastoma: Consequences on gene expression and
association with clinical manifestation. Int J Cancer 116:555–563.
Herzog S, Lohmann DR, Buiting K, Schuler A, Horsthemke B,
Rehder H, Rieder H. 2001. Marked differences in unilateral isolated retinoblastomas from young and older children studied by
comparative genomic hybridization. Hum Genet 108:98–104.
Knudson AG, Jr. 1971. Mutation and cancer: Statistical study of retinoblastoma. Proc Natl Acad Sci USA 68:820–823.
Kondoh N, Wakatsuki T, Ryo A, Hada A, Aihara T, Horiuchi S,
Goseki N, Matsubara O, Takenaka K, Shichita M, Tanaka K,
Shuda M, Yamamoto M. 1999. Identification and characterization
of genes associated with human hepatocellular carcinogenesis.
Cancer Res 59:4990–4996.
Lee WH, Murphree AL, Benedict WF. 1984. Expression and amplification of the N-myc gene in primary retinoblastoma. Nature
309:458–460.
Lillington DM, Goff LK, Kingston JE, Onadim Z, Price E, Domizio
P, Young BD. 2002. High level amplification of N-MYC is not
associated with adverse histology or outcome in primary retinoblastoma tumours. Br J Cancer 87:779–782.
129
Lillington DM, Kingston JE, Coen PG, Price E, Hungerford J,
Domizio P, Young BD, Onadim Z. 2003. Comparative genomic
hybridization of 49 primary retinoblastoma tumors identifies chromosomal regions associated with histopathology, progression, and
patient outcome. Genes Chromosomes Cancer 36:121–128.
Lu ZL, Luo DZ, Wen JM. 2005. Expression and significance of tumor-related genes in HCC. World J Gastroenterol 11:3850–3854.
Mairal A, Pinglier E, Gilbert E, Peter M, Validire P, Desjardins L,
Doz F, Aurias A, Couturier J. 2000. Detection of chromosome
imbalances in retinoblastoma by parallel karyotype and CGH
analyses. Genes Chromosomes Cancer 28:370–379.
Marchong MN, Chen D, Corson TW, Lee C, Harmandayan M, Bowles
E, Chen N, Gallie BL. 2004. Minimal 16q genomic loss implicates
cadherin-11 in retinoblastoma. Mol Cancer Res 2:495–503.
Oliveros O, Yunis E. 1995. Chromosome evolution in retinoblastoma. Cancer Genet Cytogenet 82:155–160.
Orlic M, Spencer CE, Wang L, Gallie BL. 2006. Expression analysis
of 6p22 genomic gain in retinoblastoma. Genes Chromosomes
Cancer 45:72–82.
Pishvaian MJ, Feltes CM, Thompson P, Bussemakers MJ, Schalken
JA, Byers SW. 1999. Cadherin-11 is expressed in invasive breast
cancer cell lines. Cancer Res 59:947–952.
Popnikolov NK, Cavone SM, Schultz PM, Garcia FU. 2005. Diagnostic utility of p75 neurotrophin receptor (p75NTR) as a marker
of breast myoepithelial cells. Mod Pathol 18:1535–1541.
Potluri VR, Helson L, Ellsworth RM, Reid T, Gilbert F. 1986. Chromosomal abnormalities in human retinoblastoma. A review. Cancer 58:663–671.
Reis-Filho JS, Steele D, Di Palma S, Jones RL, Savage K, James M,
Milanezi F, Schmitt FC, Ashworth A. 2006. Distribution and significance of nerve growth factor receptor (NGFR/p75NTR) in
normal, benign and malignant breast tissue. Mod Pathol 19:307–
319.
Richter S, Vandezande K, Chen N, Zhang K, Sutherland J, Anderson
J, Han L, Panton R, Branco P, Gallie B. 2003. Sensitive and efficient detection of RB1 gene mutations enhances care for families
with retinoblastoma. Am J Hum Genet 72:253–269.
Sakai K, Tanooka H, Sasaki MS, Ejima Y, Kaneko A. 1988. Increase
in copy number of N-myc in retinoblastomas in comparison with
chromosome abnormality. Cancer Genet Cytogenet 30:119–126.
Sakamoto Y, Kitajima Y, Edakuni G, Hamamoto T, Miyazaki K.
2001. Combined evaluation of NGF and p75NGFR expression is
a biomarker for predicting prognosis in human invasive ductal
breast carcinoma. Oncol Rep 8:973–980.
Schwab M. 2004. MYCN in neuronal tumours. Cancer Lett 204:
179–187.
Squire J, Gallie BL, Phillips RA. 1985. A detailed analysis of chromosomal changes in heritable and non-heritable retinoblastoma.
Hum Genet 70:291–301.
Squire J, Goddard AD, Canton M, Becker A, Phillips RA, Gallie
BL. 1986. Tumour induction by the retinoblastoma mutation is independent of N-myc expression. Nature 322:555–557.
Stoecklein NH, Erbersdobler A, Schmidt-Kittler O, Diebold J,
Schardt JA, Izbicki JR, Klein CA. 2002. SCOMP is superior to
degenerated oligonucleotide primed-polymerase chain reaction
for global amplification of minute amounts of DNA from microdissected archival tissue samples. Am J Pathol 161:43–51.
van der Wal JE, Hermsen MA, Gille HJ, Schouten-Van Meeteren
NY, Moll AC, Imhof SM, Meijer GA, Baak JP, van der Valk P.
2003. Comparative genomic hybridisation divides retinoblastomas
into a high and a low level chromosomal instability group. J Clin
Pathol 56:26–30.
Williamson D, Lu YJ, Gordon T, Sciot R, Kelsey A, Fisher C, Poremba C, Anderson J, Pritchard-Jones K, Shipley J. 2005. Relationship between MYCN copy number and expression in rhabdomyosarcomas and correlation with adverse prognosis in the alveolar
subtype. J Clin Oncol 23:880–888.
Zielinski B, Gratias S, Toedt G, Mendrzyk F, Stange DE, Radlwimmer B, Lohmann DR, Lichter P. 2005. Detection of chromosomal imbalances in retinoblastoma by matrix-based comparative
genomic hybridization. Genes Chromosomes Cancer 43:294–301.
Genes, Chromosomes & Cancer DOI 10.1002/gcc