Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
SUPPLEMENTARY INFORMATION Targeting human embryonic stem cells with quantum dots conjugated phages Wenxiu Zhao1, Lei Jin1, Hang Yuan1, Zhiyang Tan1, 3, Changhua Zhou2, *Lin Song Li2 and *Lan Ma1 Division of Life Science & Health, Graduate School at Shenzhen, Tsinghua University, Shenzhen, China. 1 Key Laboratory for Special Functional Materials, Henan University, Kaifeng 475004, P. R. China. 2 3 School of Life Sciences, Tsinghua University, Beijing, China. *Corresponding author Correspondence and requests for materials should be addressed to: [email protected], [email protected] or [email protected], Phone: 86-755-2603-6878, Fax: 86-755-2603-6878. Supplemental Figure S1. ESCs culture and identification. (A) Human embryonic cell (hESC) culture and AKP stains: (a) human ESCs, (b) differentiated human ESCs, (c) AKP stain for hESCs, and (d) AKP stain for differentiated hESCs. (B) Immunocytochemical staining For ESC markers. (a,b)Nanog; (c,d)Oct4; (e,f)SSEA-4; (g,h)TRA-1-60. (C) Monkey ESCs rs366.4 (a) mouse ESC line R1 (b), and mouse ESC line E14 (c); (d-f): AKP stains of Monkey ESCs rs366.4, mouse ESC line R1 and mouse ESC line E14. Scale bar, 50 μm. (D) RT-PCR analyses for ES cell marker genes. All ESC were cultured on mouse embryo fibroblast (MEF) feeder cells. Supplemental Figure S2. Fluorescence signal channels of immunocytochemistry of phage clone with cells. (A) Green channel shows fluorescence signals of phages; (B) Blue channel shows fluorescence signals of nucleus. Supplemental Table S1. RT-PCR primers for ESCs marker genes detection. Gene Forward primer (5’- 3’) Reverse primer (5’ – 3’) Klf4 (mouse) TGCCTTGCTGATTGTCTATT GCAGTGTCTTCTCCCTTCC Oct4 (mouse) AAAGCGAACTAGCATTGAGA AGCAGTGACGGGAACAGA Nanog (mouse) GATTCTTCTACCAGTCCCAAAC ATGCGTTCACCAGATAGCC Sox2 (mouse) TCTTCCTCCCACTCCAGG TAGTCGGCATCACGGTTT Sox2 (macaca) CCCTGTGGTTACCTCTTCC CTCCCATTTCCCTCGTTT Nanog (macaca) TTATTGTGGCGGTGACTC TTGCCTTTGGGACTGGT Oct-4 (macaca) GACAACAATGAGAACCTTCA CACATCCTTCTCTAGCCCAA Sox2 (human) CGCCCCCAGCAGACTTCACA CTCCTCTTTTGCACCCCTCCCATTT Nanog (human) TGAACCTCAGCTACAAACAGGTA AACTGCATGCAGGACTGCAGAG Oct-4 (human) AGAAGGATGGTCCGAGTGTG CCACCCTTTGTGTTCCCAATTCC Supplemental Table S2. Homological sequences of H166 peptide. Genbank Name accession BAC86301.1 Unnamed protein product [Homo sapiens] AAN78464.1 T cell receptor beta chain CDR3 region [Homo sapiens] CAB56534.1/22791 Fibrillin [Homo 6 sapiens] EAW94640.1 Sterile alpha motif domain containing 14, isoform CRA_a Homolgy sequences AAO85044.1 G protein-coupled receptor PGR6 AAH05830.2 Annexin A9 [Homo sapiens] BAC85535.1 Unnamed protein product [Homo sapiens] CAC33425.1 Unnamed protein product [Homo sapiens] EAW88662.1 CD163 antigen, isoform CRA_a [Homo sapiens] NP_001003682.1 Tran membrane protein 200B [Homo sapiens] NP_004235.4 Scavenger receptor cysteine-rich type 1 protein M130 isoform a precursor [Homo sapiens] XP_003403681.1 Deleted in malignant brain tumors 1 protein isoform BAD18710.1 Scavenger receptor protein family member EAW90667.1 hCG2040041 [Homo sapiens] EAW52262.1 hCG1791667 [Homo sapiens] CAE91957.1 Unnamed protein product [Homo sapiens] EAW89811.1 WDR45-like, isoform CRA_d [Homo sapiens] EAX02399.1 EF-hand calcium binding domain 4A [Homo sapiens] AAR13893.1 MLL5 [Homo sapiens] EAX06196.1 Nephronectin, isoform CRA_c [Homo sapiens] CAA80544.1 M130 antigen extracellular variant [Homo sapiens] EAW98118.1 WD repeat and SOCS box containing 2 [Homo sapiens] A6NCK2.3 Full=Tripartite motif-containing protein 43B CAC33425.1 Unnamed protein product [Homo sapiens] Secreted polypeptides encoded thereby Supplemental Table S3. Homological sequences of H178 peptide. Genbank Name accession EAW89544.1 Lectin, galactosidebinding, soluble, 3 binding protein, isoform CRA_b [Homo sapiens] ACK56072.1 Leukocyte immunoglobulinlike receptor [Homo sapiens] AAF65226.1 E2F transcription factor 4[Homo sapiens] AAH30029.1 Inhibin, beta B [Homo sapiens] AAY57157.1 Immunoglobulin heavy chain variable region AAC97255.1 T-cell receptor beta chain Homolgy sequences NP_005558.1 Galectin-3-binding protein precursor [Homo sapiens] NP_001138930.1 Natural cytotoxicity triggering receptor 1 [Homo sapiens] NP_001229510.1 ras and Rab interactor 2 isoform NP_001240286.1 Tyrosine-protein kinase receptor Tie1 isoform 2 [Homo sapiens] NP_005415.1 Tyrosine kinase with immunoglobulinlike and EGF-like NP_659403.4 FRAS1 related extracellular matrix 1 [Homo sapiens] NP_001035148.1 Macrosialin isoform B precursor [Homo sapiens] CD68 NP_722577.2 Probable G-protein coupled receptor 113 isoform 3 NP_110447.2 Collagen alpha1(XXI) chain precursor [Homo sapiens] NP_001001396.1 Plasma membrane calciumtransporting ATPase 4 isoform 4a [Homo sapiens] NP_005121.1 Ibroblast growth factor-binding protein 1 precursor [Homo sapiens] NP_000564.2 Complement receptor type 1 isoform F precursor [Homo sapiens] NP_001002264.1 Epithelial-stromal interaction protein 1 isoform 1 [Homo sapiens] NP_001035194.1 Mucin-17 precursor [Homo sapiens] NP_612356.1 Zinc finger protein 551 [Homo sapiens] NP_005374.2 Sialidase-2 [Homo sapiens] NP_001018056.1 SPS1/STE20related protein kinase YSK4 isoform 2 [Homo sapiens] NP_005069.2 Transducin-like enhancer protein 3 isoform a [Homo sapiens] NP_001164164.1 Cancer-associated gene 1 protein isoform 2 [Homo sapiens] NP_055858.2 TBC1 domain family member 9B isoform b [Homo sapiens] NP_958849.1 Transcriptional enhancer factor TEF-3 isoform 2 [Homo sapiens] NP_003350.1 UDP-glucose 6dehydrogenase isoform 1 [Homo sapiens] NP_062547.1 Sushi domaincontaining protein 2 precursor [Homo sapiens] NP_001129288.1 LIM domain and actin-binding protein 1 isoform 4 [Homo sapiens] NP_001186851.1 Sialate Oacetylesterase isoform 2 [Homo sapiens] NP_005655.1 Probable E3 ubiquitin-protein ligase makorin-3 [Homo sapiens] NP_056040.2 Protein prune homolog 2 [Homo sapiens] NP_002770.3 PH and SEC7 domain-containing protein 1 [Homo sapiens] NP_001129288.1 Protein PCOTH isoform 2 [Homo sapiens] NP_066288.2 Deformed epidermal autoregulatory factor 1 homolog [Homo sapiens] NP_078920.2 Lysine-specific demethylase NO66 [Homo sapiens] NP_001171696.1 BEN domaincontaining protein 2 isoform 2 [Homo sapiens] NP_115806.1 Serine/threonineprotein kinase BRSK1 [Homo sapiens] XP_001715329.2 Hypothetical protein LOC338667 [Homo sapiens] NP_001001396.1 plasma membrane calciumtransporting ATPase 4 isoform 4a [Homo sapiens] NP_663780.2 synemin isoform A [Homo sapiens] NP_001241872.1 girdin isoform 3 [Homo sapiens] NP_000419.1 Latent-transforming growth factor betabinding protein 2 precursor [Homo sapiens] NP_001089.1 aconitate hydratase, mitochondrial precursor [Homo sapiens] NP_006369.3 Semaphorin-4D isoform 1 precursor [Homo sapiens] NP_996803.2 Apical endosomal glycoprotein precursor [Homo sapiens] NP_060142.3 Transient receptor potential cation channel subfamily M member [Homo sapiens] NP_057058.2 Lambda-crystallin homolog [Homo sapiens]