Download chickenpox monoarthritis: demonstration of varicella–zoster virus in

British Journal of Rheumatology 1998;37:311–313
CHICKENPOX MONOARTHRITIS: DEMONSTRATION OF VARICELLA–ZOSTER
VIRUS IN JOINT FLUID BY POLYMERASE CHAIN REACTION
S. STEBBINGS, J. HIGHTON, M. C. CROXSON,† K. POWELL,† J. MCKAY† and J. RIETVELD*
Departments of Medicine and *Orthopaedic Surgery, Dunedin School of Medicine and †Department of Virology, Auckland
Hospital, New Zealand
SUMMARY
A case of chickenpox monoarthritis is described. The presence of varicella–zoster virus ( VZV ) within the joint was demonstrated
by the detection of viral DNA in synovial fluid at a time when peripheral blood cells were negative. This strongly suggests a
direct role of VZV in causing monoarthritis complicating chickenpox. The use of the polymerase chain reaction allows more
rapid (2 days) confirmation of the diagnosis. Early enough diagnosis would raise the question of using acyclovir to shorten
the duration of arthritis.
K : Chickenpox, Monoarthritis, Varicella–zoster, PCR.
A is a rare, but well-recognized complication
of acute varicella–zoster in children. Over the last
25 yr, there have been several isolated case reports,
usually of a monoarthritis occurring at the time of
onset of the exanthem or shortly afterwards. We
describe a case in which the presence of varicella–
zoster virus ( VZV ) was demonstrated by the detection
of VZV DNA in joint fluid. This strongly suggests a
direct role for VZV in causing this rare complication
of chickenpox and the usefulness of a polymerase chain
reaction (PCR)-based assay for rapid confirmation of
the diagnosis.
negative for bacteria. Auromine-O stain for acid-fast
bacilli was negative. Full blood count: haemoglobin
12.5 g/dl, white cell count 5.90, PMN 3.44, lymphocytes 1.74, monocytes 0.60, platelets 220, erythrocyte
sedimentation rate ( ESR) 8 mm/h, C-reactive protein
(CRP) 1 mg/l. Blood cultures were negative. She was
admitted for bed rest and splintage. A provisional
diagnosis of chickenpox with monoarthritis was made.
Three days later, the knee had again developed a tense
effusion. This was aspirated and 50 ml of ambercoloured fluid obtained and sent for viral studies.
Swabs were also taken from the base of de-roofed
crusted vesicles on her back. Over the next 3 days, her
knee swelling did not return and she was discharged
home. Assessment 2 months later showed her to be
asymptomatic and functioning normally. However,
there was mild persisting synovial thickening in the
right knee joint and the presence of a small effusion
was noted, consistent with mild persistent joint
inflammation.
CASE PRESENTATION
A 10-year-old girl presented to hospital with a 24 h
history of acute swelling of the right knee which
developed after apparently minor trauma. Over the
preceding 10 days, she had had a sore throat and
been subdued. Five days prior to presentation, she
had developed a rash over her trunk which had
persisted.
On examination, she was flushed and febrile (temperature 38°C ). She had a maculopapular, vesicular
eruption over her chest, back and abdomen. The right
knee was extremely swollen, with a tense effusion. It
was tender, and flexion was limited to 30°. She was
unable to bear weight because of pain.
She was admitted to hospital and underwent arthroscopy and wash-out, in order to exclude a septic
arthritis. A fibrinous exudate and a large quantity of
straw-coloured fluid were removed. The synovium was
noted to be boggy and hypertrophied. Synovial fluid
showed 1650 white blood cells ( WBC )/mm3: 95%
mononuclear cells (mature lymphoccytes and macrophages), 5% polymorphonuclear leucocytes (PMN ).
No organisms were noted on microscopy. Culture was
VIROLOGY TESTING
Samples submitted for virology analysis comprised
washings from the right knee joint collected on
23 November 1996, aspirate from the right knee joint
collected on 26 November 1996, swab from skin lesion
collected on 26 November 1996, and peripheral white
blood cells and serum obtained on 27 November 1996.
Methods
Samples were tested for the presence of VZV DNA
by PCR amplification using primers targeting a
sequence within VZV gene 31. The primer sequences
were chosen from a region of VZV gene 31 displaying least homology to cellular or other viral
sequences. Primer sequences are VZVK1-GCCCGTC
TCTATCTCCAAGAATT (upstream) and VZVK2ACGACGAGGAGATACGTGCCAA (downstream).
Peripheral white blood cells were prepared from
anticoagulated blood by red cell lysis, washing and
concentration by centrifugation. Aliquots of 250 ml of
sample, joint fluids or WBC suspensions were solubilized in SDS proteinase K lysis buffer and the DNA
Submitted 19 February 1997; revised version accepted 14 July
1997.
Correspondence to: J. Highton, Department of Medicine,
University of Otago School of Medicine, PO Box 913, Dunedin,
New Zealand.
© 1998 British Society for Rheumatology
311
312
BRITISH JOURNAL OF RHEUMATOLOGY VOL. 37 NO. 3
extracted by phenol/chloroform extraction. DNA was
recovered following overnight precipitation from 70%
ethanol at −20°C. The DNA pellet was redissolved in
50 ml of water. An aliquot of this material was used
for spectrophotometric determination of DNA concentration. The PCR reactions for knee washings and
knee aspirate both contained the maximum volume of
sample (10 ml ), corresponding, respectively, to 30 000
and 100 000 cell equivalents of DNA. The PCR reaction for WBC contained 167 000 cell equivalents of
DNA.
The reaction mixture contained 16.6 m ammonium sulphate, 67 m Tris–HCl (pH 8.8), 6.7 m
magnesium chloride, 10 m b-mercaptoethanol, 6.7 m
EDTA, 1.5 m each of dATP, dCTP, dGTP and dTTP,
and 170 mg/ml of bovine serum albumin (Sigma). Two
units of Taq polymerase (Life Technologies Inc.) were
added to each 50 ml reaction mixture.
Two aliquots of lysis solution were passed through
the DNA extraction procedure as controls for contamination; these were amplified (one result shown). DNA
quality of the specimens was verified by parallel amplification of a 317 bp fragment of the b microglobulin
2
gene (results not shown). DNA from peripheral WBC
was controlled for inhibitors by spiking an aliquot
with VZV DNA.
PCR reactions were denatured at 95°C for 3 min,
followed by cycling at 60°C for 30 s, 65°C for 2 min,
95°C for 1 min. Forty cycles of amplification were
performed. The 219 bp amplimer from the reaction
was electrophoresed on a 2% agarose gel and visualized
by ethidium bromide staining.
Specific antibody to VZV was measured by indirect
immunofluorescence. Cross-reacting antibodies were
removed from the serum by prior absorption with a
herpes simplex type I and II cell culture slurry. Slide
preparations of VZV-infected human fibroblast cells
were obtained from Gull (Cat #VZ211E; Gull
Laboratories Inc., UT 84117, USA).
RESULTS
Knee washings, knee aspirate and skin swab were
all positive for VZV DNA ( Fig. 1). Peripheral WBC
were negative for VZV DNA (Fig. 1). The identity of
the amplimer was confirmed by restriction endonuclease analysis (Fig. 2). Both negative control aliquots of
lysis solution were negative for VZV DNA (one result
shown). The peripheral WBC DNA control, spiked
with VZV DNA, gave an amplified product of expected
size, thus confirming there was no inhibition of VZV
amplification (result not shown).
Antibody titres were as follows (Table I ). Knee
washings consisted of synovial fluid diluted to an
unknown extent by saline wash-out solution. Knee
aspirate was undiluted synovial fluid. Parallel mumps
titres on these three samples (IgM, IgG, IgA) were all
negative at 1:16 with the exception of the serum mumps
titre of 1:128. Titres to mumps virus provided a marker
antibody to control for passive contamination of
synovial fluid with serum.
F. 1.—PCR product was electrophoresed on a 2% agarose gel and
stained with ethidium bromide. A specific amplimer of 219 bp is
produced from VZV-positive specimens. Lane 1, knee washings;
lane 2, knee aspirate; lane 3, skin swab; lane 4, peripheral white
blood cells; lane 5, no DNA control; lane 6, VZV-positive control;
lane M, molecular weight markers (Boehringer Mannheim
#13360455). The 219 bp position of the VZV amplimer is indicated.
F. 2.—The identity of the 219 bp PCR product was confirmed
using the restriction enzyme Hinfl. Lane 1, knee aspirate, digested
with Hinfl; lane 2, knee aspirate, not digested; lane 3, skin swab,
digested with Hinfl; lane 4, skin swab, not digested; lane 5, VZVpositive control, digested with Hinfl; lane 6, VZV-positive control,
not digested. Digestion of the amplimer yields fragments of 65 and
154 bp. Lanes 1, 3 and 5 show Hinfl-digested PCR product. A small
amount of the 219 bp amplimer remains and a strong band of 154 bp
has been formed. The 65 bp product does not resolve on this gel,
but may be seen at the ion front of the gel where the higher salt
concentration in the restriction digestion buffer has caused some
local distortion.
TABLE I
Antibody titres to VZV determined by indirect immunofluorescence
Knee washings
(23.12.96)
Knee aspirate
(26.12.96)
Antibody
class
VZV
VZV
IgM
IgG
IgA
< 1:4 < 1:16
1:32 < 1:16
< 1:4 < 1:16
Mumps
Mumps
< 1:4
< 1:16
1:256 < 1:16
1:16 < 1:16
Serum
(27.12.96)
VZV
Mumps
1:256
1:1024
1:256
< 1:16
1:128
< 1:16
DISCUSSION
Non-bacterial arthritis occurring during the course
of chickenpox in children has been recognized from at
least 1931 [1]. More recently, there have been several
individual case reports, involving children aged
2–10 yr. Most commonly a monoarthritis is described,
STEBBINGS ET AL.: CHICKENPOX MONOARTHRITIS
often affecting the knee [2–4]. Other joints have been
involved and polyarticular cases have also been
described [5, 6 ].
Although the clinical diagnosis of chickenpox is
usually straightforward, by the time this patient presented with arthritis the skin rash had crusted and
viral antigens were not demonstrable by direct
immunofluorescence. It was, therefore, reassuring to
confirm the diagnosis both by the presence of VZVspecific IgM and IgA in the serum, and by demonstrating VZV DNA in the swab from a skin lesion. Absence
of VZV DNA in the peripheral WBC 9 days after
cessation of new vesicle formation was consistent with
clearance of viraemia.
VZV DNA was present at high titre in synovial
fluid, both in the joint washings obtained at the acute
phase of the arthritis and again 3 days later when the
inflammation was less acute. Bacterial cultures of joint
fluid were negative at all times. Although the presence
of VZV DNA does not prove that viral replication
was occurring at the site, the high titre of VZV DNA
present in the joint fluid favours active local production. The absence of viral DNA in peripheral WBC at
that time excludes passive contamination with viraemic
blood. The DNA loading from peripheral WBC was
five times that of the joint washings and twice that of
the joint aspirate. The number of mononuclear cells
amplified from peripheral WBC was, therefore, equivalent to or in excess of the number amplified from joint
washings or aspirate. Antibody to VZV was present to
excess in synovial fluid when compared to mumps
antibody, selected as a comparative marker for passive
entry of immunoglobulin into the joint. Excess of
specific antibody suggests local antigenic stimulation.
There are rare reports in the literature describing
isolation of infectious VZV from synovial fluid [7, 8]
313
and, more recently, a report where VZV DNA was
demonstrated in the joint effusion by PCR [9]. Our
findings support these previous observations and reiterate the diagnostic utility of PCR-based technology.
Where there is fever and acute monoarthritis, a
bacterial aetiology must be considered. Once negative
bacterial cultures were obtained, the ability of PCR to
provide a rapid positive diagnosis (2 days) was of great
value to further clinical management. Classical viral
culture methods require in excess of 10 days for the
identification of VZV. Finding VZV within the joint
raises the question of using acyclovir in an attempt to
shorten the duration of arthritis.
R
1. Schnitzer TJ. Viral arthritis. In: Kelly W, Harris E,
Ruddy S, Sledge C, eds. Textbook of rheumatology, 3rd
edn. Philadelphia: WB Saunders Co., 1989:1611–28.
2. Ward JR, Bishop B. Varicella arthritis. J Am Med Assoc
1970;212:1954–6.
3. Mulhern LM, Friday GA, Perri JA. Arthritis complicating
varicella infection. Pediatrics 1971;48:827–9.
4. Di Liberti JH, Bartel SJ, Humphrey TR, Pang AW. Acute
monoarticular arthritis in association with varicella. A
case report. Clin Pediatr 1977;16:7:663–4.
5. Friedman A, Naveh Y. Polyarthritis associated with
chickenpox. Am J Dis Child 1971;122:179–80.
6. Cwajgenbaum M, Azem I, Weisbrod M. Arthritis in
chickenpox. [Letter] Am J Dis Child 1986;140:502.
7. Priest JR, Urick JJ, Groth KE, Balfour HH Jr. Varicella
arthritis documented by isolation of virus from joint fluid.
J Pediatr 1978;93:990–2.
8. Fink CG, Read SJ, Giddins G, Eglin RP. Chickenpox
infection (varicella zoster virus) and acute monoarthritis:
Evidence against a direct viral mechanism. J Clin Pathol
1992;45:267–9.
9. Baird RE, Daly P, Sawyer MH. Varicella arthritis
diagnosed by polymerase chain reaction. J Pediatr Infect
Dis 1991;10:950–2.