Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Table S1. Effects of a lon mutation on antibiotic activity Bacterial strain tested Halo size (diameter) against Bacillus subtilis (mm) Closest distance to Fusarium oxysporum (mm) CHA0 (wild type) 16.5 ± 1.9 7.4 ± 1.0 lon 21.1 ± 1.8* 12.9 ± 2.1* lon+lon 14.8 ± 1.9 ND Data represent the averages of five replicates against B. subtilis and three replicates against F. oxysporum. ND, not determined; * indicate values that are significantly different from those in CHA0 (wild type) at the P < 0.05 level (t-test). Table S2. Bacterial strains and plasmids used in this study Strain or plasmid Description Source or reference Wild type C. Keel DH5, HB101 Laboratory strains W3110 Prototroph, sup°λ− F- ompT hsdSB (rB- mB-) gal dcm (DE3) Sambrook and Russell, 2001 Sambrook and Russell, 2001 Novagen CHA0 Wild type Stutz et al., 1986 CHA89 gacA::Kmr; Kmr Laville et al., 1992 CHA1321 pycA::Sp/Sm Takeuchi et al., 2009 CHAclpPX clpPX This study CHAclpPX-lon clpPX-lon This study CHAlon CHAlonC lon lon strain with lon+ region in mini-Tn7 This study This study pCR-Blunt II-TOPO Cloning vector, pUC ori; Kmr Invitrogen pET30b (+) pET30-Lon Inducible expression vector, Kmr Novagen pET30b (+) containing a lon region with C- This study terminal six-His tag, Kmr ColIbdrd-1::Tn5, IncIα, Kmr Boulnois et al., 1985 Strains Bacillus subtilis M168 Escherichia coli BL21 (DE3) Pseudomonas protegens Plasmids pLG221 pME497 pME3087 pME3087clpPX pME3087clpPX-lon pME3087lon Mobilizing plasmid, IncP-1, Tra, RepA(Ts); Voisard et al., 1988 Apr Suicide vector, ColE1 replicon, Mob; Tcr Voisard et al., 1994 pME3087 containing a BamHI/HindIII clpPX This study region containing a deletion of 1.4 kb in the clpPX genes; Tcr pME3087 containing a BamHI/XbaI clpPX-lon This study region containing a deletion of 3.9 kb in the clpPX-lon genes; Tcr pME3087 containing a EcoRI/XbaI lon region This study containing a deletion of 1.2 kb in the lon gene; Tcr pME6031 pACYC177-pVS1 shuttle vector; Tcr Heeb et al., 2000 pME6060 Translational aprA'-'lacZ fusion; Tcr Blumer et al., 1999 pME6091 Transcriptional rsmZ-lacZ fusion; Tcr Heeb et al., 2002 pME6182 pME6182lon Mini-Tn7 gene delivery vector based on Humair et al., 2009 pME3280a, HindIII-SmaI-KpnI-NcoI-SphI cloning site, ColE1 replicon; Gmr Apr pME6182 containing the lon gene in mini-Tn7 This study pME7402 Transcriptional rsmZ-gfp fusion; Tcr pME7699 Transcriptional rsmY-lacZ fusion in mini-Tn7 Humair et al., 2009 gene delivery vector pME6182; Gmr Apr pUX-BF13 Helper plasmid encoding Tn7 transposon Bao et al., 1991 fusions; Apr Dubuis et al., 2006 Table S3. Oligonucleotides used in this study Oligonucleotide Description Source or or reference LonUF 5'-ACGTGAATTCTGTTTACGGCCTTACGG-3', underlining indicates the artificial EcoRI site This study LonUR 5'-CTTTTCCACTTGCAGCAGATCG-3', anneals to the 5' region of LonDF 5’CGATCTGCTGCAAGTGGAAAAGTTGGCATGGACTCA AGTGG-3' 5'-ACGTTCTAGACACTTAAGAGCCGCT-3', underlining indicates the artificial XbaI site This study LonFPciI 5'-ACGTACATGTATGAAATCCCCTCGCAG-3', underlining indicates the artificial PciI site This study LonRSmaI 5'-ACGTCCCGGGCTCTAAAAAGCTGTCA-3', underlining indicates the artificial SmaI site This study ClpPUF 5'-ACGTGGATCCTGAATCTGACCTTCCCTGAG-3', underlining indicates the artificial BamHI site This study ClpPUR 5'-ACGGAACATGCTCTGCAGTCA-3', anneals to the 5' region of ClpXDF or LonDF2 This study ClpXDF 5’TGACTGCAGAGCATGTTCCGTAAGCATCCGCAGCAG GAATTC-3' 5'-ACGTAAGCTTGAAACCAAGATGGG-3', underlining indicates the artificial HindIII site 5’TGACTGCAGAGCATGTTCCGTTTGGCATGGACTCAA GTGG -3' This study LonDF LonDR ClpXDR LonDF2 This study This study This study This study