Download The role of anti-HSP70 autoantibody-forming VH1±JH1 B

International Immunology, Vol. 15, No. 1, pp. 39±47
ã 2003 The Japanese Society for Immunology
The role of anti-HSP70 autoantibody-forming
VH1±JH1 B-1 cells in Toxoplasma gondiiinfected mice
Mei Chen1, Fumie Aosai1, Kazumi Norose1, Hye-Seong Mun1 and Akihiko Yano1
1Department of Infection and Host Defense, Graduate School of Medicine, Chiba University,
1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan
Keywords: anti-HSP70 autoantibody, avidity maturation, B-1 cell, Toxoplasma gondii, VH1±JH1
Abstract
Anti-heat shock protein 70 (HSP70) autoantibody formation was induced by B-1 cells (CD5+ B cells)
in Toxoplasma gondii-infected mice. Here we report that VH1±JH1 B-1 cells from peritoneal exudate
cells (PEC) of T. gondii-infected C57BL/6 mice (B6, a susceptible strain) increased predominantly.
Moreover, the hybridoma lines producing anti-T. gondii HSP70 (TgHSP70) antibody cross-reactive
with mouse HSP70 (mHSP70) expressed the VH1±JH1 gene, whereas the hybridoma lines producing
anti-TgHSP70 antibody non-cross-reactive with mHSP70 expressed the VH11A±JH1 gene or VH12±
JH1 gene. The avidity maturation of anti-TgHSP70 IgG antibody in the sera of BALB/c mice (a
resistant strain) and that of anti-mHSP70 IgG autoantibody in the sera of B6 mice were observed 9
weeks after T. gondii infection. T. gondii numbers in the brains of T. gondii-infected B6 mice
treated with anti-mHSP70 autoantibody were markedly higher than those in the brains of T. gondiiinfected B6 mice treated with anti-TgHSP70 antibody. Furthermore, B-1 cells producing IL-10 downregulated the IFN-g expression of PEC in T. gondii-infected mice. These results indicate that B-1
cells dominantly expressing VH1±JH1 mRNA, and producing anti-HSP70 autoantibody and IL-10
regulate susceptibility of mice to T. gondii infection.
Introduction
Toxoplasma gondii, an obligate intracellular protozoan parasite, is an important cause of morbidity and mortality, especially in congenital toxoplasmosis and immunocompromised
hosts. Cellular immunity is essential for protection against
T. gondii infection (1). We have demonstrated the existence of
CD4±CD8+ and CD4+CD8± cytotoxic T lymphocytes (CTL)
speci®c for T. gondii-infected cells in patients with toxoplasmosis (2±6).
The proteins of heat shock protein 70 (HSP70) families have
been shown to have important functions as molecular chaperones in peptide and protein transport between cell organelles
(7,8). The role of HSP in antigen presentation and processing
has been demonstrated (8±10). We have also reported that the
induction of anti-T. gondii HSP70 (TgHSP70) antibody and antimouse HSP70 (mHSP70) autoantibody produced in T. gondiiinfected BALB/c (a resistant strain) and C57BL/6 (B6, a
susceptible strain) mice (11,12), and B-1 cells were responsible for anti-mHSP70 autoantibody formation in T. gondiiinfected mice (11). In fact, the mechanisms of the autoimmunity
induced by parasites are not yet well de®ned (13).
B-1 cells are a self-renewing population of B cells that differ
from conventional B cells (B-2 cells) in that they are particularly
predisposed to autoantibody production (14±16). Although
much is known about the signaling pathways that control B-1
cell growth and development (17), less is known about why
these cells are prone to produce autoreactive antibodies. In
the transgenic mice carrying the Ig heavy and light chain gene
encoding an autoantibody against mouse red blood cells,
about one-half of the mice developed autoimmune hemolytic
anemia through the activation of peritoneal B-1 cells by enteric
bacteria, whereas transgenic mice bred in germ-free or
speci®c pathogen-free conditions neither produced autoantibodies nor suffered from anemia, indicating that tolerance was
maintained in the latter environmental condition, and B-1 cell
activation and autoantibody production did not occur (18).
Moreover, humoral immune response is achieved by the
three processes of avidity maturation, class switching and
memory formation. All three occur at about the same time after
B lymphocyte activation. The basis of avidity maturation is the
selection, in the germinal centers (GC), of antibodies that bind
Correspondence to: A. Yano; E-mail: [email protected].
Transmitting editor: S. Koyasu
Received 15 January 2002, accepted 27 September 2002
40
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
the antigen better. Early in an immune response, the selection
is from the primary repertoire; later, it is from mutants
generated by hypermutation at the Ig loci (19). Somatic
hypermutation in GC may produce not only high-avidity
antibodies, but also generate autoreactive B cell clones (20).
In this study, VH gene family expression in B-1 cells from
peritoneal exudate cells (PEC) of T. gondii-infected mice and
the hybridoma lines producing anti-TgHSP70 antibody crossreactive with mHSP70 were detected. Moreover, the avidity
maturation of anti-TgHSP70 IgG antibody and anti-mHSP70
IgG autoantibody in the sera of T. gondii-infected BALB/c and
B6 mice was observed. Finally, the biological signi®cance of
anti-mHSP70 autoantibody produced by B-1 cells in the host
defense to T. gondii infection was analyzed. Collectively, the
present study elucidated the role of B-1 cells in the regulation
of susceptibility of mice to T. gondii infection.
Methods
Mice and T. gondii strain
Eight-week-old female wild-type BALB/c and wild-type B6
mice were purchased from SLC (Hamamatsu, Japan). Cysts of
an avirulent Fukaya strain of T. gondii were used for infection
experiments as previously described (11,12,21).
Puri®cation of B-1 cells in PEC of T. gondii-infected mice
BALB/c and B6 mice were sacri®ced 1 week after T. gondii
infection. To eliminate T cells, single-cell suspensions of PEC
of BALB/c and B6 mice were incubated with microbeads
conjugated with anti-mouse CD90 (Thy-1.2) (30-H12; Miltenyi
Biotec, Auburn, CA) and passed through a magnetic ®eld
(VarioMACS separator system; Miltenyi Biotec). Subsequently, B-1 cells were positively enriched from T celldepleted PEC using microbeads conjugated with anti-mouse
CD5 (Ly-1) (53-7.3; Miltenyi Biotec). The purity of CD5+/B220+
for B-1 cells was determined by ¯ow cytometry analysis
(FACScan; Becton Dickinson, Mountain View, CA) with Rphycoerythrin (PE)-conjugated rat anti-mouse CD5 (Ly-1) (537.3; PharMingen, San Diego, CA)/FITC-conjugated rat antimouse CD45R (B220) (RA3-6B2; PharMingen).
Analysis of anti-mHSP70 autoantibody formation by B-1
cells
BALB/c and B6 mice were sacri®ced 3 days after T. gondii
infection. The B-1 cells from PEC of T. gondii-infected BALB/c
and B6 mice puri®ed as described above were resuspended
in RPMI 1640 culture medium supplemented with 5% FCS,
2-mercaptoethanol and antibiotics, and were cultured for 3
days at 37°C in a 96-well microplate at 105 cells/well as
previously described (11). Production of anti-TgHSP70 antibody and anti-mHSP70 autoantibody in the supernatants was
tested by ELISA using recombinant TgHSP70 (rTgHSP70) and
rmHSP70 as antigens.
Detection of the antigen speci®city of anti-mHSP70 autoantibody produced by PEC B-1 cells from T. gondii-infected and
uninfected B6 mice was performed by the adsorption of
culture supernatant with rTgHSP70, rmHSP70 and BSA. B6
mice were sacri®ced 0 and 3 days after T. gondii infection. The
B-1 cells from PEC of uninfected and T. gondii-infected B6
mice were puri®ed and incubated as described above. Three
days after incubation, the culture supernatants were incubated for 1 h on ice in a plastic plate coated with 60 mg of either
rTgHSP70 or rmHSP70 and then the preadsorbed supernatants were harvested. As control, the supernatants were
similarly adsorbed in a plastic plate coated with 10 mg/ml of
BSA. The preadsorbed supernatants were used for ELISA
targeting rmHSP70 as previously described (11). The titrations
of culture supernatants unadsorbed or preadsorbed with
rTgHSP70, rmHSP70 or BSA against rmHSP70 were analyzed
at dilutions of 1/2, 1/4, 1/8, 1/16 and 1/32 by ELISA.
Production of anti-TgHSP70 mAb cross-reactive with
mHSP70
The spleen B-1 cells of T. gondii-infected B6 mice were
puri®ed as mentioned above. Then, the spleen B-1 cells of
T. gondii-infected B6 mice were fused with hypoxanthine±
aminopterin±thymidine-sensitive P3U1 cells at a 1:5 ratio using
45% polyethylene glycol (mol. wt 4000; Sigma, St Louis, MO).
For cloning of hybridoma cell lines producing anti-HSP70
autoantibody (TgCRB 21 and TgCRB 28), the culture supernatants of the hybridomas were tested by ELISA using
rTgHSP70 or rmHSP70 as target antigen. Hybridoma lines
producing anti-TgHSP70 antibody (TgNCR A5 and TgNCR
C2) and anti-HSP70 autoantibody (TgCR 16 and TgCR 20)
were established as previously described (11).
Analysis of VH gene and IL-10 expression in B-1 cells
The expression of VH families in B-1 cells from PEC of
uninfected and T. gondii-infected BALB/c and B6 mice and in
various hybridoma lines producing anti-TgHSP70 antibody
cross-reactive (CR) with mHSP70 (TgCR 16, TgCR 20, TgCRB
21 and TgCRB 28) and anti-TgHSP70 antibody non-crossreactive (NCR) with mHSP70 (TgNCR A5 and TgNCR C2) (11)
was analyzed. Total cellular RNA was extracted with TRIzol
(Gibco/BRL, Grand Island, NY) from PEC B-1 cells of
uninfected and T. gondii-infected mice and various hybridoma
lines according to the manufacturer's instructions. Then 1 mg
of total RNA was reverse transcribed in a ®nal volume of 20 ml
using an RNA PCR kit (R019A; Takara, Shiga, Japan)
according to the manufacturer's instructions.
The PCR reaction conditions were optimized for VH1±JH1
(J558 family), VH2±JH1 (Q52 family), VH11A±JH1 (CP3 family),
VH11B±JH1 (CP3 family) and VH12±JH1 (CH27 family) primers
as shown in Table 1. GAPDH DNA was also ampli®ed as a
standard to ensure that the cDNA concentrations in different
reaction mixtures were approximately equal. The PCR products were electrophoresed in 1.2% agarose gel with ethidium
bromide. The quanti®cation of RNA was performed with an
IPLab Gel densitometer (Signal Analytical, Vienna, VA). The
results were expressed as the ratio of the OD value of the PCR
products of VH1±JH1 to the OD value of the products of
GAPDH according to the following formula: (OD of VH1±JH1/
OD of GAPDH) 3 100. The mRNA expression of IL-10 in B-1
cells from PEC of uninfected and T. gondii-infected BALB/c
and B6 mice was detected as described above.
Avidity assay
The avidity of IgG speci®c for rTgHSP70 and rmHSP70
was measured by protein-denaturing immunoassay (avidity
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
41
Table 1. RT-PCR conditions (sequences of the oligonucleotide primers used for PCR ampli®cation of VH gene families and
IL-10 mRNA, number of PCR cycles and product size predicted)
Gene
Sense primer (5¢®3¢)
Antisense primer (5¢®3¢)
T (°C)a
Cycles
Product size
(bp)
VH1±JH1
VH2±JH1
VH11A±JH1
VH11B±JH1
VH12±JH1
IL-10
GAPDH
TGTCCTGCAAGGCTTCTG
CTGGTGGCGCCCTCAC
CTTGGTGCAACCTGGGG
GGACTCTCTTGTGAAGGC
ACCTGGCCTGGTGAAAC
CGGGAAGACAATAACTG
ACCACAGTCCATGCCATCAC
GCCCCAGACATCGAAGTA
GCCCCAGACATCGAAGTA
GCCCCAGACATCGAAGTA
GCCCCAGACATCGAAGTA
GCCCCAGACATCGAAGTA
CATTTCCGATAAGGCTTGG
TCCACCACCCTGTTGCTGTA
56
56
56
56
56
50
55
35
35
35
35
35
37
35
263
306
298
273
307
187
452
aAnnealing
temperature used for primer set in PCR.
ELISA). Brie¯y, 1/100, 1/200, 1/400, 1/800, 1/1600 and 1/3200
diluted sera of BALB/c and B6 mice 2 and 9 weeks after
T. gondii infection were placed in microtiter wells coated with
rTgHSP70 or rmHSP70. After withdrawal of the sera, the
antibodies attached to the antigen were eluted with a protein
denaturant (6 M urea) and the proportion of residual/total
antigen-bound IgG was quanti®ed immunoenzymatically
(22,23). Absorbance was read at 405 nm. The avidity index
was calculated by the following formula: percentage of urearesistant IgG of total bound IgG (A405urea+/A405urea±).
with the permeabilization buffer and the IFN-g expression was
analyzed by a FACScan (Becton Dickinson).
Quantitative competitive-PCR (QC-PCR)
NCR anti-TgHSP70 mAb (TgNCR C2; IgG2a) and CR antiTgHSP70 mAb (TgCR 20; IgG3) were obtained as previously
described (11). Age/sex-matched BALB/c and B6 mice were
i.p. treated by injection of TgNCR C2 mAb or TgCR 20 mAb.
Control groups were injected with PBS. Seven days after the
treatment, the mice were p.o. infected with ®ve T. gondii cysts
of the Fukaya strain as previously described (21). The infected
mice were sacri®ced 6 weeks post-infection and the numbers
of T. gondii in the brains of T. gondii-infected mice were
measured by QC-PCR. Total genomic DNAs were puri®ed as
described previously (21,24) from ~1 mm3 of tissues. The
resulting DNAs were tested for the presence of surfacespeci®c antigen gene 1 (SAG1) by thermal ampli®cation with
speci®c primer pairs (21,25). Brie¯y, genomic DNA (1 mg)
extracted from these organs was co-ampli®ed with a constant
concentration of truncated SAG1 DNA, which competitively
binds the primers with wild-type SAG1. The ampli®ed cDNAs
were eletrophoretically separated on 1.2% agarose gel containing ethidium bromide and the ratio against competitor
(T/C) SAG1 DNA subsequently ampli®ed was measured by an
ILPab Gel densitometer (Signal Analytical). The numbers of
T. gondii were calculated as described previously (21,24).
The production of anti-TgHSP70 antibody and anti-mHSP70
autoantibody by B-1 cells in PEC of T. gondii-infected BALB/c
and B6 mice was analyzed in vitro. The purity of B-1 cells
(Fig. 1A) was 91.5%. High levels of anti-TgHSP70 antibody
were produced by B-1 cells puri®ed from PEC of T. gondiiinfected BALB/c and B6 mice. In contrast, high levels of antimHSP70 autoantibody were observed in B-1 cells puri®ed
from PEC of T. gondii-infected B6 mice, while only low levels
were observed in PEC B-1 cells of T. gondii-infected BALB/c
mice (Fig. 1B).
To demonstrate the antigen speci®city of anti-mHSP70
autoantibody produced by B-1 cells of T. gondii-infected mice,
the production of this anti-mHSP70 autoantibody in PEC of
uninfected and T. gondii-infected B6 mice was analyzed by
adsorption of culture supernatant with rTgHSP70, rmHSP70
and BSA. The culture supernatant of B-1 cells from T. gondiiinfected B6 mice adsorbed with rTgHSP70 and rmHSP70 did
not react with rmHSP70. On the other hand, that preadsorbed
with BSA reacted with rmHSP70, indicating that speci®c antimHSP70 autoantibody was produced by PEC B-1 cells of
T. gondii-infected mice (Fig.1C). Anti-mHSP70 autoantibody
was not detected in PEC B-1 cells from uninfected mice
(Fig. 1D).
Detection of intracellular IFN-g
VH1±JH1 peritoneal exudate B-1 cells increased after
T. gondii infection in B6 mice
Three days after transferring T. gondii-infected peritoneal B-1
cells (1 3106) to B6 mice, the mice were i.p. infected with 50
T. gondii cysts of the Fukaya strain. PEC were harvested 5
days after the infection. Then, the cells were ®xed and
permeabilized with a Cyto®x/Cytoperm kit (PharMingen) and
stained with 0.1 mg of FITC-conjugated rat anti-mouse IFN-g
mAb (XMG1.2; PharMingen). Finally, the cells were washed
As shown in Fig. 2(A), the mRNA expression of VH1±JH1 in B-1
cells from PEC of B6 mice signi®cantly increased 1 week after
T. gondii infection, whereas that from PEC of BALB/c mice
showed only a slight increase. Moreover, the hybridoma lines
producing anti-TgHSP70 antibody cross-reactive with
mHSP70 (TgCR 16 and TgCR 20) expressed the VH1±JH1
gene. Furthermore, the B-1 cell hybridoma lines producing
Statistics
Differences between mean values were analyzed by unpaired
Student's t-test. P values <0.05 were considered signi®cant.
Results
Anti-mHSP70 autoantibodies were produced in PEC B-1
cells from T. gondii-infected susceptible B6 mice
42
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
Fig. 1. Speci®c anti-mHSP70 autoantibody produced in B-1 cells. (A) Isolated peritoneal B-1 cells were tested for purity by ¯ow cytometry as
described in Methods. (B) Anti-TgHSP70 antibody and anti-mHSP70 autoantibody formation in B-1 cells from PEC of T. gondii-infected mice.
B-1 cells were puri®ed from PEC of T. gondii-infected BALB/c and B6 mice as described in Methods. After 3 days of incubation at 37°C, antiTgHSP70 antibody and anti-mHSP70 autoantibody formation in the culture supernatants of B-1 cells from PEC of T. gondii-infected BALB/c
and B6 mice was examined by ELISA. Data represent means 6 SD of three to ®ve mice in three separate experiments. *P > 0.05; **P < 0.01
compared with the culture supernatant from T. gondii-infected BALB/c mice. (C and D) Anti-mHSP70 autoantibody produced in PEC B-1 cells
of T. gondii-infected B6 mice recognized cross-reactive antigenic determinants shared by rTgHSP70 and rmHSP70. B-1 cells were puri®ed
from PEC of uninfected (D) and T. gondii-infected (C) B6 mice. After 3 days of incubation at 37°C, the culture supernatants were diluted as
described in Methods. The diluted culture supernatants of PEC B-1 cells from uninfected and T. gondii-infected B6 mice were adsorbed with
either rTgHSP70, rmHSP70 or BSA on ice as described in Methods, and the reactivities of unadsorbed and preadsorbed culture supernatants
with rmHSP70 were then tested by ELISA. Data represent means 6 SD of three to ®ve mice in three separate experiments. **P < 0.01.
anti-TgHSP70 antibody cross-reactive with mHSP70 (TgCRB
21 and TgCRB 28) expressed the VH1±JH1 gene. One
hybridoma line producing anti-TgHSP70 antibody non-crossreactive with mHSP70 (TgNCR A5) expressed the VH11A±JH1
gene and another hybridoma line producing anti-TgHSP70
antibody non-cross-reactive with mHSP70 (TgNCR C2)
expressed the VH12±JH1 gene (Fig. 2B). These data indicated
that B-1 cells forming anti-mHSP70 autoantibody dominantly
utilized the VH1±JH1 gene.
Avidity maturation of anti-TgHSP70 IgG antibody and
anti-mHSP70 IgG autoantibody in T. gondii-infected mice
Our previous studies demonstrated that anti-TgHSP70 antibody and anti-mHSP70 autoantibody were produced in both
BALB/c and B6 mice after T. gondii infection. The avidity
maturation of anti-TgHSP70 IgG antibody and anti-mHSP70
IgG autoantibody in the sera of BALB/c and B6 mice 2 and 9
weeks after T. gondii infection was examined. The avidity
index of anti-TgHSP70 IgG antibody in sera of BALB/c mice 9
weeks after T. gondii infection was higher than that at 2 weeks
post-infection (Fig. 3A), while that of anti-mHSP70 IgG
autoantibody at 9 weeks was only slightly increased when
compared with that at 2 weeks post-infection (Fig. 3B). In
contrast, the avidity index of anti-TgHSP70 IgG antibody in
sera of B6 mice 9 weeks after T. gondii infection was only
slightly increased when compared with that at 2 weeks postinfection (Fig. 3C), whereas that of anti-mHSP70 IgG autoantibody reached a high level 9 weeks post-infection (Fig. 3D).
The results imply that the avidity maturation of anti-HSP70 IgG
autoantibody is correlated with the susceptibility of mice to
T. gondii infection.
B-1 cells producing anti-mHSP70 autoantibody and IL-10
down-regulate host defense in T. gondii-infected B6 mice
To demonstrate the biological signi®cance of anti-mHSP70
autoantibody, the numbers of T. gondii in the brains of
T. gondii-infected mice treated with TgNCR C2 mAb or
TgCR 20 mAb were measured by QC-PCR. Those in B6
mice treated with TgCR 20 mAb were markedly higher than in
those treated with TgNCR C2 mAb or PBS 6 weeks after the
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
43
challenge infection. The numbers in B6 mice treated with
TgNCR C2 mAb were similar to those in control mice. The
numbers of T. gondii in the brains of T. gondii-infected BALB/c
mice treated with TgNCR C2 mAb or TgCR 20 mAb were as
low as those in control mice (Fig. 4A). Therefore, anti-HSP70
autoantibody produced by PEC B-1 cells deteriorated the host
defense in T. gondii-infected mice.
To examine the roles of B-1 cells in the IL network, the mRNA
expression of IL-10 in B-1 cells from PEC of T. gondii-infected
BALB/c and B6 mice was analyzed. IL-10 mRNA expression
was not detectable in B-1 cells from PEC of uninfected BALB/c
and B6 mice. mRNA expression of IL-10 was signi®cantly
present in B-1 cells from PEC of B6 mice 7 days after T. gondii
infection, but none was detected in infected BALB/c mice
(Fig. 4B). The expression of IFN-g on PEC of B6 mice was
observed after T. gondii infection (Fig. 4C) and injection of
T. gondii-infected peritoneal B-1 cells then decreased this
expression. These results suggested that B-1 cells producing
anti-mHSP70 autoantibody and IL-10 down-regulated host
defense in T. gondii-infected susceptible B6 mice.
Discussion
Previous investigations of anti-mHSP70 autoantibody produced in T. gondii-infected mice have shown that the levels of
anti-mHSP70 autoantibody in the sera of T. gondii-infected B6
mice (a susceptible strain) were higher than those in the sera
of T. gondii-infected BALB/c mice (a resistant strain) and B-1
cells were responsible for anti-mHSP70 autoantibody formation in T. gondii-infected mice (11). However, whether antimHSP70 autoantibody produced by B-1 cells exerted effects
at susceptibility/resistance of the mice to T. gondii infection
has not been investigated. Many studies have suggested that
autoantibody-producing cells are generated from B-1 cells in
autoimmune-prone mice and in autoantibody-producing
transgenic mice (26±28). Several lines of evidence have also
suggested that both phosphatidylcholine-reactive antibody
and bromelain-treated mouse red blood cell-reactive antibody
were highly produced in the normal B-1 cell population and
predominantly used VH11 or VH12 genes with restricted
complementarity-determining region 3 structure (29±31).
Moreover, previous studies have revealed that the B-1 cell
IgH repertoire such as VH1, VH2 and VH8 was limited, and
marked by characteristic speci®cities for self and particular
bacterial antigens (32±34). B-1 cells from PEC of T. gondiiinfected B6 mice predominantly expressed the VH1±JH1 gene
and produced high levels of anti-HSP70 autoantibody,
whereas PEC B-1 cells of T. gondii-infected BALB/c mice
expressed low levels of VH1±JH1 mRNA and produced low
levels of anti-mHSP70 autoantibody. Moreover, the B-1 cell
hybridoma lines producing anti-TgHSP70 antibody crossreactive with mHSP70 expressed the VH1±JH1 gene. These
results suggested that B-1 cells responsible for anti-mHSP70
autoantibody formation preferentially utilized the VH1±JH1
gene in T. gondii-infected mice and the higher level of VH1±
JH1 gene expression in PEC B-1 cells may be correlated to the
strain-dependent differences in susceptibility to T. gondii
infection.
Lappalainen et al. have been reported that avidity maturation of anti-T. gondii IgG antibody occurs during the course of
Fig. 2. Expression of VH1±JH1. (A) VH1±JH1 expression in B-1 cells.
B-1 cells from PEC of BALB/c and B6 mice were puri®ed, as
described in Methods, before infection and 1 week after T. gondii
infection. The expression of VH1±JH1 in B-1 cells from PEC of
uninfected and T. gondii-infected BALB/c and B6 mice was
analyzed by RT-PCR as described in Methods. Data represent
means 6 SD of three to ®ve mice in three separate experiments. *P
< 0.05; ***P < 0.005 compared with uninfected B-1 cells. (B)
Expression of VH families in hybridoma cell lines. Various hybridoma
cell lines (TgCR 16, TgCR 20, TgNCR A5 and TgNCR C2) were
established as previously described (11). The B-1 cell hybridoma
lines (TgCRB 20 and TgCRB 28) were established as described in
Methods. The expression of VH families including VH1±JH1, VH2±JH1,
VH11A±JH1, VH11B±JH1 and VH12±JH1 in hybridoma cell lines was
analyzed by RT-PCR. PCR ampli®cation of the GAPDH gene was
used as a control to ensure that the amounts of cDNA obtained from
each sample were equivalent. Representative results from three
independent experiments are shown.
T. gondii infection in humans (23). In the present study, avidity
maturation of anti-TgHSP70 IgG antibody in the sera of
T. gondii-infected BALB/c mice (a resistant strain) and antimHSP70 IgG autoantibody in the sera of T. gondii-infected B6
mice (a susceptible strain) was observed. It was con®rmed, by
using an in vitro culture system as described previously (11),
that the high-af®nity anti-HSP70 autoantibody was shown to be
produced by B-1 cells prepared from B6 mice infected with
T. gondii 9 weeks ago (data not shown). The results imply that
the avidity maturation of anti-HSP70 IgG autoantibody in
susceptible B6 mice may be correlated with the susceptibility
to T. gondii infection.
44
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
Fig. 3. Avidity maturation of anti-TgHSP70 IgG antibody and anti-mHSP70 IgG autoantibody in T. gondii-infected mice. Effects of the
concentration of IgG on the avidity index (solid lines: scale on the left) of anti-TgHSP70 IgG antibody (A) and anti-mHSP70 IgG autoantibody
(B) in sera of BALB/c mice 2 (closed triangles) or 9 (closed circles) weeks after T. gondii infection were analyzed. Diluted sera were allowed to
bind to rTgHSP70 or rmHSP70, then washed in PBS/Tween with or without 6 M urea. Bound IgG was quantitated immunoenzymatically. The
avidity index was expressed as described in Methods. Avidity maturation of anti-TgHSP70 IgG antibody (C) and anti-mHSP70 IgG
autoantibody (D) (solid lines: scale on the left) in sera of B6 mice 2 (closed triangles) or 9 (closed circles) weeks after T. gondii infection was
examined. Dashed lines (scale on the right) show the levels of absorbance (A405urea±). Open triangles represent anti-TgHSP70 IgG antibodies
and anti-mHSP70 IgG autoantibodies in BALB/c and B6 mice 2 weeks after T. gondii infection; open circles represent anti-TgHSP70 IgG
antibodies and anti-mHSP70 IgG autoantibodies in BALB/c and B6 mice 9 weeks after T. gondii infection.
The main function of HSP70 molecules is known to be
that of molecular chaperones under physiological and stress
conditions (35,36). They play a role in antigen processing and
presentation (8±10), and are detectable on the cell surface
(37). We have reported that heat shock cognate protein 71
plays a potential role in antigen presentation and processing
of T. gondii-infected melanoma cells to CD4+ CTL (38).
Furthermore, Lakey et al. demonstrated that antibodies to
HSP70 blocked the presentation of an antigenic peptide to a
MHC class II-restricted T cell hybridoma (39). To address the
functional signi®cance of anti-HSP70 IgG autoantibody produced in T. gondii-infected mice, we analyzed T. gondii
numbers in the brains of T. gondii-infected mice. Higher levels
of T. gondii numbers in the brains of T. gondii-infected B6 mice
treated with TgCR 20 mAb were observed, suggesting that
anti-mHSP70 autoantibodies cause deterioration of the host
defense to T. gondii infection by blocking HSP70 peptide±
MHC class II complex formation. On the other hand, antiTgHSP70 antibody did not in¯uence the host defense to
T. gondii infection.
While the present research on T. gondii infection has a focus
on the humoral immune response, the protective immunity to
T. gondii was characterized by the development of a cellmediated immune response dominated by the production of
IFN-g by T cells (a Th1-type response). The production of IFN-g
by T. gondii-speci®c CD4+ T cells has been shown to upregulate class II expression on target cells and promote their
killing (4). Several other studies have indicated that IFN-g
mediated anti-parasitic effects in the murine model primarily
by up-regulating the expression of macrophage and microglial
inducible NO synthase, and the production of NO that was
believed not only to be directly toxoplasmacidal but also to
promote tachyzoite to bradyzoite transformation by inhibition
of mitochondrial respiration (40±43). On the other hand, IL-10
enhances humoral immunity by inhibiting macrophage as well
as Th1 cell activation and promoting the development of Th2
cytokine synthesis (44±46). One of the characteristics of B-1
cells is their capacity to produce large amounts of IL-10 in
response to lipopolysaccharide (47). Additionally, IL-10 is
needed for the development of murine B-1 cells (48). Velupillai
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
45
et al. reported that activation and expansion of IL-10producing B-1 cells were governed via cross-regulatory
cytokines (49). Although IL-10 probably directly antagonizes
macrophage functions, particularly tumor necrosis factor-a,
IL-1, IL-12 and NO production (45,50), Suzuki et al. recently
reported that IL-10 was required for preventing the development of IFN-g-mediated pathology and mortality in T. gondiiinfected mice (1). In the present study, the expression of IFN-g
on PEC of susceptible B6 mice was decreased by injection of
PEC B-1 cells from T. gondii-infected mice. The result
supported the former interpretation regarding the role of
IL-10 in the host defense to T. gondii infection.
Taken together, our results indicate that anti-HSP70 autoantibody and IL-10-forming B-1 cells and avidity maturation of
anti-HSP70 IgG autoantibody regulate the susceptibility of
mice to T. gondii infection.
Acknowledgements
This work was supported in part by a Grant-in-Aid for Scienti®c
Research of Health and Welfare, and a grant from the Ministry of
Education, Science, Sports and Culture, Japan.
Abbreviations
B6
CTL
GC
HSP70
m
NCR
OD
PEC
QC-PCR
r
SAG1
TgCR
TgNCR
TgHSP70
C57BL/6
cytotoxic T lymphocyte
germinal center
heat shock protein 70
mouse
non-cross-reactive
optical density
peritoneal exudate cells
quantitative competitive-PCR
recombinant
surface-speci®c antigen gene 1
T. gondii cross-reactive
T. gondii non-cross-reactive
T. gondii HSP70
References
Fig. 4. (A) Biological signi®cance of anti-mHSP70 autoantibody in
the host defense to T. gondii infection. BALB/c and B6 mice treated
with TgNCR C2 mAb or TgCR 20 mAb p.o. infected with the T. gondii
Fukaya strain. Six weeks after infection, the mice were sacri®ced
and the numbers of T. gondii in the brain were measured by QCPCR targeting the SAG1 gene. Control groups were injected with
PBS. Data represent means 6 SD of three to ®ve mice in three
separate experiments. *P > 0.05; **P < 0.01. (B) mRNA expression
of IL-10 by PEC B-1 cells. B-1 cells were puri®ed from PEC of
uninfected mice and T. gondii-infected BALB/c and B6 mice 7 days
after infection as described in Methods. mRNA expression of IL-10
in B-1 cells from PEC of uninfected and T. gondii-infected BALB/c
and B6 mice was analyzed. Representative results from three
independent experiments are shown. (C) Intracellular IFN-g
expression on PEC from uninfected B6 mice (shaded histograms),
T. gondii-infected B6 mice (solid line) and T. gondii-infected B6
mice transferred with peritoneal B-1 cells (dotted line). The PEC from
uninfected B6 mice, T. gondii-infected B6 mice and T. gondiiinfected B6 mice transferred with peritoneal B-1 cells were stained
with FITC-labeled rat anti-mouse IFN-g mAb. Flow cytometric
analysis was performed as described in Methods. Representative
results from three independent experiments are shown.
1 Suzuki, Y., Sher, A., Yap, G., Park, D., Neyer, L. E., Liesenfeld, O.,
Fort, M., Kang, H. and Gufwoli, E. 2000. IL-10 is required for
prevention of necrosis in the small intestine and mortality in both
genetically resistant BALB/c and susceptible C57BL/6 mice
following peroral infection with Toxoplasma gondii. J. Immunol.
164:5375.
2 Aosai, F., Yang, T. H., Norose, K., He, N., Ueda, M. and Yano, A.
1995. Comparative study of interferon-g production by
Toxoplasma gondii-infected melanoma cell-speci®c CD4+ CTL.
Jpn. J. Parasitol. 44:210.
3 Aosai, F., Yang, T. H., Ueda, M. and Yano, A. 1994. Isolation of
naturally processed peptides from a Toxoplasma gondii-infected
human B lymphoma cell line that are recognized by cytotoxic T
lymphocytes. J. Parasitol. 80:260.
4 Yang, T. H., Aosai, F., Norose, K., Ueda, M. and Yano, A. 1995.
Enhanced cytotoxicity of IFN-gamma-producing CD4+ cytotoxic T
lymphocytes speci®c for T. gondii-infected human melanoma
cells. J. Immunol. 154:290.
5 Yano, A., Aosai, F., Ohta, M., Hasekura, H., Sugane, K. and
Hayashi, S. 1989. Antigen presentation by Toxoplasma gondiiinfected cells to CD4+ proliferative T cells and CD8+ cytotoxic
cells. J. Parasitol. 75:411.
6 Yano, A., Ohno, S., Norose, K., Baba, T., Yamashita, K., Aosai, F.
and Segawa, K. 1992. Antigen presentation by Toxoplasma-
46
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
infected cells: antigen entry through cell membrane fusion. Int.
Arch. Allergy Immunol. 98:13.
Hightower, L. E. 1991. Heat shock, stress protein, chaperones,
and proteotoxicity. Cell 66:191.
Vanbuskirk, A., Crump, B. L., Margoliash, E. and Pierce, S. K.
1989. A peptide binding protein having a role in antigen
presentation is a member of the HSP70 heat shock family. J.
Exp. Med. 170:1799.
DeNagel, D. C. and Pierce, S. K. 1992. A case for chaperones in
antigen processing. Immunol. Today 13:86.
Manara, G. C., Sansoni, P., Badiali-De Giorgi, L., Gallinella, G.,
Ferrari, C., Brianti, V., Fagnoni, F. F., Ruegg, C. L., De Pan®lis, G.
and Pasquinelli, G. 1993. New insights suggesting a possible role
of a heat shock protein 70-kD family-related protein in antigen
processing/presentation phenomenon in humans. Blood 82:2865.
Chen, M., Aosai, F., Mun, H. S., Norose, K., Hata, H. and Yano, A.
2000. Anti-HSP70 autoantibody formation by B-1 cells in
Toxoplasma gondii-infected mice. Infect. Immun. 68:4893.
Mun, H. S., Aosai, F. and Yano, A. 1999. Role of Toxoplasma
gondii HSP70 and Toxoplasma gondii HSP30/bag1 in antibody
formation and prophylactic immunity in mice experimentally
infected with Toxoplasma gondii. Microbiol. Immunol. 43:471.
Benoist, C. and Mathis, D. 2001. Autoimmunity provoked by
infection: how good is the case for T cell epitope mimicry? Nat.
Immunol. 2:797.
Hayakawa, K., Hardy, R. R., Parks, D. R. and Herzenberg, L. A.
1983. The `Ly-1 B' cell subpopulation in normal immunodefective,
and autoimmune mice. J. Exp. Med. 157: 202.
Hayakawa, K., Hardy, R. R., Honda, M., Herzenberg, L. A.,
Steinberg, A. D. and Herzenberg, L. A. 1984. Ly-1 B cells:
functionally distinct lymphocytes that secrete IgM autoantibodies.
Proc. Natl Acad. Sci. USA 81:2494.
Hayakawa, K., Hardy, R. R., Herzenberg, L. A. and Herzenberg, L.
A. 1985. Progenitors for Ly-1 B cells are distinct from progenitors
for other B cells. J. Exp. Med. 161:1554.
Tarakhovsky, A. 1997. Bar Mitzvah for B-1 cells: how will they grow
up? J. Exp. Med. 185:981.
Murakami, M., Nakajima, K., Yamazaki, K., Muraguchi, T.,
Serikawa, T. and Honjo, T. 1997. Effects of breeding
environments on generation and activation of autoreactive B-1
cells in anti-red blood cell autoantibody transgenic mice. J. Exp.
Med. 185:791.
Wabl, M. and Steinberg, C. 1996. Af®nity maturation and class
switching. Curr. Opin. Immunol. 8:89.
Rajewsky, K. 1996. Clonal selection and learning in the antibody
system. Nature 381:751.
Luo, W., Aosai, F., Ueda, M., Yamashita, K., Shimizu, K., Sekiya,
S. and Yano, A. 1997. Kinetics in parasite abundance in
susceptible and resistant mice infected with an avirulent strain
of Toxoplasma gondii by using quantitative competitive PCR. J.
Parasitol. 83:1070.
Hedman, K. and Seppala, I. 1988. Recent rubella virus infection
indicated by a low avidity of speci®c IgG. J. Clin. Immunol. 8: 214.
Lappalainen, M., Koskela, P., Koskiniemi, M., Ammala, P.,
Hiilesmaa, V., Teramo, K., Raivio, K. O., Remington, J. S. and
Hedman, K. 1993. Toxoplasmosis acquired during pregnancy:
improved serodiagnosis based on avidity of IgG. J. Infect. Dis.
167:691.
Luo, W.., Seki, T., Yamashita, K., Aosai, F., Ueda, M. and Yano, A.
1995. Quantitative detection of Toxoplasma gondii by competitive
polymerase chain reaction of the surface speci®c antigen gene-1.
Jpn. J. Parasitol. 44:183.
Burg, J. L., Perelman, D., Kasper, L. H., Ware, P. L. and
Boothroyd, J. C. 1988. Molecular analysis of the gene encoding
the major surface antigen of Toxoplasma gondii. J. Immunol.
141:3584.
Kasaian, M. T. and Casali, P. 1993. Autoimmunity-prone B-1 (CD5
B) cells, natural antibodies and self recognition. Autoimmunity
15:315.
Murakami, M., Tsubata, T., Okamoto, M., Shimizu, A., Kumagai,
S., Imura, H. and Honjo, T. 1992. Antigen-induced apoptotic death
of Ly-1 B cells responsible for autoimmune disease in transgenic
mice. Nature 357:77.
28 Fagarasan, S. and Honjo, T. 2000. T-independent immune
response: new aspects of B cell biology. Science 290:89.
29 Mercolino, T. J., Locke, A. L., Afshari, A., Sasser, D., Travis, W. W.,
Arnold, L. W. and Haughton, G. 1989. Restricted immunoglobulin
variable region gene usage by normal Ly-1 (CD5+) B cells that
recognize phosphatidyl choline. J. Exp. Med. 169:1869.
30 Pennell, C. A., Sheehan, K. M., Brodeur, P. H. and Clarke, S. H.
1989. Organization and expression of VH gene families
preferentially expressed by Ly-1+ (CD5) B cells. Eur. J.
Immunol. 19:2115.
31 Reininger, L., Kaushik, A., Izui, S. and Jaton, J. C. 1988. A
member of a new VH gene family encodes antibromelinized
mouse red blood cell autoantibodies. Eur. J. Immunol.
18:1521.
32 Hayakawa, K., Carmack, C. E., Hyman, R. and Hardy, R. R. 1990.
Natural autoantibodies to thymocytes: origin, VH genes, ®ne
speci®cities, and the role of Thy-1 glycoprotein. J. Exp. Med.
172:869.
33 Pecquet, S. S., Ehrat, C. and Ernst, P. B. 1992. Enhancement of
mucosal antibody responses to Salmonella typhimurium and the
microbial hapten phosphorylcholine in mice with X-linked
immunode®ciency by B-cell precursors from the peritoneal
cavity. Infect. Immun. 60:503.
34 Pennell, C. A., Arnold, L. W., Lutz, P. M., LoCascio, N. J.,
Willoughby, P. B. and Haughton, G. 1985. Cross-reactive
idiotypes and common antigen binding speci®cities expressed
by a series of murine B-cell lymphomas: etiological implications.
Proc. Natl Acad. Sci. USA 82:3799.
35 Gething, M. J. and Sambrook, J. 1992. Protein folding in the cell.
Nature 355:33.
36 Morimoto, R. I. and Milarski, K. L. 1990. Expression and function of
vertebrate hsp70 genes. In Morimoto, R. I., ed., The Stress Protein
in Biology and Medicine, p. 323. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
37 VanBuskirk, A. M., DeNagel, D. C., Guagliardi, L. E., Brodsky, F.
M. and Pierce, S. K. 1991. Cellular and subcellular distribution of
PBP72/74, a peptide-binding protein that plays a role in antigen
processing. J. Immunol. 146:500.
38 Yang, T. H., Aosai, F., Norose, K., Mun, H. S. and Yano, A. 1997.
Heat shock cognate protein 71-associated peptides function as
an epitope for Toxoplasma gondii-speci®c CD4+ CTL. Microbiol.
Immunol. 41:553.
39 Lakey, E. K., Margoliash, E. and Pierce, S. K. 1987. Identi®cation
of a peptide binding protein that plays a role in antigen
presentation. Proc. Natl Acad. Sci. USA 84:1659.
40 Gazzinelli, R. T., Hieny, S., Wynn, T. A., Wolf, S. and Sher, A. 1993.
Interleukin 12 is required for the T-lymphocyte-independent
induction of interferon gamma by an intracellular parasite and
induces resistance in T-cell-de®cient hosts. Proc. Natl Acad. Sci.
USA 90:6115.
41 Jun, C. D., Kim, S. H., Soh, C. T., Kang, S. S. and Chung, H. T.
1993. Nitric oxide mediates the toxoplasmastatic activity of murine
microglial cells in vitro. Immunol. Invest. 22:487.
42 Langermans, J. A., Van der Hulst, M. E., Nibbering, P. H.,
Hiemstra, P. S., Fransen, L. and Van Furth, R. 1992. IFN-gammainduced L-arginine-dependent toxoplasmastatic activity in murine
peritoneal macrophages is mediated by endogenous tumor
necrosis factor-alpha. J. Immunol. 148:568.
43 Bohne, W., Heesemann, J. and Gross, U. 1994. Reduced
replication of Toxoplasma gondii is necessary for induction of
bradyzoite-speci®c antigens: a possible role for nitric oxide in
triggering stage conversion. Infect. Immun. 62:1761.
44 Rousset, F., Garcia, E., Defrance, T., Peronne, C., Vezzio, N., Hsu,
D. H., Kastelein, R., Moore, K. W. and Banchereau, J. 1992.
Interleukin 10 is a potent growth and differentiation factor for
activated human B lymphocytes. Proc. Natl Acad. Sci. USA
89:1890.
45 D`Andrea, A., Aste-Amezaga, M., Valiante, N. M., Ma, X., Kubin,
M. and Trinchieri, G. 1993. Interleukin 10 (IL-10) inhibits human
lymphocyte interferon gamma-production by suppressing natural
killer cell stimulatory factor/IL-12 synthesis in accessory cells. J.
Exp. Med. 178:1041.
46 Tripp, C. S., Wolf, F. and Unanue, E. R. 1993. Interleukin 12 and
Self-HSP70-speci®c B-1 cells in T. gondii-infected mice
tumor necrosis factor alpha are costimulators of interferon gamma
production by natural killer cells in severe combined
immunode®ciency mice with listeriosis, and interleukin 10 is a
physiologic antagonist. Proc. Natl Acad. Sci. USA 90:3725.
47 O`Garra, A., Chang, R., Go, N., Hastings, R., Haughton, G. and
Howard, M. 1992. Ly-1 B (B-1) cells are the main source of B cellderived interleukin 10. Eur. J. Immunol. 22:711.
48 Nisitani, S., Sakiyama, T. and Honjo, T. 1998. Involvement of IL-10
47
in induction of autoimmune hemolytic anemia in anti-erythrocyte Ig
transgenic mice. Int. Immunol. 10:1039.
49 Velupillai, P., Sypek, J. and Harn, D. A. 1996. Interleukin-12 and 10 and gamma interferon regulate polyclonal and ligand-speci®c
expansion of murine B-1 cells. Infect. Immun. 64:4557.
50 Fiorentino, D. F., Zlotnik, A., Mosmann, T. R., Howard, M. and
O`Garra, A. 1991. IL-10 inhibits cytokine production by activated
macrophages. J. Immunol. 147:3815.