Download Coding Region of NKX3.1, a Prostate-Specific

[CANCER RESEARCH 57. 4455-4459.
October 15. 1997]
Advances in Brief
Coding Region of NKX3.1, a Prostate-Specific
Mutated in Human Prostate Cancers1
Homeobox Gene on 8p21, Is Not
H. James Voeller, Meena Augustus,2 Victor Madike,2 G. Steven Bova, Kenneth C. Carter, and Edward P. Gelmann3
Division of Hemato/ogy/Oncology, Lombardi Cancer Center, Georgetown University Medical Center, Washington, DC 20007-2197 [H. J. V., E. P. GJ; Department of Molecular
Biologv, Human Genome Sciences Inc., Rockville, Maryland 20850 [M. A., V. M., K. C. C.I; and Brady Urological institute, Johns Hopkins University, Baltimore, Maryland
21287 ¡G.S. B.I
Abstract
Loss of heterozygosity
at chromosome
8p21-22
is common in human
prostate cancer, suggesting the presence of one or more tumor suppressor
genes at this locus. A homeobox gene that is expressed specifically in adult
human prostate, NKX3.1, the expression of which is regulated by androgen, maps to chromosome 8p21. Fine structure in situ mapping showed
that NKX3.I is proximal to MSRÌ2(macrophage scavenger receptor type
II) and /./'/ (human lipoprotein lipase) and very close to NEFL (human
neurofilament
light chain) on 8p21. Single-strand
conformational
NKX3.1 in prostate cancer tissues to identify possible mutations that
would be expected to occur in conjunction with LOH at 8p21 if
NKX3.1 were a prostate cancer tumor suppressor gene. This assump
tion was based on the paradigm of tumor suppressor gene inactivation
that often involves deletion of one alÃ-eleand point mutation or other
targeted disruption of the contralateral alÃ-ele.
Materials and Methods
poly
FISH Mapping. Three cDNA probes, MSR (HSRAV71; 1.5 kb). LPL
(HMSCL84; 2.5 kb), and NEFL (HKBIF36; 1.79 kb), obtained from the
Human Genome Sciences database were used for cohybridization. in doubleand triple-label experiments. We determined that all three cDNAs were iden
morphism analysis of 48 radical prostatectomy cancer specimens and 3
métastases for the entire coding region of NKX3.1 showed no tumorspecific sequence alterations in 50 specimens and total absence of the gene
in 1 specimen known to have a biallelic deletion of 8p21. NKX3.1 was
found to have a polymorphism at nucleotide 154 in codon 52 that resulted
in a CGC—»TGCsequence change and an Arg—»Cys
amino acid alter
tical to MSRI, LPL, and NEFL in GenBank and the public domain using the
BLAST algorithm (12). Prometaphase chromosome spreads were obtained
from phytohemagglutinin-stimulated
lymphocytes in normal male peripheral
blood by conventional high-resolution chromosome preparation methods.
Single-copy gene FISH methods were applied with minor modifications (13,
ation (R52C). This polymorphism was present in 20% of DNA samples. If
NKX3.1 is a target of the 8p21 LOH, it is not via disruption of the coding
region of the gene.
14). The three marker cDNAs, MSR. LPL, and NEFL, were nick translated
using both biotin 14-dATP and dig 11-dUTP and used as probes in various
experiments. A biotin-labeled probe of the 20-kb A genomic DNA for NKX3.1
Introduction
LOH,4 homozygous deletion, and methylation-associated
was used consistently in all of the experiments for the sake of uniformity. In
the double-label experiments, MSR, LPL, and NEFL cDNAs were cohybrid-
silencing
of genes within the chromosome region 8p21-22 are the most com
monly described genetic aberrations in prostate cancer (1-8). This
implies that one or more tumor suppressor genes reside on 8p and that
one of the two alÃ-elesof the gene(s) is inactivated by the LOH at 8p21.
NKX3.1 is a homeobox gene that is highly conserved in mouse and
human DNA (9, 10). Human NKX3.I was initially isolated from
cDNA libraries made from two samples of prostate cancer tissue. The
gene was mapped to 8p21 (11). Expression of NKX3.1 in adult human
tissues was found to be restricted to the prostate, with a very low level
of expression also seen in testis. Among a large panel of cell lines
tested, expression of NKX3.I was restricted to the LNCaP prostate
cancer cell line, where it was induced by treatment of the cells with
androgens (II).5
Because of its chromosomal location and the prostate-specific
expression of this gene, we undertook fine mapping ofNKXJ.l to map
its chromosomal location with respect to other 8p markers known to
be deleted in prostate cancer. We also performed SSCP analysis of
Received 6/26/97; accepted 8/28/97.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
' This work was supported by NIH Grant CA57178 to E.P.G. and by an award from
the CaPCURE Foundation.
2 These authors contributed equally to this work.
1 To whom requests for reprints should be addressed, at Division of Hematology/
Oncology. Lombardi Cancer Center. Georgetown University Medical Center. 3800 Res
ervoir Road NW, Washington, DC 20007-2197. Phone: (202) 687-2207; Fax: (202) 7841229; E-mail: [email protected].
4 The abbreviations used are: LOH, loss of heterozygosity; FISH, fluorescence in situ
hybridization; SSCP. single-strand conformational polymorphism; DAPI, 4',6-diamidino2-phenylindole.
5 J. Prescott and D. Tindall. submitted for publication.
ized with NKX3.1 on separate slides to fix the gene order along the chromo
some. To determine the precise chromosomal location of the NKX3.1 with
reference to the frequently used markers in the 8p21-22 region and to resolve
the gene order in this minimal region of LOH on 8p with respect to NKX3.Ì
at
8p21, triple-label experiments were done using any two of the marker cDNAs
and NKX3.Ì.Each hybridization in the double-label experiments was per
formed using a mixture of 100 ng of each marker (digoxigenin-labeled) and
NKX3.1 (biotin-labeled). In the triple-label experiments, using NKX3.1 to
gether with two of the markers simultaneously, orange signal was obtained by
using a mixture of 50 ng each of the digoxigenin- and biotin-labeled probes.
Detection was done using FITC-conjugated avidin and antidigoxigenin-conjugated rhodamine (Boehringer Mannheim) for the biotin and digoxigenin
labels, respectively. Chromosomes were counterstained with DAPI and
mounted with antifade. Color digital images containing both DAPI and gene
signals were recorded using a triple-band pass filter set (Chroma Technology,
Inc., Brattleboro, VT) in combination with a charge-coupled device camera
(Photometries, Inc., Tucson, AZ) and variable excitation wavelength filters
(15). Images were analyzed using the ISEE software package (Inovision Corp.
Durham. NC). In isolated cases, some of the interfering background fluores
cence on the slide but not on the chromosomes was electronically eliminated
to improve signal visibility. The gene signals were analyzed and localized
using the 850 band-resolution ideogram for chromosome 8 (16).
Tissues. From our prostate tumor bank, we chose 35 confirmed cases of
prostate cancer obtained at radical prostatectomy. Clinical stages ranged from
T|C to T,. Histológica! grades (Gleason score) ranged from 5 to 9. One DNA
from a liver metastasis was also used. In some instances. DNA was isolated
from fresh tissue obtained at surgery and subsequently confirmed to contain
prostate cancer. Cancerous tissue was dissected from paraffin-embedded tissue
in regions that had been confirmed histologically to contain prostatic cancer. In
addition, we analyzed 15 sets of tumor/normal pair DNAs from the Johns
Hopkins University. These samples were cryostat dissected, and the tumor
samples were estimated to contain at least 70% tumor nuclei by visual analysis
4455
Downloaded from cancerres.aacrjournals.org on August 11, 2017. © 1997 American Association for Cancer
Research.
NKX3.I
IS NOT MUTATED
IN PROSTATE
CANCER
of sections stained every 300 /urn during the dissection process. Twelve of
these samples (10 prostate tissues and 2 lymph node métastases)had been
shown to harbor chromosome 8p LOH ( I ). DNA from whole blood from
human female volunteers was a gift from Jennifer Hu (Lombardi Cancer
Center).
DNA Isolation and SSCP Analysis. Genomic DNA was prepared from
50-200 mg of frozen prostate tumor tissue by digestion in 2 ml of DNA
digestion buffer (100 mM NaCl. 10 mM Tris-Cl, pH 8, 25 mM EDTA, 0.5%
SDS. and 0.1 mg/ml proteinase K) at 50°Covernight. The samples were then
extracted once with phenol, and 10 ixg/ml RNase A was added at 37°Cfor I h.
GAAAGC. right primer, CGCGCTGTCTCTGGCTGCTC;
fragment 2, left
primer, CGCTCACGTCCTTCCTCATCCAG,
right primer, TCGGTCTCTGCCAGCGTCTCG:
fragment 3, left primer, AGCCAGAGCCAGAGCCAGAGG, right primer, GCTGCGGAGGCGGGAAGGTC.
Exon 2 56°C:frag
Following further extractions with phenol-chloroform
and chloroform, the
DNA was precipitated with a one-fifth volume of 10 M ammonium acetate and
2 volumes of 100% ethanol. H&E-stained sections from prostate tumor tissues,
formalin-fixed and embedded in paraffin, were used as reference to distinguish
regions of normal and tumor tissue. To prepare DNA. a 50-fiM section was
mega, Madison, WI). Individual clones were sequenced using an ABI 377 dye
terminator DNA sequencing system in the Macromolecular Synthesis/Se
quencing Shared Resource Center of the Lombardi Cancer Center. Multiple
clones were sequenced in each case.
extracted twice with 1 ml of Americlear histology clearing solvent (Stephens
Scientific. Riverdale, NJ) for 30 min at room temperature and then washed
twice with 1 ml of 100% ethanol. Samples were air dried, resuspended in 0.5
ml of DNA digestion buffer, and treated as above.
SSCP analysis was performed by PCR amplification of 50-100 ng of DNA
in 10 /til of 1X PCR buffer [50 mM KC1, 10 mM Tris-Cl (pH 8.3), and 1.5 mM
MgCy containing 5% DMSO. 50 ¿IMeach dNTP, 1 juCi [32P]dCTP, l /IM
Results and Discussion
oligonucleotide primers, and 0.25 units of Taq polymerase (Life Technologies,
Gaithersburg, MD). Cycle conditions were 94°Cfor 30 s, 56-64°C (primerdependent) for 30 s, and 72°Cfor 30 s for 30 cycles followed by 72°C
extension for 7 min. Sample aliquots were mixed with 4 volumes of 95%
formamide sample buffer, heated to 85°Cfor 5 min, immediately snap frozen
on dry ice, and then thawed on ice. Four n\ of each sample were loaded onto
a 0.5 X mutation detection enhancement (MDE) gel (FMC Bio Products,
Rockland, ME) containing 0-10% glycerol. Gels containing no glycerol were
electrophoresed at 20 W with a cooling fan for 4 h; those containing 5 or 10%
glycerol were run at 6 W for 18 h. Gels were then dried and autoradiographed.
Primers used to generate PCR fragments of the two coding NKX3. Ì
exons were
as follows. Exon 1, 64°C:fragment 1, left primer, CGGGAGGCGGAAAGT-
ment 4, left primer, CCCATCCCTCCTTCCCCACTCTCC,
right primer,
TTGGGTCTCCGTGAGCTTGAGGTT;
fragment 5, left primer, GAAGTACCTGTCGGCCCCTGAACG,
right primer, CACCCTGGGGAAGGCAGTTTTTGA.
Sequence Analysis. Aberrantly migrating bands from SSCP analysis were
sliced from the gel. PCR amplified, and cloned into pGEM-T Vector (Pro-
Chromosomal Fine Mapping of NKX3.1. Emi et al. (17) con
structed a genetic linkage map of markers for the short arm of human
chromosome 8. This unbroken map spanned 45 cM in males and 79
cM in females and included 14 DNA markers. These markers in
cluded, among others, three genes (MSR, LPL, and NEFL) that were
previously assigned to 8p. We used these three genes because they
mapped within the 8p21-22 region of chromosome 8 where NKX3.Ì
was mapped, and they are loci frequently deleted or shown to undergo
allelic losses in prostate cancer.
Cumulatively, more than 30 metaphases were analyzed by eye,
most of which had doublet signals characteristic of genuine hybrid
ization for the given gene on at least one chromosome 8. Doublet
signal was not detected on any other chromosome for NKX 3.1, MSR,
or LPL. However, the NEFL probe showed strong secondary signal at
17qter (data not shown), which we disregarded for purposes of this
report. Detailed analyses of more than 50 individual chromosomes,
MSR
NKX3.1
LPL
NKX3.1
Fig. 1. Fine mapping of NKX3.Ì.Double- and
triple-label single-copy gene FISH was done as
described in "Materials and Methods." A. three
different examples of chromosome 8. each of
which has undergone double-probe hybridization.
B, two different examples of chromosome 8. each
of which has undergone triple-probe hybridization.
For both A and B. probe signal, identification, and
color are indicated by the arrows. 2a. inverse
black-and-white presentation of the DAPI staining
pattern is shown for the chromosome depicted in
2b. showing the g-band like paltem. Chromosomes
were counterstained with DAPI (blue). C. Interna
tional System for Human Cytogenetic Nomencla
ture ideogram of chromosome 8 showing the rela
tive map positions of NKX3.1 (green bar) in
relation to MSR. LPL, and NEFL (black bars: Ref.
16). Previously reported genetic distances are de
picted in cM to the right of the map (3, 17).
C.
^ MSR
s+'NKXa.ì
NEFL
MSR
LPL
-NKX3.Ì
21¿x
D 21-2'T
r **2
8
4456
Downloaded from cancerres.aacrjournals.org on August 11, 2017. © 1997 American Association for Cancer
Research.
NKX3.1 IS NOT MUTATED
IN PROSTATE
B
CANCER
Fragment 1
Fragment 2
1234567
Hi
Fragment 3
1234567
1234567
CAAT
TATA
Exon[2
Exon 1
60 aa
homeodomain
T
arg/cys
polymorphism
aa52
lililÃ-
-•M «ft
Exon 1 allelotype:
C
Fragment 4
Fragment 1
1234
5
67
8
9
123
A A
B
A
B
4
5
A A
B
678
9 10 11 12 Hf)
10 11 12
» UN
Fragment 5
Fragment 2
Fragment 3
Fig. 2. A, genomic map of NKX3.1 showing two exons that contain the coding region of the gene (shaded}. The location of five PCR transcripts used for SSCP analysis of the gene
are included above the map and numbered 1-5. The locations of the R52C polymorphism and the homeodomain are shown. B, SSCP analysis of exon 1 using cell lines and normal
tissue DNA to demonstrate polymorphisms. In each panel: Lanes 1-4, prostate cancer cell line DNA from LNCaP, DU-145. PC-3. and TSU-Prl; Lane 5. human breast cancer cell
line MDA-MB-435; Lane 6, human placental DNA; Lane 7, DNA from normal human thymus. Heterozygosity for fragment 2 is demonstrated in Lane I. The other lanes have DNA
that is homozygous A/A or B/B. C, representative SSCP analysis of prostate cancer DNA specimens for fragments 1-3 of exon 1. The polymorphisms for fragment 1 are seen in Lanes
1-3 and 9, but no aberrant bands were observed. For fragment 2. A/B heterozygosity is seen in Lane 7. D, representative SSCP gels of fragments that overlap exon 2. The SSCP gels
contain 12 prostate cancer DNA samples (Lanes 1-12).
using fluorescence banding combined with high-resolution image
analysis, indicated that NKX3.Ì
was situated within 8p21, flanked
distally by LPL and MSR at 8p21.3 and 8p22, respectively. NEFL,
which is among the closest known markers for the minimally deleted
8p21 region, colocalized with NKX3.1 but was sometimes seen
slightly proximal ofNKXS.l at the border of 8pl2 and 8p21.3 (Fig. 1).
However, in a double-blind analysis, NKX3.1 and NEFL could not be
resolved along the longitudinal axis of the metaphase chromosome,
indicating that these genes lay within approximately 2-3 Mb of each
other (14). This helped confirm that the chromosomal location of the
NKX3.Ì
gene was 8p21, probably closer to 8p21.2 than 8p21.3, and it
indicated that the gene was contained within the minimally deleted
region reported for some prostate cancers (7). The gene order for
NKX3.1 and the three loci linked to LOH on 8p was established as
4457
Downloaded from cancerres.aacrjournals.org on August 11, 2017. © 1997 American Association for Cancer
Research.
NKX3.1 IS NOT MUTATED
cen-NEFL/NKX.ÃŒJ-LPL-MSR-pter. The juxtaposition of NEFL to
NKX3.1 along with the prostate-specific expression and androgen
regulation of NKX3.1 strengthened the possibility that this was a
tumor suppressor gene important for prostate cancer (11). Therefore,
we did analyses aimed at detecting alterations of NKX3.1 in prostatic
cancers.
SSCP Analysis. The open reading frame of NKX3.1 is contained
entirely in two exons, the second of which includes the homeodomain,
the region of the homeobox gene that codes for the DNA-binding
domain. On the basis of the transcription start site predicted from the
genomic sequence, the portion of the gene coding for the protein
would account for somewhat more than 1 kb of processed mRNA.
Because Northern analyses indicated that the mature NKX3.1 mRNA
was approximately 4 kb, there must be a long 3' untranslated region
(<3.5 kb), which is likely encoded within the second exon compara
ble to the structure of the mouse gene (9, 10). The organization of the
human NKX3.1 gene and the location of PCR products that were used
in SSCP are shown in Fig. 2A.
SSCP analysis of exon 1 revealed the presence of two polymor
phisms. These are demonstrated in an analysis of DNA from five cell
lines, placenta, and normal thymus, as shown in in Fig. IB. Fragment
1 shows two distinct patterns indicative of a polymorphism. The
DNAs in Lanes I and 2 have a migration pattern showing presence of
both polymorphic alÃ-eles;those in Lanes 3-5 and 7 are homozygous
for one alÃ-ele;and that in Lane 6 is homozygous for the other alÃ-ele.
Nucleotide sequence analysis showed that the polymorphism of frag
ment 1 was due to a single nucleotide change 15 bases upstream from
the ATG in exon 1. The sequence of this region is: GGGCCGGGCGGGTGCATTCAGGCCAA(G/A)GGCGGGGCCGCCGGGATGCTCAGGA.
PCR fragment 2 also showed two different SSCP migration pat
terns. We have named these two patterns A and B because they
represent one of two polymorphic amino acids at codon 52 of the
NKX3.1 protein. The A alÃ-eleencodes an arginine and the B a
cysteine at codon 52 (Fig. Z4). DNA in Lane 1 has both alÃ-eles(A/B);
DNAs in Lanes 2, 4, 6, and 7 are homozygous for A; and DNAs in
Lanes 3 and 5 are homozygous for B. We know that the fragment 2
SSCP migrations represent two alÃ-elesbecause we isolated each of
these bands from the SSCP gel for nucleotide sequencing and showed
that the A alÃ-elecorrelated with a T at nucleotide 154 encoding an
arginine at codon 52 and the B alÃ-elecontained a cytosine at nucle
otide 154, encoding a cysteine. PCR fragment 3 gave a uniform
migration of the seven samples, suggesting that there were no se
quence differences between the samples.
An example of SSCP analysis of exon 1 of prostate cancer tissue is
shown in Fig. 2C. Thirty-six different prostate cancer tissue DNAs
were analyzed initially. We observed the R52C polymorphism in the
coding region of exon 1 in seven samples, but saw no other aberrant
bands. The sequence of the R52C polymorphism was confirmed in
four of seven cases of prostate cancer in which it was observed by
SSCP. SSCP analysis of all seven cases showed identical gel migra
tion and a ratio of band intensities consistent with the presence of a
polymorphism.
We analyzed exon 2, which contains the homeodomain region,
using PCR fragments 4 and 5 shown in Fig. 2A. No aberrations in
SSCP migration were seen in 36 samples tested. Fig. ID shows
examples of SSCP migration of two PCR fragments that span exon 2.
To be certain that we had not missed NKX3.Õmutations due to
tissue heterogeneity or sample selection, we analyzed 15 paired DNA
samples from matched tumor/normal tissues from individuals with
prostate cancer, 12 of which contained known 8p21 LOH. One of the
12 had no amplifiable signal in the tumor DNA, suggesting the
possibility of a total deletion of the gene. The other 14 samples had no
IN PROSTATE
CANCER
aberrations of the NKX3.ÃŒcoding region in SSCP analysis. One of
these 14 samples contained A/B heterozygosity of exon 1 and did not
display LOH of either alÃ-ele.Therefore, in a total of 51 prostate cancer
DNAs, one specimen had a biallelic deletion of NKX3.I and 50
samples had no mutations.
Because we found a polymorphism in the deduced NKX3.1 protein
sequence, we asked whether the occurrence of the B polymorphism
was different in the prostate cancer tissue compared to DNAs from
normal tissue. Four of 26 normal tissues from prostate cancer patients
and 8 of 50 cancer specimens contained the B polymorphism and
displayed A/B heterozygosity by SSCP. Therefore, it did not appear
that the B alÃ-elewas preferentially retained or lost in cancer speci
mens. We also analyzed DNA from normal female peripheral blood
and found the A/B heterozygosity in 8 of 37 DNA samples. Definitive
analysis of the sex- and population-based frequencies of the R52C
exon 1 polymorphism in NKX3.1 is currently under way.
NKX3. /isa homeobox gene as determined by the presence of a
60-amino acid homeodomain. The homeobox family of genes are
recognized as playing a central role in the development of organs and
body patterns in a wide variety of organisms. These genes encode
proteins containing a conserved 60-amino acid region, the homeodo
main, which in several cases has been shown to bind specifically to
DNA and to be involved in transcription regulation. Although the role
of NKX3.1 in prostate cancer remains unknown, its tissue-specific
expression and androgen regulation make it an important subject for
further studies.
Because NKX3.1 is expressed in hormone-responsive but not hor
mone-unresponsive prostate cancer cell lines, it will be interesting to
see whether this pattern of expression is recapitulated in prostate
cancer tissues. Only one of the samples we analyzed, a DNA extracted
from a liver metastasis, came from hormone-refractory cancer tissue
that had progressed after androgen ablation. NKX3.1 was not mutated
in this sample. The other 50 tissues came from 48 primary prostate
cancers and 2 lymph node métastasesobtained at the time of initial
prostate surgery and had not been exposed to androgen ablation. The
one case that showed homozygous deletion of NKX3.1 had not been
subjected to hormone therapy at the time the tissue was obtained.
Therefore, it would be important to examine the state of the NKX3.1
locus in androgen-independent prostate cancer tissues.
Acknowledgments
Gilben Jay and Cory Abate-Shen shared unpublished data. We are grateful
to Connie Sommers for constructive criticism of the manuscript.
References
1. Bova, G. S.. Carter. B. S.. Bussemakers, J. G.. Emi, M.. Fujiwara, Y., Kyprianon. N..
Jacobs, S. C. Robinson, J. C. Epstein, J. I., Walsh. P. C. and Issacs, W. B.
Homozygous deletion and frequent allelic loss of chromosome 8p22 loci in human
prostate cancer. Cancer Res.. 53: 3869-3873, 1993.
2. Matsuyama. H.. Pan. Y.. Skoog. L.. and Tribukait. B. Deletion mapping of chromo
some 8p in prostate cancer by fluorescence in situ hybridization. Oncogene. 9:
3071-3076, 1994.
3. Fujiwara. Y., Ohala, H., Emi, M., Okui, K., Koyama, K., Tsuchirya, E., Nakajima, T.,
Monden. M., Mori. T., Kurimasa. A.. Oshimura, M., and Nakamura, Y. A 3-Mb
physical map of the chromosome region 8p21.3-p22. including a 600-kb region
commonly deleted in human hepatocellular carcinoma, coloréela!cancer, and nonsmall cell lung cancer. Genes Chromosomes Cancer, 10: 7-14, 1994.
4. Crundwell, M. C.. Chughtai. S.. Knowles, M., Takle. L.. Luscombe, M.. Neoptolemos, J. P., Morton, D. G.. and Phillips. S. M. Allelic loss on chromosomes 8p. 22q
and 18q (DCC) in human prostate cancer. Int J. Cancer. 69: 295-300, 1996.
5. Kagan, J.. Stein. J.. Babaian. R. J., Joe, Y. S.. Pisters, L. L., Glassman. A. B., von
Eschenbach. A. C., and Troncoso. P. Homozygous deletions at 8p22 and 8p2I in
prostate cancer implicate these regions as the sites for candidate tumor suppressor
genes. Oncogene. //.- 2121-2126. 1995.
6. Suzuki, H., Emi, M., Komiya. A.. Fujiwara, Y., Yatani. R., Nakamura, Y., and
Shimazaki. J. Localization of a tumor suppressor gene associated with progression of
human prostate cancer within a 1.2 Mb region of 8p22-p21.3. Genes Chromosomes
Cancer. 13: 168-174, 1995.
7. Vocke, C. D.. Pozzatti, R. O.. Bostwick. D. G.. Florence. C. D.. Jennings. S. B.. Strap.
4458
Downloaded from cancerres.aacrjournals.org on August 11, 2017. © 1997 American Association for Cancer
Research.
NKX3.1 IS NOT MUTATED
S. E.. Duray, P. H., Liotta, L. A., Emmert-Buck, M. R., and Linehan, W. M. Analysis
of 99 microdissected prostate carcinomas reveals a high frequency of allelic loss on
chromosome 8p21-22. Cancer Res., 56: 2411-2416, 1996.
8. MacGrogen, D., Levy, A., Bostwick. D., Wagner, M., Wells, D.. and Bookstein, R.
Loss of chromosome arm 8p loci in prostate cancer: mapping by quantitative allelic
imbalance. Genes Chromosomes Cancer, 10: 151-159, 1994.
9. Bieberich, C. J., Fujita, K., He. W. W.. and Jay, G. Prostate-specific and androgendependent expression of a novel homeobox gene. J. Biol. Chem., 277: 31779-31782,
1996.
10. Sciavolino, P. J., Abrams, E. W., Yang, L.. Austenberg, L. P., Shen, M. M.. and
Abate-Shen, C. Tissue-specific expression of murine Nkx3.1 in the male urogenital
sinus. Dev. Dyn., 209.- 127-138, 1997.
11. He. W. W., Sciavolino. P. J., Wing, J.. Augustus, M., Hudson, P.. Meissner, S. P..
Curtis, R. T., Shell. B. K.. Bostwick, D. G., Tindall. D. J., Gelmann, E. P., AbateShen, C., and Carter, K. C. A novel human prostate-specific androgen-regulated
homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate
cancer. Genomics, 43: 69-77, 1997.
IN PROSTATE
CANCER
12. Altschul, S. F., Gisg, W., Miller, W., Myers, E. W., and Lipman. D. J. Basic local
alignment search tool. J. Mol. Biol., 215: 403-410, 1990.
13. Lawrence. J. B., Villnavae, C. A., and Singer. R. A. Sensitive high-resolution
chromatin and chromosome mapping in situ: presence and orientation of two closely
integrated copies of EBV in a lymphoma line. Cell, 52: 51-61, 1988.
14. Johnson. C. V., Singer, R. H., and Lawrence, J. B. Fluorescent detection of nuclear
RNA and DNA: implications for genome organization. Methods Cell Biol., 35:
73-99, 1991.
15. Johnson. C. V., McNeil, J. A., Carter, K. C., and Lawrence, J. B. A simple, rapid
technique for precise mapping of multiple sequences in two colors using a single
optical fiber set. Genet. Anal. Tech. Appi.. 8: 75-76. 1991.
16. ISCN (1985): an international system for human cytogenetic nomenclature. In: D. G.
Harnden and H. P. Klinger (eds.). Birth Defects: Original Article Series. Vol. 21.
March of Dimes Birth Defects Foundation, 1985.
17. Emi, M., Fujiwara, Y.. and Nakamura, Y. A primary genetic linkage map of 14 poly
morphic loci for the short arm of human chromosome 8. Genomics, /5: 530-534, 1993.
4459
Downloaded from cancerres.aacrjournals.org on August 11, 2017. © 1997 American Association for Cancer
Research.
Coding Region of NKX3.1, a Prostate-Specific Homeobox Gene
on 8p21, Is Not Mutated in Human Prostate Cancers
H. James Voeller, Meena Augustus, Victor Madike, et al.
Cancer Res 1997;57:4455-4459.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/57/20/4455
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on August 11, 2017. © 1997 American Association for Cancer
Research.