Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download e2f and survivin – key players in cellular proliferation
Document related concepts
no text concepts found
Transcript
E2F AND SURVIVIN – KEY PLAYERS IN CELLULAR PROLIFERATION AND TRANSFORMATION DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Baidehi Maiti, M.B.B.S. ***** The Ohio State University 2007 Dissertation Committee: Dr. Rachel A. Altura, Advisor Approved by Dr. Arthur H.M. Burghes Dr. Albert de la Chapelle Dr. Jiayuh Lin Advisor Graduate Program in Molecular Genetics ABSTRACT The E2F transcription factor family and survivin play a crucial role in maintaining homeostasis by coupling the vital processes of cell division and apoptosis. Deregulation of E2F or survivin signaling, lead to developmental defects in mice and are hallmarks of virtually every human cancer. Functionally, the mammalian E2F family consists of activators (E2F1-2 and E2F3a) and repressors (E2F3b and E2F4-8), which regulate cellular proliferation, apoptosis and differentiation. E2F7 and E2F8, which are the last two discovered mouse E2F family members, structurally form a sub-class within the repressor E2Fs. E2F7-8 are distinct in having a duplicated DNA binding domain, which is highly conserved across all the E2F family members. Both E2F7 and E2F8 inhibit cellular proliferation when overexpressed in mouse embryonic fibroblasts (MEFs). Expression of E2F7 and E2F8 are cell cycle regulated and are detected in the same adult mouse tissues suggesting a functional overlap or synergy. Consistent with the expanding complexity and functional diversity of the large mammalian E2F family, a cell cycle checkpoint is also regulated by the ii E2Fs. Simultaneous deletion of E2F1, E2F2 and E2F3, leads to a severe proliferative defect in the MEFs, correlating with the upregulation of p21 and the absence of cyclin dependent kinase activity. A proliferative defect is also observed in the MEFs conditionally deleted for survivin, a direct transcriptional target of the E2Fs. Survivin performs dual functions as a regulator of cell division and as an anti-apoptotic protein. During cell division, survivin ensures high fidelity chromosomal segregation and proper cytokinesis. Accordingly, survivin deleted MEFs fail to proliferate and become increasingly polyploid with an abnormal nuclear morphology. However, they do not undergo apoptosis, indicating a role of survivin in proliferation but not survival. Additionally, MEFs transformed with oncogenes c-Myc and H-RasV12 fail to proliferate following conditional deletion of survivin, demonstrating a requirement for survivin in the maintenance of transformation. Preliminary evidence also suggests that survivin is capable of collaborating with c-Myc or HRasV12 in transforming MEFs, unraveling a novel role for survivin in cancer initiation. Collectively, these data uncover important roles of the E2F family and survivin in cellular proliferation and transformation. iii Dedicated to my parents, Dr. Bibekananda Maiti and Dr. Ilorasri Chakraborti for everything you do iv ACKNOWLEDGMENTS I would like to thank my advisor Dr. Rachel A. Altura for her excellent guidance, advice, encouragement and support. I am grateful to her for providing me a scientifically stimulating, enjoyable and productive mentor-student relationship. She has been instrumental in making this thesis possible. I wish to extend my gratitude to Dr. Gustavo W. Leone for giving me his time, supervision, scientific training and advice. I am thankful to all my current and past graduate advisory committee members, Dr. Arthur H. M. Burghes, Dr. Albert de la Chapelle, Dr. Jiayuh Lin, Dr. Lee F. Johnson and Dr. Michael C. Ostrowski for their time and effort towards my scientific development. I would like to acknowledge the contributions of all my present and past colleagues from the Altura and Leone labs. Thanks to Harold I. Saavedra, Rene Opavsky and Yuying Jiang, not only for their excellent scientific advice but also for being wonderfully supportive friends. It has also been a great learning experience to work with Cynthia McAllister, Michael P. Holloway, Lizhao Wu, Cynthia Timmers and Alain de bruin. v Thank you to Dr. Mark A. Seeger, Dr. Berl R. Oakley and Dr. David M. Bisaro for your kind and active support through some of the most challenging times of my career. I am also thankful to the staff of Molecular Genetics for their excellent timely help in the official procedures and paperwork. Finally, none of my achievements would be possible without the endless love and support of my family and friends. Thanks so much to my husband Sumit for remaining ever so loving, caring, understanding and supportive even when facing my displaced frustrations from failed experiments. Our little daughter Shivangi continues to be a source of enormous joy, love and energy for me. I am ever so thankful to my brother Baijayanta for his love, support and unwavering confidence in my abilities through rain or shine. My parents are a source of great inspiration for me. Their deepest love and devotion continues to brighten each day of my life. I can never thank them enough. vi VITA 1999……………………………….. M.B.B.S., Calcutta Medical College, University of Calcutta, Calcutta, India. 1999 - present……………………. Graduate Teaching and Research Associate, The Ohio State University, Columbus, Ohio. PUBLICATIONS Research Publication 1. Timmers C, Sharma N, Opavsky R, Maiti B, Wu L, Wu J, Orringer D, Trikha P, Saavedra HI, Leone G. E2f1, E2f2, and E2f3 control E2F target expression and cellular proliferation via a p53-dependent negative feedback loop. Mol Cell Biol. 2007 Jan;27(1):65-78. PMID: 17167174 2. Logan N, Graham A, Zhao X, Fisher R, Maiti B, Leone G, La Thangue NB. E2F-8: an E2F family member with a similar organization of DNA-binding domains to E2F-7. Oncogene. 2005 Jul 21;24(31):5000-4. PMID: 15897886 3. Maiti B, Li J, de Bruin A, Gordon F, Timmers C, Opavsky R, Patil K, Tuttle J, Cleghorn W, Leone G. Cloning and characterization of mouse E2F8, a novel mammalian E2F family member capable of blocking cellular proliferation. J Biol Chem. 2005 May 6;280(18):18211-20. Epub 2005 Feb 18. PMID: 15722552 4. de Bruin A, Maiti B, Jakoi L, Timmers C, Buerki R, Leone G. Identification and characterization of E2F7, a novel mammalian E2F family member capable of blocking cellular proliferation. J Biol Chem. 2003 Oct 24;278(43):42041-9. Epub 2003 Jul 31. PMID: 12893818 5. Saavedra HI, Maiti B, Timmers C, Altura R, Tokuyama Y, Fukasawa K, Leone G. Inactivation of E2F3 results in centrosome amplification. Cancer Cell. 2003 Apr;3(4):333-46. PMID: 12726860 vii 6. Wu L, Timmers C, Maiti B, Saavedra HI, Sang L, Chong GT, Nuckolls F, Giangrande P, Wright FA, Field SJ, Greenberg ME, Orkin S, Nevins JR, Robinson ML, Leone G. The E2F1-3 transcription factors are essential for cellular proliferation. Nature. 2001 Nov 22;414(6862):457-62. PMID: 11719808 FIELDS OF STUDY Major Field: Molecular Genetics viii TABLE OF CONTENTS Page Abstract ........................................................................................................ii Dedication ....................................................................................................iv Acknowledgment ..........................................................................................v Vita ... ...........................................................................................................vii List of Tables ................................................................................................xi List of Figures ...............................................................................................xii List of Abbreviations .....................................................................................xv Chapter 1: Introduction ................................................................................1 E2F overview .....................................................................................2 The mammalian E2F transcription factor family.................................3 E2Fs regulate cellular proliferation ....................................................4 E2F in apoptosis ................................................................................5 E2Fs and cancer................................................................................6 Survivin overview ...............................................................................7 Survivin as an anti-apoptotic protein ..................................................8 Function of survivin in cell division .....................................................10 Survivin in development.....................................................................12 Survivin and cancer ...........................................................................13 Conclusion .........................................................................................15 Tables and figures .............................................................................16 Chapter 2: Cloning and characterization og mouse E2F8, a novel mammalian E2F family member capable of blocking cellular proliferation .......................25 ix Abstract..............................................................................................25 Introduction ........................................................................................26 Materials and Methods.......................................................................29 Results...............................................................................................36 Discussion .........................................................................................47 Tables and Figures ............................................................................50 Chapter 3: Identification and characterization of E2F7, a novel mammalian E2F family member capable of blocking cellular proliferation ..............................63 Abstract..............................................................................................63 Introduction ........................................................................................64 Materials and methods.......................................................................68 Results...............................................................................................69 Discussion .........................................................................................74 Tables and figures .............................................................................77 Chapter 4: The E2F1-3 transcription factors are essential for cellular proliferation ...........................................................................................................83 Abstract..............................................................................................83 Introduction ........................................................................................84 Results and discussion ......................................................................85 Materials and methods.......................................................................89 Tables and figures .............................................................................92 Chapter 5: Survivin is essential for proliferation and collaborates with c-Myc and H-Ras (V12) in the transformation of mouse embryonic fibroblasts..............98 Abstract..............................................................................................98 Introduction ........................................................................................99 Materials and methods.......................................................................104 Results and discussion ......................................................................107 Tables and figures .............................................................................112 Chapter 6: Discussion .................................................................................125 E2F7 and E2F8 form unique sub-class in the murine E2F family ......125 Survivin is essential for the proliferation and transformation of MEFs126 List of references ..........................................................................................128 x LIST OF TABLES Table 4.1 Page Genotypic analysis of E13.5 embryos derived from crosses of E2F mutant animals………………………………………………………………………97 xi LIST OF FIGURES Figure Page 1.1 The cell division cycle...................................................................16 1.2 Rb and E2F regulate gene expression .........................................17 1.3 E2F: the family portrait .................................................................18 1.4 Genomic structure of the survivin locus and splice variants .........19 1.5 Structure-function of survivin splice variants ................................20 1.6 Schematic representation of the human inhibitor of apoptois protein family ............................................................................................21 1.7 Pathways to apoptosis..................................................................22 1.8 Localization and function of survivin (and its fellow passenger proteins) during mitosis ...............................................................................23 2.1 Structure of mouse E2F8 gene, mRNA and protein .....................50 2.2 Comparative analysis of E2F8 and other known E2F and DP family members ......................................................................................52 xii 2.3 Tissue-specific and cell cycle-dependent expression of E2F8 .....54 2.4 Regulation of E2F8 promoter .......................................................56 2.5 Subcellular localization and DNA binding activity of E2F8............58 2.6 E2F8 can homodimerize...............................................................60 2.7 E2F8 overexpression inhibits cellular proliferation .......................61 3.1 Tissue-specific and cell cycle-dependent expression of E2F7 .....77 3.2 Cell cycle regulation of the E2F7 promoter...................................79 3.3 E2F7 has transcriptional repressor function .................................81 4.1 E2F3 conditional knock out strategy.............................................92 4.2 Growth defect in E2F3 single or combinatorial knock out MEFs ..94 4.3 Loss of E2F3 activates checkpoint via p21...................................95 5.1 Conditional knock out strategy of survivin in primary mouse embryonic fibroblasts .....................................................................................112 5.2 Survivin is essential for proliferation but not for survival of primary MEFs ............................................................................................114 5.3 Primary MEFs lacking survivin display an abnormal nuclear morphology...................................................................................116 5.4 Loss of survivin results in polyploidy.............................................120 5.5 Survivin is essential for the maintenance of the myc/ras transformed phenotype in MEFs.......................................................................122 xiii 5.6 Survivin collaborates with c-Myc and H-RasV12 in transforming wt primary MEFs ...............................................................................124 xiv ABBREVIATIONS APC Adenomatous polyposis coli APC/C Anaphase promoting complex/cyclosome ATM Ataxia-telangiectasia-mutated BIR Baculovirus IAP repeat BIRC Baculoviral IAP-repeat-containing BrdU 5-bromo-2_-deoxyuridine CARDs Caspase-recruitment domains Cdk Cyclin dependent kinase Chk2 Checkpoint kinase 2 cIAP Cellular IAP (cIAP) xv CMV Cytomegalovirus CPC Chromosomal passenger complex CPP Chromosomal Passenger Protein DAPI 4,6-diamidino-2-phenylindole DBD DNA binding domain DBD DNA-binding domain(s) DDR DNA damage response DHFR Dihydrofolate reductase DMEM Dulbecco’s modified Eagle’s medium ERK Extracellular signal-regulated kinase EST Expressed sequence tag(s) FBS Fetal bovine serum. GDP Guanosine diphosphate g-o-f Gain of function GTP Guanosine triphosphate HBXIP Hepatitis B X-interacting protein HDAC Histone Deacetylase HIAP Human IAP xvi IAP Inhibitor of apoptosis protein ILP IAP-like protein INCENP Inner centromere protein. KIAP Kidney IAP l-o-f Loss of function LRRs Leucine-rich repeats MAPK Mitogen-activated protein kinase MEF Mouse embryonic fibroblast(s) MIH Mammalian IAP homologue ML-IAP Melanoma IAP NACHT Domain found in NAIP, CIITA, HET-E and TP-1 NAIP Neuronal apoptosis-inhibitory protein NES Nuclear export signal PBS Phosphate buffered saline PCR Polymerase chain reaction PI Propidium Iodide PI3K Phosphatidylinositol 3-kinases xvii Rb Retinoblastoma RING Really interesting new gene RNAi RNA interference RPE Retinal pigment epithelium shRNA Short hairpin RNA TK Thymidine kinase Ts-IAP Testicular IAP UBC Ubiquitin-conjugation WT Wild type XIAP X-linked IAP xviii CHAPTER 1 INTRODUCTION Cell division is an essential process in normal development, growth, reproduction and immunity. It also plays an important role in various disease processes. Consequently, the cell division cycle is highly regulated with a multitude of proteins orchestrating the sequence of events in a temporal and spatial manner. To maintain homeostasis, cell division and apoptosis (or programmed cell death) must be tightly coupled. A disruption in the coordination of these two processes can lead to aberrant cellular proliferation with the accumulation of genetic mutations and ultimately to a transformed phenotype. The E2F family of transcription factors and the anti-apoptotic protein, survivin are significant molecules that link cellular proliferation and cell death. Signaling pathways involving these proteins are deregulated and/or mutated in a vast majority of human cancers and are the focus of this thesis. 1 E2F overview In mammals, the cell cycle consists of four stages: G1, S, G2 and M (Figure 1.1). An important event during the G1-S transition of the cell cycle is the phosphorylation of tumor suppressor protein, Retinoblastoma (Rb) by the various cdks (cyclin dependent kinases). Rb when hypophosphorylated binds to the E2F family of transcription factors thus inactivating them. Phosphorylated Rb no longer binds E2F. Consequently Rb-mediated repression is lifted and the E2F target genes can be expressed (Dyson, 1998). The E2F target genes play important roles in a variety of cellular processes like DNA replication, DNA repair, mitosis, apoptosis and cell cycle checkpoint functions and differentiation (DeGregory and Johnson, 2006) (Figure 1.2). Consequently, deregulated E2F activities result in developmental defects and cancer (DeGregory and Johnson, 2006). The mammalian E2F transcription factor family The mammalian E2F transcription factors arise from eight distinct genes, E2F1 – 8. These loci give rise to at least ten different transcripts with two isoforms each from the E2F3 and E2F7 genes. The highly conserved DNA binding domain is shared among all the family members and enables the E2Fs to 2 bind a consensus DNA binding element present on its target gene promoters (DeGregory and Johnson, 2006; Tsantoulis and Gorgoulis, 2005). E2F7 and E2F8 are unique in possessing duplicated DNA binding domains. (Christensen et al., 2005; Logan et al., 2005; Maiti et al., 2005 ∗ ; Logan et al., 2004; DiStefano et al., 2003; deBruin et al., 2003 ∗ ). A C-terminal transactivation domain, in which is embedded the Rb-binding region, is present in E2Fs 1-5. The E2Fs 1-6 have a leucine-zipper dimerization domain through which they bind to their dimerization partner, DP. This dimerization enables high-affinity DNA binding as well as regulates the subcellular localization pattern of E2F (Figure 1.3) (DeGregory and Johnson, 2006; Tsantoulis and Gorgoulis, 2005). E2F activities are also regulated at the levels of transcription, post translational modifications like acetylation and phosphorylation, co-factor binding and ubiquitination (Nevins et al., 1998, Trimarchi and Lees, 2002). Functionally, E2Fs have been classified as ‘activators’ or ‘repressors’ depending on their action on target promoters and their association with these promoters during transcriptionally active or repressed states. The ‘activator’ E2Fs (E2F 1-3) associate with the target gene promoters during active transcription (G1-S phase of cell cycle), while ‘repressor E2Fs (E2F4-5) associate with the target genes during early G1 and quiescence. E2F4-5 repress genes at least in part via recruiting Rb, p130, p107 (the pocket proteins) and their associated co- ∗ These two papers, reporting for the first time, the cloning and characterization of mouse E2F7 and E2F8, form part of this thesis since they have significant contributions by Maiti B. 3 repressors like HDAC (Histone Deacetylase), BRM/BRG1 (Chromatin remodeling complex) and SUV39H (Histone methylation machinery), while E2F6 represses genes by complex formation with either the polycomb group of proteins or with Mga and Max proteins (Trimarchi et al., 2001; Ogawa et al., 2002). The mechanism of repression by E2F7 and E2F8 is unclear at this point. Additionally, the activator E2Fs as well as E2F7 and E2F8 show a cell cycle regulated oscillation in expression, while no such variation is observed for the repressor E2Fs 4 and 5 (DeGregory and Johnson, 2006). E2Fs regulate cellular proliferation E2Fs have been shown to play an important role in cell cycle progression as well as cell cycle arrest through gene disruption (knockout) and overexpression. E2F1 overexpression has been shown to promote S-phase induction in mouse embryonic fibroblasts (Wang et al., 1998). Accordingly, its deficiency leads to impaired cell cycle progression in activated T-cells (DeGregory and Johnson, 2006). Combinatorial knockouts of E2F1 and E2F2 lead to defective proliferation of hematopoietic progenitors and exocrine pancreas (DeGregory and Johnson, 2006). While E2F1-/-E2F3-/- and E2F2-/E2F3-/- MEFs have severe proliferation defects, E2F1-/-E2F2-/-E2F3-/- MEFs arrest in every stage of the cell cycle (Wu et al., 2001). On the other hand, MEFs deficient in the ‘repressor’ E2Fs, E2F4 and E2F5 fail to arrest despite 4 overexpression of p16Ink4a (a cyclin dependent kinase inhibitor leading to hypophosphorylated Rb) indicating a requirement for ‘repressor’ E2F mediation of pocket protein functions (DeGregory and Johnson, 2006). Generally speaking, the ‘activator’ E2Fs, which transactivate the target genes, are ‘pro-proliferative’, while ‘repressor’ E2Fs, which silence target genes, inhibit proliferation. Accordingly, E2F7 and E2F8 have also been shown to inhibit cellular proliferation and repress known E2F targets (Tsantoulis and Gorgoulis, 2005; DeGregory and Johnson, 2006). E2F in Apoptosis E2F1 is the most extensively studied E2F family member in apoptosis. E2F1 mediates apoptosis via the p53 and p73 pathways (DeGregory and Johnson, 2006). p53 dependent apoptosis is mediated via the ARF gene, which is a transcriptional target of E2F1. ARF prevents mdm2 mediated p53 degradation and leads to stabilization of p53. E2F1 also mediates the DNA damage response (DDR) checkpoint due to DNA damage induced by radiation or by the intercalating agent adriamycin. Phosphorylation of E2F1 by ATM (Ataxiatelangiectasia-mutated), Rad3-related (ATR) kinases and checkpoint kinase 2 (Chk2) leads to its stabilization, following DNA damage (Lin et al., 2001; Stevens et al., 2003). E2F1 in turn can lead to ATM dependent phosphorylation of p53, leading to its stabilization and activation, and hence apoptosis (Lin et al., 2001; 5 Powers et al., 2004; Rogoff et al., 2004). The importance of E2F1 mediated apoptosis is evident in vivo by the reduced apoptosis of thymocytes leading to impaired negative selection in E2F1-/- mice. Besides E2F1, E2F3 is also capable of inducing apoptosis when overexpressed (DeGregory and Johnson, 2006). E2Fs and cancer Deregulated E2F activity, as a result of mutations in Rb itself or in members of its signaling pathway, including p16Ink4a (a cyclin dependent kinase inhibitor), and Cyclin D is a hallmark of virtually every human cancer. Additionally, amplification of E2F1, E2F3 or E2F5 has been documented in retinoblastoma, bladder, lung, ovarian and prostate, gastrointestinal cancers and metastatic melanomas (Johnson and DeGregory, 2006). Paradoxically, overexpression or amplification of the same E2F family member could lead to a favorable or unfavorable prognosis, perhaps depending on the tissue involved and associated mutations (Johnson and DeGregory, 2006). All the E2F family members that associate with Rb can lead to oncogenic transformation in vitro, when overexpressed (Johnson and DeGregory, 2006). Transgenic mice overexpressing E2F1, E2F3 and E2F4 in keratinocytes also show increased tumorigenicity (Johnson and DeGregory, 2006). E2Fs are 6 relevant targets downstream of mutated Rb in oncogenesis, as shown by their disruption leading to decreased tumor formation (Johnson and DeGregory, 2006). Some transgenic studies using mice deficient in E2F1, E2F2 or E2F3 reveal a tumor suppressive function for those E2F family members. Current evidence suggests that the tumor suppressor function of E2Fs have both p53 and apoptosis-dependent and -independent arms (Johnson and DeGregory, 2006). In case of E2F3, this could be related to genomic instability consequent to the loss of E2F3 (Saavedra et al., 2003). Thus the role of E2Fs in cancer is context specific and definitely warrants a thorough understanding and careful approach especially when designing drugs to target E2Fs in cancer therapy. Survivin overview Survivin, a direct transcriptional target of E2F, is a 16.5 kDa protein with dual functions in cellular proliferation and cell death (Altieri, 2003; Lens et al., 2006). In addition to its essential role as a chromosomal passenger protein (CPP) during mitosis, survivin prevents cell death by interfering with both caspase dependent and independent pathways (Wheatley et al., 2005). Analysis of the spatial and temporal expression of survivin reveals an ‘oncofetal’ pattern whereby it is ubiquitous during development, undetectable in most terminally differentiated adult tissues and highly re-expressed in virtually every human cancer (Altieri, 2006). Preferential expression of survivin in human cancers 7 makes it a potential diagnostic tool, prognostic marker as well as a promising therapeutic target. The survivin gene is located on chromosome 17q25 (human) or 11E2 (mouse). The human locus gives rise to at least five alternatively spliced survivin transcripts (Figure 1.4) Besides the wild type survivin (142 amino acids), survivin2B (165 amino acids) results from an alternative exon 2 insertion; survinin-ΔEx-3 (137 amino acids) arises from the exon 3 skipping resulting in a frameshift; and survivin-3B (120 amino acids) results from the novel exon 3B insertion (Figure 1.5) (Caldas et al., 2005). These isoforms help fine-tune survivin function and attribute more functional diversity to this gene. Survivin as an anti-apoptotic protein Survivin is the smallest member of the mammalian inhibitor of apoptosis (IAP) gene family, containing a single Baculovirus IAP repeat (BIR), a ~ 70amino-acid zinc-finger fold but no RING domain (Altieri, 2003). In humans eight IAPs have been identified so far, namely, cIAP-1, cIAP-2, XIAP, ILP-2, NAIP, MLIAP, apollon and survivin. IAPs are evolutionarily conserved from yeast to humans and function to protect the cell from the fortuitous activation of the caspase cascade and subsequent self-destruction (Zangemeister-Wittke et al., 2004) (Figure 1.6) 8 Mounting evidence in the field has unequivocally proven the anti-apoptotic function of survivin in both normal tissue and cancer. Inactivation of the survivin signaling by molecular antagonists like siRNA sequences or dominant negative mutants result in increased apoptosis in vitro and in vivo (Altieri, 2003). Mechanistically, Dohi et al., (2004) showed that following the addition of proapoptotic stimuli, a tumor cell specific mitochondrial pool of survivin is mobilized rapidly to the cytosol, where it blocks cell death at least in part by interfering with caspase-9 processing. Adenovirus mediated expression of dominant-negative survivin increases apoptosis in tumor cells and suppresses angiogenesis (BlancBrude et al., 2003). Furthermore, adenovirus mediated mitochondrial expression of survivin accelerates xenograft tumor growth in SCID mice and abrogates tumor cell apoptosis (Dohi et al., 2004; Li and Ling 2006). From a mechanistic viewpoint, survivin inhibits both caspase dependent and caspase independent apoptosis initiated via the extrinsic or intrinsic cellular apoptotic pathways. (Figure 1.7) As reviewed by Altieri (2003), cell death caused by inhibiting survivin signaling, exhibits features of mitochondrial dependent apoptosis with cytochrome c release, caspase-9 activation and activation of the caspase cascade. Survivin prevents cell death by binding to caspase-9 in the cytoplasm, in the presence of the HBXIP (Hepatitis B X-interacting protein) or by interaction with XIAP or Smac/DIABLO (a pro-apoptotic protein released from the mitochondria) (Zangemeister-Wittke et al., 2004). Pan caspase inhibitors only partially rescue apoptosis induced by overexpression of a survivin dominant 9 mutant (T34A), indicating the involvement of a caspase independent pathway by survivin (Liu et al., 2004). Function of survivin in cell division Disruption of survivin activity, using dominant negative mutants or survivin-specific siRNAs also results in mitotic defects, in a multitude of normal and tumor cell types studied. These defects are characterized by multipolar mitotic spindles, misseggregation of chromosomes, polyploidy, multinucleation and failure of cytokinesis (Altieri, 2003). Consistent with its role in mitosis, survivin is predominantly expressed during this period in a cell cycle regulated fashion and has been shown to physically associate with the mitotic apparatus (Altieri, 2006). Survivin forms a chromosomal passenger complex (CPC) with INCENP (inner centromere protein), Borealin/Dasra-B and the kinase subunit Aurora-B (Vader et al., 2006b). The chromosomal passenger proteins (CPP), survivin, INCENP and Borealin regulate the proper and timely localization of the active enzymatic core of the complex, Aurora-B. The CPC shows a very dynamic localization pattern during mitosis. At prophase it is present diffusely along chromatin, progressing to the inner kinetochore (site of spindle microtubule attachment) during prometaphase, to the central spindle during anaphase and the midbody during cytokinesis (Vader et al, 2006b). This dynamic localization of 10 the CPC correlates with its activity at the different sites, namely, histone modification, destabilization of improper chromosome-spindle attachments, maintaining the spindle assembly checkpoint (SAC) in a BubR1 and Mad2 (spindle checkpoint proteins) dependent fashion, thus promoting correct bioriented chromosome-spindle attachment and finally cytokinesis (Lens et al., 2006; Vader et al., 2006b; Lens et al., 2003) (Figure 1.8). In case of an improper kinetochore-microtubule interaction (for example kinetochores attached to microtubules from the same spindle pole or syntelic attachment), survivin and Aurora-B sense the lack of tension at the kinetochore, and signal directly to the microtubule, resulting in the activation of a spindle checkpoint by influencing affinity of checkpoint protein BubR1 to the kinetochore (lens et al., 2003; Lens and Medema, 2003). Thus, survivin and Aurora-B are crucial for ensuring highfidelity chromosomal segregation during mitosis. Vader et al., (2006a) targeted the individual members of the CPC in order to further pinpoint their contributions. Their work revealed that while INCENP stabilized the whole CPP complex and Borealin promoted survivin binding to INCENP; even in the absence of Borealin, survivin could localize Aurora-B to the centromere and midbody. Extensive biochemical work is ongoing to understand the functions of the different domains or residues of the survivin molecule. Vong et al., (2005) showed that the centromeric localization of survivin in a precise timely manner was orchestrated by ubiquitination and deubiquitination of survivin on the Lys(63) residue by the Ufd1 and hFAM proteins. Recently, Colnaghi et al., (2006) showed 11 that a point mutation (L98A) of the NES (Nuclear export signal) in the survivin molecule was able to separate the anti-apoptotic and mitotic functions of survivin, perhaps secondary to its nuclear localization pattern. The NES mutant of survivin, which is deficient in CRM1/exportin pathway mediated nuclear export, is still capable of carrying out the mitotic functions but is unable to serve as an antiapoptotic protein (Colnaghi et al., 2006). Survivin in development Survivin plays an essential role in normal embryonic development as evidenced by the early embryonic death of the survivin-/- embryos around day 4.5 post coitum (Uren at al., 2000; Conway et al., 2002). The survivin null embryos exhibited irregular nuclear morphology, multinucleation, giant cell formation and microtubule bundling, consistent with a defect in microtubule organization and cytokinesis (Uren et al., 2000). This was a phenocopy of INCENP null embryos, suggesting the requirement for survivin as a chromosomal passenger protein at this stage of development (Uren et al., 2000). The antiapoptotic role of survivin is also relevant in embryogenesis as elucidated by Jiang et al., (2004), where neuronal precursor cells lacking survivin underwent massive apoptosis resulting in an immature brain structure at birth. Additionally, hepatocytes from survivin +/- mice exhibit an increased apoptotic response to suboptimal activation of Fas ligand mediated cell death signaling (Conway et al., 12 2002; Altieri, 2003). Thus, survivin’s role in normal development is very likely a combination of its mitotic and cytoprotective functions. Survivin expression is undetectable in a vast majority of adult tissues with a few exceptions of rapidly dividing tissues, as hematopoietic stem/progenitor cells, T-lymphocytes, vascular endothelium and gastric epithelium (Li And Brattain, 2006; Fukuda et al., 2006). Survivin plays an important role in hematopoietic cells, T-lymphocyte proliferation survival and maturation. Okada et al., (2004) showed that conditional deletion of survivin in T cell lineage resulted in a differentiation block from CD4-CD8- double negative to CD4+CD8+ double positive T-lymphocytes, in addition to a proliferation defect in these cells. Survivin also plays an important role in spermatogenesis, wound healing and liver regeneration in adults (Li And Brattain, 2006). Thus, survivin plays a crucial role in the proliferation, survival and maturation of cells during the entire mammalian lifespan. Survivin and cancer Survivin is a ‘cancer gene’ and the top 4th ‘transcriptome’ preferentially expressed in transformed cells over the normal tissue (Altieri, 2006). Aberrantly high levels of survivin have been documented in virtually every human malignancy namely, central nervous system tumors (medulloblastoma, glioblastoma, astrocyte tumors), laryngeal, esophageal, breast, non-small cell 13 lung, gastric, pancreatic, hepatocellular, renal, endometrial, cervical cancers, as well as osteosarcoma, soft tissue sarcoma, melanoma, leukemias and lymphomas (Fukuda et al., 2006). Increased survivin expression corelates with a more aggressive tumor phenotype in terms of increased proliferation, and higher radio- and chemotherapy resistance, reflecting of the mitotic and anti-apoptotic functions of survivin. The nuclear versus cytoplasmic subcellular localization of survivin in cancer cells has also been associated with clinical outcome, including patient survival and tumor recurrence (Li et al., 2005; Altura et al., 2003). The cancer specificity combined with undetectable expression in terminally differentiated normal adult tissue makes survivin a highly explored molecular target for cancer therapy. Targeting survivin with siRNA in cancer cell lines results in increased apoptosis and heightened chemo- and radiosensitivity (Sommer et al., 2003). Survivin expression is positively regulated by multiple oncogenic pathways like E2F-Rb (Jiang et al., 2004), constitutively activated c-H-Ras (Sommer et al., 2003) and STAT3 (Kanda et al., 2003), and is also negatively regulated by various tumor suppressor pathways like p53 (Hoffman et al., 2003) and adenomatous polyposis coli (APC) (Zhang et al., 2001; Altieri, 2006). Thus, survivin is a fascinating little protein, which is at the crossroads of the multiple cancer related pathways and arms the cancer cell with pro-proliferative and antiapoptotic properties. 14 Conclusion In summary, the Rb-E2F and survivin signaling pathways overlap and yet play very distinct roles in cell division, differentiation, apoptosis and transformation. The chapters that follow elucidate the cloning and characterization of a novel mammalian E2F family member E2F8 and the contribution of survivin in the proliferation and transformation of primary mouse embryonic fibroblasts (MEFs). This thesis makes an effort towards understanding the roles played by the E2F family of transcription factors and survivin in the regulation of cellular proliferation and transformation in mammals. 15 Go (serum starved) cells M (Mitosis) G1 G2 S (DNA synthesis) Figure 1.1 The cell division cycle The cell cycle is comprised of G1, S, G2 and M phases. 16 CDK P P Rb Rb P E2F G0 quiescent Proliferating E2F Target Gene Expression DNA replication, cell cycle control, DNA repair, mitosis Figure 1.2 Rb and E2F regulate Gene expression Following phosphorylation by cyclin dependent kinases (cdk) Rb can no longer bind E2Fs ensuring the proper transition from G1 to S phase of cell cycle. 17 Figure 1.3 E2F: the family portrait. The highly conserved winged-helix DNA binding domain (DBD) is indicated in blue, and the hydrophobic heptad repeat domain required for dimerization is shown in pink. The DBD also appears to contribute to dimerization. Other domains required for associations with cyclin A/cdk2 and Rb family members are also indicated. E2F1- E2F6 all bind DNA as heterodimers with DP family proteins, while E2F7 and E2F8 appear to associate with DNA independent of DP proteins. Note also that mouse homologs of human DP-2 are usually referred to as DP-3, and there are several differentially spliced isoforms of DP2/DP3 (not shown). There are also two known isoforms of E2F7 which differ in their Ctermini (also not shown). Adapted from DeGregory and Johnson, 2006 18 Figure 1.4 Genomic structure of the Survivin locus and splice variants. The Survivin gene is composed of exons 1–4. All identified Survivin isoforms contain exons 1 and 2. Survivin-2B has an extra exon 2B; Survivin-deltaEx3 is missing exon 3; Survivin-3B contains 5 exons including an extra novel exon 3B derived from a 165 bp long portion of intron 3; and Survivin-2a consists of 2 exons (exons 1 and 2) as well as a 30 197 bp region of intron 2. Adapted from Fangusaro et al., 2006 19 Figure 1.5 Structure−function of survivin splice variants. Common features to all splice forms at the amino terminus include the dimer interface and the BIR domain. Survivin-2B differs by the introduction of exon 2B but retains the ORF for the remainder of the C-terminus. The BH2 domain and mitochondrial localization signal of survivin-Ex3 are also indicated. A frameshift occurs in exon 3 of survivin 3B causing a premature stop of the protein with a distinct Cterminus Adapted from Caldas et al., 2005 20 Figure 1.6 Schematic representation of the human inhibitor of apoptosis protein family. In addition to at least one baculoviral IAP repeat (BIR) domain, most IAPs have other distinct functional domains. The really interesting new gene (RING) domain found in many IAPs is an E3 ligase that presumably directs targets to the ubiquitinproteasome degradation system. Caspase-recruitment domains (CARDs) can mediate homotypic protein–protein interactions, although the binding partners for the cellular IAP (cIAP) CARDs have not yet been elucidated. Bruce has a ubiquitin-conjugation (UBC) domain that is found in many ubiquitin-conjugating enzymes. The NACHT domain of neuronal apoptosis-inhibitory protein (NAIP) resembles a nucleotide-oligomerization domain related to the AAA+ NTPases, whereas the leucine-rich repeats (LRRs) are similar to those of the Toll-like receptors that function as pathogen sensors. BIRC, baculoviral IAP-repeat-containing; HIAP, human IAP; IAP, inhibitor of apoptosis protein; ILP, IAPlike protein; KIAP, kidney IAP; MIH, mammalian IAP homologue; ML-IAP, melanoma IAP; NACHT, domain found in NAIP, CIITA, HET-E and TP-1; Ts-IAP, testicular IAP; XIAP, X-linked IAP. Adapted from Eckelman et al., 2006 21 Figure 1.7 Pathways to Apoptosis. Activation of cell death pathways can be initiated through different mechanisms, including through ligand binding (FasL, TNF) to a death receptor on the cell surface (extrinsic pathway) or via direct mitochondrial signaling (intrinsic pathway). The mitochondrial pathway is initiated by activation of the Bax/Bcl-2 pathway leading to the release of apoptotic factors such as cytochrome c (Cyt C) and apoptosis-inducing factor (AIF) from the mitochondrial intermembrane space into the cytoplasm. The release of cytochrome c from mitochondria results in caspase-3 activation through formation of the cytochrome c/Apaf-1/caspase-9 apoptosome complex. Caspase-3 cleaves a number of substrates including cytoskeletal proteins andDNA. Caspase-activated DNase (CAD) and inhibitor of CAD (ICAD) initiate cleavage and fragmentation ofDNA. The Inhibitors of Apoptosis (IAPs) inhibit cell death by physically interacting with caspases. Survivin (SVN) has been shown to inhibit apoptosis through caspase-dependent and independent pathways. Adapted from Fangusaro et al., 2006 22 Figure 1.8 Localization and function of Survivin (and its fellow passenger proteins) during cell division. (a) In (pro)metaphase, Survivin localizes on centromeres and chromosome arms (not visible). During anaphase, Survivin no longer associates with centromeric DNA but binds to the overlapping bundles of antiparallel microtubules of the central spindle that form the midzone. These microtubules bundles become compact and mature into the midbody during telophase and cytokinesis, where Survivin eventually localizes. (b) When localized on centromeres, the CPC, of which Aurora B is the enzymatic core and Survivin an important targeting subunit, executes different functions that are important for proper chromosome alignment and segregation: (i) destabilization of improper kinetochore–microtubule attachments and thereby promoting biorientation; (ii) regulation of BubR1 kinetochore levels; (iii) keeping the spindle checkpoint active in the absence of tension by recreating unattached kinetochores and/or by regulating BubR1 kinetochore levels; and (iv) stabilizing chromosome/kinetochore-induced microtubule formation. (v) When present on the central spindle and midbody, the complex is essential for completion of cytokinesis by phosphorylating several substrates (e.g. MKLP1 and vimentin) involved in midzone and midbody function. Abbreviation: MT, microtubule. Adapted from Lens et al., 2006 23 Figure 1.8 Localization and function of Survivin (and its fellow passenger proteins) during cell division. 24 CHAPTER 2 CLONING AND CHARACTERIZATION OF MOUSE E2F8, A NOVEL MAMMALIAN E2F FAMILY MEMBER CAPABLE OF BLOCKING CELLULAR PROLIFERATION 1 ABSTRACT The E2F transcription factor family plays a crucial and well established role in cell cycle progression. Deregulation of E2F activities in vivo leads to developmental defects and cancer. Based on current evidence in the field, mammalian E2Fs can be functionally categorized into either transcriptional activators (E2F1, E2F2, and E2F3a) or repressors (E2F3b, E2F4, E2F5, E2F6, and E2F7). As part of my thesis, I have identified a novel E2F family member, E2F8, which is conserved in mice and humans and has its counterpart in Arabidopsis thaliana (E2Ls). Interestingly, E2F7 and E2F8 share unique structural features that distinguish them from other mammalian E2F repressor 1 Reproduced with permission from J Biol Chem. 2005 May 6;280(18):18211-20. Epub 2005 Feb 18. Maiti B, Li J, de Bruin A, Gordon F, Timmers C, Opavsky R, Patil K, Tuttle J, Cleghorn W, Leone G. © 2005 by The American Society for Biochemistry and Molecular Biology, Inc. All data were generated by Maiti B, under the supervision of Leone G, except data pertaining to in silico structural analysis and E2F8 co-immunoprecipitation. 25 members, including the presence of two distinct DNA-binding domains and the absence of DP-dimerization, retinoblastoma-binding, and transcriptional activation domains. Similar to E2F7, overexpression of E2F8 significantly slows down the proliferation of primary mouse embryonic fibroblasts. These observations, together with the fact that E2F7 and E2F8 can homodimerize and are expressed in the same adult tissues, suggest that they may have overlapping and perhaps synergistic roles in the control of cellular proliferation. INTRODUCTION The E2F transcription factor family plays a crucial and well established role in the regulation of cellular proliferation differentiation and apoptosis. Although E2Fs can act as transcriptional activators, they can also repress gene expression when bound to the retinoblastoma (Rb) tumor suppressor protein or related pocket proteins (p130 and p107). Rb negatively regulates the E2F transcriptional activity by binding to and masking the transactivation domain of E2F (Helin et al., 1993; Flemington et al., 1993). When bound to E2F, Rb can also directly repress E2F-target genes by recruiting chromatin-remodeling complexes and histone-modifying activities to the promoter (Vandel et al., 2001; Sellers et al., 1995; Luo et al., 1998; Brehm et al., 1998; Zhang et al., 2000; Ferreira et al., 1998; Trouche et al., 1997). During the G1-S transition of the cell cycle, the cyclin-dependent kinases phosphorylate Rb, resulting in the release of 26 E2F from Rb-containing complexes and the expression of E2F-target genes. Many studies indicate E2F as a key mediator of Rb function in cellular proliferation, differentiation, and apoptosis (Dyson, 1998; Nevins, 1998). E2Fs are also regulated at the level of transcription, post-translational modifications, subcellular localization, association of cofactors, and degradation (Nevins et al., 1998; Trimarchi and Lees, 2002). Since the identification of the founder E2F family member, E2F1, six additional family members have been identified. Structurally, E2F1–6 share a highly conserved DNA-binding and dimerization domain. E2F1–6 bind DNAtarget sequences as heterodimers with DP1 or DP2. Although heterodimerization is required for high affinity sequence-specific DNA binding, the specificity of the dimer is determined by the E2F component (Dyson, 1998; Nevins, 1998; Trimarchi and Lees, 2002). The most recently identified E2F family member, E2F7, is unique in having a duplicated conserved E2F-like DNA-binding domain and in lacking a DP-dimerization domain. E2F1–5 possess conserved transactivation and pocket protein-binding domains at the C terminus that are absent in E2F6 and E2F7 (Dyson, 1998; Ren et al, 2002; de Bruin et al, 2003; Di Stefano et al., 2003; Logan et al., 2003). Based on structural and functional considerations, E2Fs have been classified as either “activator” (E2F1, E2F2, and E2F3a) or “repressor” E2Fs (E2F3b, E2F4, E2F5, E2F6, and E2F7). Activator E2Fs are maximally expressed late in G1 and can be found in association with E2F-regulated promoters during the G1-S transition, coinciding with the 27 activation of many E2F-target genes. Mouse embryonic fibroblasts ablated for all of the three activator E2Fs are severely compromised in E2F-target gene expression as well as the capacity to proliferate, underscoring the importance of the activator subclass in cell cycle progression (Wu et al., 2001). In contrast to the activator E2Fs, E2F3b, E2F4, and E2F5 are expressed in quiescent cells and can be found associated with E2F-binding elements on E2F-target promoters during G0 phase (Trimarchi and Lees, 2002; Ren et al., 2002; Leone et al., 1998; Takahashi et al., 2000; Schwede et al., 2003). Among the repressor subclass, E2F6 mediates repression via recruitment of the Polycomb group of proteins or complexes containing Mga and Max proteins (Ogawa et al., 2002; Trimarchi et al., 2001). Although the most recently identified E2F7 protein can function as a repressor independent of DP interaction, its exact mechanism of mediating repression is not understood (de Bruin et al, 2003; Di Stefano et al., 2003; Logan et al., 2003). E2Fs regulate the transcription of a multitude of genes involved in DNA replication, cell cycle regulation, chromatin assembly and condensation, chromosome segregation, DNA repair, and checkpoint control (Dyson, 1998; Nevins, 1998; Trimarchi and Lees, 2002; Ren et al., 2002). Consistent with its role in various important cellular processes, E2Fs are evolutionarily conserved among plants and animals with the exception of yeast. Drosophila melanogaster has two E2F genes named dE2F1, which acts as an activator, and dE2F2, which functions as a repressor. Each of these E2Fs heterodimerize with a single DP 28 protein found in Drosophila called dDP (Stevaux et al., 2002). E2F-like activities have also been found in Xenopus laevis and Caenorhabditis elegans (Ceol et al., 2001; Suzuki et al., 2000). In the plant, Arabidopsis thaliana, six E2Fs (AtE2Fa-f) and two DPs (AtDPa-b) have been described. Of these, AtE2Fa-c are reminiscent of the mammalian activator E2F1–3a subclass and E2Fd-f resemble the recently discovered E2F7 in that they possess a duplicated DNA-binding domain and exhibit repressor function. Besides human and mouse, Arabidopsis is the only other species where E2Fs with duplicated DNA-binding domain have been described (Mariconti et al., 2002; Kosugi et al., 2002). As a primary focus if my thesis project, I have identified and characterized another mouse E2F family member called E2F8, which closely resembles E2F7. E2F8 is expressed in a cell cycle regulated fashion, has duplicated DNA-binding domains that are essential for binding to consensus E2F-binding DNA elements, represses E2F-target genes, and negatively influences cellular proliferation. MATERIALS AND METHODS Cloning of the E2F8 cDNA—The mouse testis cDNA library (Origene) was screened using the primer pairs 5’-AGTACCCCAACCCTGCTGTGAATA- 3’/5’GGACTTGTCTTTGCGGCTGTTTAC-3’ and 5’ CCGGCACAACCTCACCAAAAC3’/5’-TCCCCCGCGTAGAGAAGAGG-3’. Each primer pair resulted in a single sharp band in three wells that were positive in 96-wells of the master plate. 29 Subsequently, I screened the subplates to obtain the clone with the full-length E2F8 cDNA. A 5XMyc tag was subcloned in between the BamH1 and EcoR1 sites of the pcDNA3.1/HisB (Invitrogen) vector in-frame with the His6 tag. Next the 2583-bp open reading frame of E2F8 was subcloned in frame with the His and Myc tags, thus generating a construct with full-length E2F8 ORF tagged with His6 and 5X Myc tag at the N terminus. Generation of Mouse Embryonic Fibroblasts and in Vitro Cell Culture— Primary mouse embryonic fibroblasts (MEFs) were generated using standard techniques as described before (Wu et al., 2001). All of the cell lines were grown in DMEM with 15% FBS. Cells were starved in DMEM containing 0.2% FBS when they were ~70% confluent. After starving for 48–60 h, they were stimulated to grow with DMEM containing 15% FBS. Cells were harvested at different time points after serum stimulation for BrdUrd incorporation assay, Northern blot assay, and realtime RT-PCR. BrdUrd Incorporation Assay—BrdUrd was added to the medium, and cells were incubated with BrdUrd for 2 h being harvested and fixed in methanol/acetone 1:1. Cells were stained in 35-mm dishes with anti- BrdUrd primary antibody (NA-61 from Oncogene) and anti-mouse rhodamine secondary antibody and counterstained with 4’,6-diamidino-2- phenylindole (DAPI). At least 400 cells/35 mm plate were counted. Northern Blot Assay—For the cell cycle Northern Blot analysis, total RNA was isolated from MEFs using TRIzol (Invitrogen) and mRNA was subsequently 30 purified using PolyATract mRNA isolation system (Promega). Poly(A) mRNA was separated on a 1% agarose gel containing 6% formaldehyde and transferred onto a GeneScreen membrane (PerkinElmer Life Sciences). The mouse tissue Northern blot was purchased from Origene. The 3’ 1850 bp of the E2F8 cDNA including the 3_-untranslated region (UTR) was used as a probe for both Northern blot analyses. The probe was radiolabeled with 50 μCi of [α-32P]dCTP using Prime-It RmT (Stratagene). Hybridization was carried on overnight under high stringency conditions (5X saline/ sodium phosphate/EDTA, 50% formamide, 5X Denhardt’s solution, 1% SDS at 42 °C) and washed several times (0.2X SSC, 0.2% SDS at 65 °C) before autoradiography. Real-time RT-PCR—Approximately 1X106 cells were harvested at the indicated time point, and total RNA was isolated using the Qiagen RNA Miniprep column as described by the manufacturer, including a DNase treatment before elution from the column. Reverse transcription of 2 μg of total RNA was performed by combining 1 μl of Superscript III reverse transcriptase (Invitrogen), 4 μl of 10X buffer, 0.5 μl of 100 mM oligo(dT) primer, 0.5 μl of 25 mM dNTPs, 1.0 μl of 0.1 M dithiothreitol, 1.0 μl of RNase inhibitor (Roche Applied Science), and water up to a volume of 20 μl. Reactions were incubated at 50 °C for 60 min and then diluted 5-fold with 80 μl of water. Real-time RT-PCR was performed using the Bio-Rad iCycler PCR machine. Each PCR reaction contained 0.5 μl of cDNA template and primers at a concentration of 100 nM in a final volume of 25 μl of SYBR Green reaction mixture (Bio-Rad). Each PCR reaction generated only the 31 expected amplicon as shown by the melting-temperature profiles of the final products and by gel electrophoresis. Standard curves were performed using cDNA to determine the linear range and PCR efficiency of each primer pair. Reactions were done in triplicate, and relative amounts of cDNA were normalized to GAPDH. The sequences of the primer pair used for the E2F8 cDNA were 5’ CCGGCACAACCTCACCAAAAC-3’ and 5’-TCCCCCGCGTAGAGAAGAGG- 3’. Primer sequences of the E2F-target genes are available upon request. 5’-RACE PCR—Total RNA was isolated from wild-type primary MEFs and mouse thymus, and the mouse testis cDNA was purchased in the Marathon Ready cDNA kit (Clontech). cDNA was prepared, and 5’-RACE PCR was performed using the BD SMART RACE cDNA amplification kit (BD Biosciences) following the manufacturer’s protocol. The reverse primer used for 5’-RACE PCR was 5’-TCACGCGTAAGGACTTGTCTTTGC- 3’ mapping to the exon 6 of E2F8 gene, and the nested primer was 5’ CGTCCCGAGGGTTTTGGTGAGGTT-3’ located in the exon 5 of the E2F8 gene. The products of 5’-RACE PCR were cloned using the TOPO TA cloning kit for sequencing (Invitrogen). At least 20 colonies from each tissue type were sequenced. Luciferase Reporter Assay—A 3.5-kb promoter fragment was isolated from the BAC clone RPCI 24-294G9 and subcloned into pBluescript vector. The primer pair used for amplifying the long promoter (LP) fragment was 5’ GAGAGAGGTACCGTCCTCCAACCCCTCGTTTG-3’ and 5’ AGAGAGAAGCTTGCTGAAGTTTCTCGCCTGACAC-3_ and that for amplifying 32 the short promoter (SP) fragment was 5’ GAGAGAGGTACCAGCTCTGAAGGAGGATTGACAGG- 3’ and 5’AGAGAGAAGCTTGCTGAAGTTTCTCGCCTGACAC- 3’. The amplified fragments were subcloned into the pGL2Basic vector using the HindIII and KpnI restriction sites. The two E2F-binding consensus sites in the E2F8 promoter fragment were mutated using the QuikChange site-directed mutagenesis kit as described by the manufacturer. All of the constructs were confirmed by sequencing. Subconfluent REF52 cells grown in triplicates were transfected using the Superfect reagent (Qiagen). The cells were transfected with the firefly luciferase expression vectors and thymidine kinase (TK) Renilla luciferase as internal control. The cells then were serum-starved in DMEM containing 0.2% FBS for 48 h and stimulated to enter the cell cycle by DMEM containing 15% FBS. Cells were harvested at the indicated time points, and luciferase was detected by the Dual-Luciferase reporter assay system (Promega). Western Blot Analysis—Cell protein lysates were separated in SDS polyacrylamide gels and transferred to polyvinylidene fluoride membranes. Blots were first incubated in blocking buffer (10% skim milk in Tris-buffered saline plus Tween 20) for 1 h and subsequently incubated overnight in blocking buffer containing the antibody specific for Myc tag 9E10 (Santa Cruz Biotechnology, SC-40). The primary antibody was then detected using horseradish-peroxidase conjugated secondary antibody and ECL reagent as described by the manufacturer (Amersham Biosciences). Immunofluorescence—MEFs were 33 grown in 35-mm dishes and transfected with His-Myc-tagged E2F8 or control vector. The cells were fixed with 4% paraformaldehyde and methanol/acetone (1:1). The Myc antibody 9E10 was the primary antibody used, and rhodamineconjugated anti-mouse IgG (Vector Laboratories) was used as the secondary. The cells were counterstained with DAPI. The procedure for the staining was same as described before (de Bruin et al., 2003). Electromobility Shift Assay for DNA Binding—The probe used for the DNA binding assay was a fragment of the adenoviral E2 promoter containing two E2F binding sites. The complimentary strands of the probes were biotinylated on the 5’ end and were annealed together to make a double-stranded probe end labeled with biotin. The sequence of the wild-type probe was 5’ TCGAGACGTAGTTTTCGCGCTTAAATTTGAGAAAGGGCGCGAAACTAGTC TTAACTCGA- 3’, and that of the mutated probe was 5’ TCGAGACGTAGTTTTAAGGCTTAAATTTGAGAAAGGGCTTGAAACTAGTCC TAACTCGA- 3’. The binding reaction was carried out in a 20-μl volume using 40 fmol of biotinylated probe and 8 pmol of non-biotinylated wild-type or mutated probe as and when required. The binding conditions were the same as described previously (Logan et al., 2004). The supershift analysis was carried out as previously described using an antibody specific against Myc (Santa Cruz Biotechnology, SC-40). Proteins were translated using the TNT Quick Coupled transcription/translation system (Promega). After carrying out the binding reaction at 30 °C for 30 min, Ficoll was added to it to a final concentration of 4% and it 34 was separated on a 4% polyacrylamide gel. After running the gel, it was transferred to Hybond N+ membrane (Amersham Biosciences) and UV-crosslinked. It then was probed using the LightShiftTM chemiluminescent EMSA kit (Pierce) following the manufacturer’s protocol. The chemiluminescence was detected on Hyperfilm (Amersham Biosciences). Site-directed Mutagenesis of the DNA-binding Domains—Site-directed mutagenesis was carried out using the QuikChange site-directed mutagenesis kit following the manufacturer’s protocol. We used the following primers for DBD1, 5’-CGGAAGGAGAAGAGCGAATTCTTGCTATGCCACAAA- 3’ and 5’ TTTGTGGCATAGCAAGAATTCGCTCTTCTCCTTCCG- 3’, and the following primers for DBD2, 5’-CGCAAAGACAAGTCCGAATTCGTGATGAGCCAGAAG3’ and 5’ -CTTCTGGCTCATCACGAATTCGGACTTGTCTTTGCG- 3’. Structural Analysis—Sequence alignments of the E2F8 DNA-binding domains by the ClustalW method were used to generate models for E2F8 DNA binding (Schwede et al., 2003). Modeling requests were submitted to the SWISSMODEL protein modeling server using the previously solved E2F4/DP2 crystal structure Protein Data Bank file (1CF7) as the template. Co-immunoprecipitation—Transiently transfected 293 cells were harvested in cold phosphate-buffered saline, and cell pellets were lysed in 10X volume of lysis buffer (0.05 M sodium phosphate, pH 7.3, 0.3 M NaCl, 0.1% Nonidet P-40, 10% glycerol with protease inhibitor mixture). Lysates were incubated with Protein G Plus/protein A-agarose beads (Calbiochem) at 4 °C for 35 1 h to preclear. The precleared lysates were incubated with appropriate antibody overnight. Protein G Plus/ protein A-agarose beads were added and incubated for 1 h at 4 °C. Protein binding to the beads were released and resolved by SDSPAGE followed by immunoblotting. Immunoprecipitation and Immunoblotting were performed using M2 monoclonal anti-FLAG (Sigma), anti-HA (Roche Applied Science), anti-Myc 9E10 antibodies. Retroviral Infection—Full-length cDNAs for His-Myc-tagged E2F8 was subcloned into the pBABE retroviral vector containing a hygromycin- resistance gene. High-titer retroviruses were produced by transient transfection of retroviral constructs into the Phoenix-Eco packaging cell line as described previously (Pear et al., 1993). MEFs were infected with the retrovirus using standard methods and were selected in the presence of 200 μg ml-1 hygromycin. Proliferation Assay—MEFs were plated at 4 X 104 cells/60-mm plate and grown in DMEM with 15% FBS. Duplicate plates were counted daily using a BD Biosciences Coulter counter and were replated every 72 h at the same density of the initial plating. RESULTS Identification and Cloning of Mouse E2F8— I performed a homology search across the sequenced mouse genome (Celera and GenBankTM databases) using the E2F3 DBD amino acid sequence as the reference. The 36 search retrieved the known E2Fs (E2F1–7) and a potentially novel E2F gene, which we named E2F8. The in silico predicted E2F8 protein (Celera and GenBankTM databases) possessed two E2F-like DBDs but shared no homology to any other known domains conserved across the E2F family members. I also performed a BLASTN (www.ncbi.nlm.nih.gov/BLAST/) search using the predicted E2F8 transcript as a query. The search recovered several mouse expressed sequence tags from a variety of mouse tissues and developmental stages (UniGene Cluster Mm.240566). Using E2F8-specific primers, I screened the mouse testis Cdna library (Origene Technologies Inc.) and retrieved the fulllength mouse E2F8 cDNA clone. Analysis using the University of California Southern California Genome Browser BLAT tool (Kent, 2002) revealed that the mouse E2F8 gene is located on chromosome 7 and contains 13exons separated by 12 introns (Figure 2.1A). I sequenced a BAC clone containing the E2F8 gene to determine the sequences across the splice junctions. From 5’ to 3’ end of the gene, the 12 splice sites have the universal consensus splice junction dinucleotides GT/AG. The first initiation ATG, as predicted by the presence of a Kozak consensus sequence and an in-frame termination codon, is in exon 2, and the stop codon TGA are in exon 13, giving rise to a 2583-bp open reading frame encoding 860 amino acids (Figure 2.1B). E2F8 mRNA has a 300-bp long 5’-UTR and a 587-bp long 3’-UTR. There are two consensus polyadenylation signals, AATAAA and ATTAAA, that are 327 and 238 bp upstream of the poly(A) tail, 37 respectively. The polyadenylation signal that is relevant in this particular clone is the non-canonical polyadenylation signal TATAAA located 18 bases upstream of the poly(A) tail (Beaudoing et al., 2000). E2F8 Protein Characteristics and Homology with the Other E2Fs—The E2F8 protein consists of 860 amino acids with a predicted molecular mass of ~95 kDa. It has two E2F-like DBDs and three putative nuclear localization signals (Figure 2.1C and Figure 2.1D). The presence of two E2F-like DBDs is reminiscent of the mammalian E2F7 and Arabidopsis E2Fd-f. The alignment of the DBDs of mouse E2F1–8 and Arabidopsis E2Fd using the ClustalW program shows high homology with notable conservation of the RRXYDI DNA recognition motif (Figure 2.2A). Despite significant homology in the duplicated DBD, E2F8 is devoid of any other E2F-like domains including the pocket protein binding, transactivation, and DP dimerization domains, a characteristic shared by mammalian E2F7 and Arabidopsis E2Fd-f proteins (Figure 2.2C). Phylogenetically, the DBDs of Arabidopsis E2Fd-f and mouse E2F7 and E2F8 cluster together (Figure 2.2B). Significantly, when the full-length mouse E2F proteins were analyzed for evolutionary relationship on the basis of their primary structure, a segregation pattern that is reflective of their known functional characteristics was observed. The acquisition of additional E2Fs may stem from a developmental requirement for E2F activity in multiple different tissues as organisms evolve to be structurally and functionally more complex down the path of evolution (Figure 2.2D). 38 E2F8 Expression Pattern in Tissues and over the Cell Cycle— As a first step toward the understanding of E2F8 function, I investigated its tissue and cell cycle expression patterns. A 3’~2500-bp fragment of E2F8 cDNA, which lacked any significant sequence overlap with any of the other known E2Fs, was used to probe tissue-specific Northern blots. E2F8 was highly expressed in the liver, skin, thymus, and testis but not in the brain, muscle, and stomach (Figure 2.3A). Interestingly, this pattern of expression is almost identical to that previously found for E2F7, giving rise to the possibility that E2F7 and E2F8 may have overlapping or complementary functions in these organs. As discussed above, the known E2F family members fall into two distinct categories with regard to their patterns of expression during the cell cycle. Consistent with their function, the expression of the activator subclass (E2F1, E2F2, and E2F3a) is maximal as cells enter the cell cycle, whereas the expression of the repressor subclass (E2F3b, E2F4, and E2F5) remains unchanged throughout all of the cell cycle. To determine whether the expression of E2F8 is cell cycle-dependent, E2F8 mRNA levels were measured by Northern blot and real-time RT-PCR analysis in synchronized and cycling populations of primary MEFs. MEFs were synchronized in quiescence (G0) by starvation in medium containing 0.2% FBS for 48 h and then stimulated by the addition of medium containing 15% FBS. RNA was isolated from cells harvested at different time points following serum stimulation. Poly(A) mRNA was purified and subjected to denaturing electrophoresis as described under “Materials and 39 Methods,” transferred to membrane, and hybridized to an E2F8-specific radioactive-labeled probe (Figure 2.3B). Both the Northern blot and the real-time RT-PCR analyses suggest that E2F8 expression is cell growth-dependent with maximal expression levels found during S phase (Figure 2.3C). The seruminduced activation of E2F8 expression was mild when compared with the activation of Cdc6 expression, which is a well established cell cycle-regulated E2F-target gene. This mild induction in E2F8 expression was not simply a consequence of an inability of primary MEFs to respond to serum, because E2F8 expression was also poorly induced in p53 mutant MEFs, which can be efficiently induced to enter the cell cycle in response to serum addition. Regulation of the E2F8 Promoter—To understand the basis of E2F8 tissue-specific and cell growth-dependent expression patterns and to confirm its transcriptional start site, the genuine 5’ end of the E2F8 geneI used 5’-RACE PCR with mRNA isolated from the adult mouse thymus, testis, and primary MEFs. Approximately 20 clones were analyzed from each tissue type, revealing the presence of three alternative first exons (Figure 2.4A, exons 1a, 1b, and 1c). As a reference, the first nucleotide of exon 1b was labeled as +1. All of the three alternative first exons spliced precisely to the common exon 2, which contains the ATG of the full-length E2F8 open reading frame. The universal splice junction dinucleotide GT/AG was present in each of the alternative first exons. The usage of either exon 1a or 1b preserved the full-length open reading frame of E2F8. The usage of exon 1c introduced two short ORFs preceding the ATG of the full- 40 length E2F8 ORF, which could potentially produce proteins of 98 and 30 amino acids long. However, none of these ATGs fulfilled the Kozak criteria for efficient initiation of translational and is most likely not used as initiating codons. Hence, the ATG located toward the 5’ end of exon 2, which contains a perfect Kozak sequence, is predicted to represent the translational start site for the full-length E2F8 ORF. The usage of the three alternative exons, 1a, 1b, or 1c, gives rise to the same full-length ORF. To investigate the transcriptional regulation of E2F8 gene expression, we analyzed the putative E2F8 promoter region for the presence of consensusbinding sites of different transacting factors. Because E2Fs are known to be auto-regulated, it was not surprising to find two canonical E2F-binding elements (a and b) at positions +257 and +385. I cloned a ~2.9-kb genomic fragment containing the -1993 to +855 region of the E2F8 gene into a firefly-luciferase transcriptional reporter plasmid and called this construct LP. A second E2F8 genomic fragment extending from +166 to +855 bp, which represents the most proximal sequence near exon 1c (Figure 2.4A), was also cloned into the fireflyluciferase reporter plasmid, which we called the SP. I tested the promoter activity of these constructs in REF52 cells using the TK promoter-driven Renilla luciferase plasmid as an internal control for Transfection efficiencies. Since both the reporter constructs contained the E2F DNA binding elements a and b, I determined whether these constructs were responsive to the overexpression of E2F1, an activator of E2F. As expected, E2F1 overexpression 41 led to a dose-dependent activation of luciferase activity from either the LP or SP reporter construct (Figure 2.4B). Thus, I hypothesized that the observed growthdependent expression of E2F8 could be the result of an E2F autoregulatory loop mediated via these putative E2F-binding elements. To test this hypothesis, I analyzed the transcriptional activity of these reporter constructs in synchronized REF52 cell populations. The reporter constructs were transfected in REF52 cells and serum-starved them in medium containing 0.2% FBS for 60 h in order to synchronize them in G0 and then re-stimulated the cells with medium containing 15% FBS. As expected, the expression from both the SP and LP constructs was significantly increased in the18-h re-stimulated samples, indicating that the cell growth regulation of E2F8 is, at least in part, transcriptional in nature (Figure 2.4C). To assess the role of the two consensus E2F-binding elements in regulating the expression of E2F8, I mutated both the E2F-binding elements, a and b, in the SP reporter construct (SP*ab) and re-assessed their promoter activity in E2F1-overexpressing cells. As shown in Figure 2.4E, the mutation of the two E2F DNA recognition sites reduced but did not completely eliminate the E2F responsiveness of these reporters, indicating that additional non-consensus E2Ftarget sites must also mediate their E2F responsiveness. To determine whether these consensus E2F sites played a role in the growth regulation of E2F8, I analyzed the activity of both the wild-type (SP) and mutant SP reporter constructs (SP*b) in quiescent REF52 cells. Mutation of site b (SP*b) led to a small but reproducible 2-fold increase in reporter expression, indicating that E2F8 42 expression in quiescent cells is likely repressed through an E2F-dependent mechanism (Figure 2.4D). Although the expression of E2F8 is likely to be complex, the above data suggest that the E2F-binding sites contribute to the positive and negative regulation of its expression during the cell cycle. Subcellular Localization and DNA Binding Activity of E2F8—To gain insight into the possible function of the E2F8 protein product, I overexpressed a Myc-tagged version of the murine E2F8 protein (Myc-E2F8) in MEFs and assessed its effect on cellular proliferation. Western blot analysis of Myc- E2F8transfected cell lysates using Myc epitope-specific antibodies (9E10) revealed a protein product that migrated in SDSPAGE with a mobility of ~115 kDa. Two additional Myc-E2F8- specific products of ~110 and 82 kDa were also evident in these lysates and probably represent degradation cleavage productsof the fulllength protein (Figure 2.5A). Consistent with the presence of three potential nuclear localization signals, Immunofluorescence microscopy using anti-Myc epitope antibodies revealed Myc-E2F8 to be completely localized to the nucleus (Figure 2.5B). All of the known E2F family members possess a highly conserved E2F DNA-binding domain that can mediate specific binding to consensus E2F DNAbinding elements. The ability of in vitro translated Myc-E2F8 to bind the adenoviral E2 promoter fragment containing two intact E2F-binding sites was tested by EMSA. As shown in Figure 2.5C, in vitro translated Myc-E2F8 bound specifically to the E2 probe as indicated by the appearance of two distinct bands 43 that were both supershifted with anti-Myc antibodies. In vitro translated MycE2F3/DP1 served as a positive control, and in vitro translated luciferase protein served as a negative control for DNA binding activity. The binding of E2F8 to the E2 probe was demonstrated to be specific, because the binding could be efficiently competed with an excess unlabeled E2 probe but not with an excess of a mutant E2 probe containing a 2-bp substitution within the E2F-binding consensus site. Similar to Arabidopsis E2Fd-f and mammalian E2F7, E2F8 contains two DBDs (referred to as DBD1 and DBD2 from N to the C terminus). This domain arrangement is identical to the recently described E2F7 protein, which binds DNA independently of DP (Logan et al., 2004). Given this similarity and the high degree of homology between E2F and DP DNA-binding domains, we tested whether modeling of E2F8 would allow the DNA-binding domains to adopt a structure homologous to E2F/DP binding as determined from the crystal structure of the E2F4/DP2 heterodimer (Zheng et al, 1999). Sequence alignments by the ClustalW method and through the SWISS-MODEL server showed that DBD2 has a higher sequence homology to the DP DNA-binding domain than DBD1. Based upon conservation of the residues involved in heterodimerization and the binding of the E2F DNA consensus sequence, we were able to model E2F8 binding to DNA with DBD2 adopting the structure of the DP binding partner. Our in silico analysis and model for DNA binding suggest that E2F8 binds DNA with DBD1 in 44 the position of the E2F binding partner and DBD2 in the position of the DP binding partner (Figure 2.5E). To determine whether each domain directly contributes to E2F8 DNA binding activity, point mutations were introduced in DBD1, DBD2, or both DBD1 and DBD2 (DBD1–2) that are predicted to disrupt DNA binding activity. The conserved leucine 118 and glycine 119 in DBD1 and leucine 266 and arginine 267 in DBD2 were replaced with glutamate and phenylalanine, respectively (Figure 2.5E). These leucines contribute to the dimerization interface of the DNAbinding domains and are conserved across all of the E2F family members as shown in Figure 2.2A. In E2F1, the corresponding conserved leucine at position 132 is thought to make important heterodimerization contacts with DP and its mutation abrogates DNA binding activity (Zheng et al., 1999; Johnson et al., 1993). Disruption of these two amino acids in DBD1 or DBD2 of E2F8 completely abrogated its DNA binding capacity, indicating that the integrity of both of the DBDs of E2F8 is important for its DNA binding function (Figure 2.5D). These observations are consistent with our modeling of E2F8, which indicates that DNA binding is dependent upon dimerization interactions at both interfaces of DBD1 and DBD2 (Figure 2.5E) (Logan et al., 2004; Kosugi et al., 2002). E2F8 Forms Homodimers—Previous work from LaThangue’s group demonstrated that the related E2F7 family member can form homodimers (Logan et al., 2004). To test the possibility that E2F8 could also oligomerize, FLAGtagged E2F8 and HA-tagged E2F8 were exogenously expressed in the 293 cells 45 and their ability to interact with each other by immunoprecipitation and immunoblotting using anti-FLAG or anti-HA antibodies. To rule out any nonspecific antibody interactions, singly transfected cells were also immunoprecipitated with either FLAG-E2F8 or HA-E2F8 as controls (Figure 2.6A). In this analysis, HA-tagged E2F8 could be detected in the anti-FLAG immunoprecipitates derived from the doubly transfected cells but not from the singly transfected HA-tagged E2F8 samples. Likewise, FLAG-tagged E2F8 could be detected in the HA immunoprecipitates from doubly but not singly transfected samples. These data indicate that E2F8 can indeed form oligomers. These findings raise the possibility that the inability of the E2F8 DBD mutants to bind to E2F consensus sites could be due to the disruption of E2F8 oligomerization. Co-immunoprecipitation assays demonstrated that the single (DBD1 or DBD2) or double (DBD1–2) DBD mutants of E2F8 still retained the capacity to oligomerize (Figure 2.6B and data not shown). These results demonstrate that oligomerization of E2F8 is independent of its DNA binding activity. E2F8 Overexpression Blocks Cellular Proliferation—E2Fs are thought to be critical players in orchestrating the control of cellular proliferation. To determine the potential role of E2F8 in the control of cellular proliferation, E2F8 was overexpressed in MEFs and proliferation was monitored over a period of 7 days. To this end, primary MEFs were infected with retroviruses expressing MycE2F8 and transduced cells were selected for 48 h in hygromycin. Cells were then 46 plated in medium containing 15% FBS, and viable cells were harvested and counted every 24 h over a period of 7 days. Relative to control-treated cells, MEFs over-expressing Myc-E2F8 proliferated considerably slower (Figure 2.7A). Consistent with the observed growth retardation, the expression of E2F-target genes in synchronized populations of Myc-E2F8-overexpressing cells was significantly reduced (Figure 2.7B). Whether the inhibition of E2F-target gene expression is a direct or indirect effect of E2F8 over-expression remains to be determined. DISCUSSION The E2F family members play important roles in cellular proliferation, apoptosis, and differentiation in both Rb-dependent and independent manners. E2F activities have been described in the vast majority of eukaryotes studied, ranging from plants to mammals, with the exception of yeast. Mammals have seven distinct E2F genes with some family members encoding multiple related isoforms through differential promoter usage or alternative splicing. The identification of yet another mammalian E2F family member, E2F8, provides further complexity to the E2F family of transcription factors. Interestingly, E2F8 has the distinctive feature of possessing two tandem DBDs. However, other than within these E2F-like DBDs, there is little amino acid sequence conservation between E2F8 and the other E2Fs. 47 E2F8 is an E2F member based on the presence of conserved DNAbinding domains and its ability to bind to E2F consensus sites found in many E2F-regulated promoters. Structure modeling predicts that the duplicated DBDs of E2F8 can interact with each other to form a functional DNA binding unit, thus alleviating the requirement to interact with DP. Interestingly, this modeling predicts that the key conserved leucine residues, which are important for the interaction between the DBDs of the E2F and DP heterodimers, are also important for the intramolecular interactions between DBD1 and DBD2. This prediction is supported by our data demonstrating that introduction of point mutations at this conserved leucine residue in either of the E2F8 DBDs abrogates DNA binding activity. Co-immunoprecipitation assays demonstrate that E2F8, like E2F7, can form homodimers, suggesting that these two unique E2Fs could potentially form contacts with multiple consensus E2F sites at once. E2F7 and E2F8 share a number of characteristics that could reflect their unique function. Each is expressed in a cell growth-dependent manner with peak levels found during S phase and is expressed in the same adult tissues of mice. Both have the ability to homodimerize and to repress E2F-dependent gene expression. Importantly, their overexpression can lead to a pronounced decreas in the proliferative capacity of cells. These observations have led to the hypothesis that these two E2F family members may have overlapping and/or synergistic functions in the control of cellular proliferation. Although the identification of E2F8 adds further complexity to the E2F family of transcription 48 factors, our findings begin to place E2F members into distinct subclasses that have general structural and functional themes that might be used to differentially regulate cellular proliferation. Acknowledgment—We thank Charles Bell for advice in modeling E2F8 structure. 49 Figure 2.1 Structure of mouse E2F8 gene, mRNA, and protein. A, schematic representation of the E2F8 genomic locus on the Mus musculus chromosome 7. The 13 exons are represented by boxes, and the intronic regions are represented by lines. The lengths of the introns and exons are indicated. B, structure of the E2F8 mRNA. The ORF extends from 301 to 2883 base pairs. The 5'- and 3'-untranslated regions are shaded light gray. The polyadenylation signals are represented by arrows in the 3'UTR. C, schematic diagram of full-length E2F8 protein. The nuclear localization signals (NLS) and the DBDs as predicted by in silico analysis are indicated, and the amino acid positions are indicated within parentheses. D, amino acid sequence of fulllength E2F8 protein. From the N terminus to the C terminus, the DBDs are named DBD1 and DBD2 and are indicated by boldface letters in the primary structure of full-length E2F8 protein. 50 Figure 2.1 Structure of mouse E2F8 gene, mRNA, and protein. 51 Figure 2.2 Comparative analysis of E2F8 and other known E2F and DP family members. A, sequence alignment of the DBDs of mouse E2F1–8 (represented as mE2F1–8), mouse DP1–2 (represented as mDP1– 2), and A. thaliana E2Fd (AtE2Fd) using the ClustalW program. The conserved RRXYD motif that makes DNA base contacts is indicated with a line. The amino acids Leu-Gly in mE2F8 DBD1 and Leu-Arg in mE2F8 DBD2 are marked with asterisks, indicating that these amino acids when mutated to Glu and Phe abolished DNA binding of E2F8 as shown later in Fig. 5d. Conserved amino acids are shaded yellow. B, phylogenetic relationship of the DBD amino acid sequences among E2F8, the E2F/DP family in mouse, and E2Fd-f of A. thaliana (phenogram). The length of each horizontal line represents the evolutionary distance between branching points, whereas the units at the bottom of the tree indicate the number of substitution events. The dotted line on the phenogram indicates a negative branch length. C, schematic representation of the domain structure of full-length E2F1–8 proteins. The domains indicated are N-terminaldomain (NTD), DBD, leucine zipper (LZ), marked (Marked), Rb binding (Rb bind), and transactivation domains. D, phylogenetic relationship of the full-length amino acid sequences between murine E2F1 and E2F8 (phenogram). The length of each horizontal line represents the evolutionary distance between branching points, whereas the units at the bottom of the tree indicate the number of substitution events. The dotted line on the phenogram indicates a negative branch length. 52 Figure 2.2 Comparative analysis of E2F8 and other known E2F and DP family members. 53 Figure 2.3 Tissue-specific and cell cycle-dependent expression of E2F8. A, mouse tissue blot from Origene was either hybridized with an E2F8-specific probe or a -actin probe as a loading control. B, primary MEFs were brought to quiescence by serum starvation and stimulated to proliferate by the addition of fresh medium with 15% serum. Cells were harvested for RNA at 0, 12, 18, and 24 h after serum stimulation as indicated, and Northern blot analysis was performed as described under "Materials and Methods." The membrane was probed with E2F8-specific probe or with GAPDH probe as a loading control. C, primary MEFs or p53-/- MEFs were brought to quiescence by serum starvation and stimulated to proliferate by the addition of 15% FBS containing medium. Cells were harvested for RNA at 0, 9, 12, 15, 18, 21, and 24 h after serum stimulation, and real-time RT-PCR was performed with primers for E2F8 and Cdc6 as described under "Materials and Methods." Real-time RT-PCR for GAPDH was done to standardize the amount of cDNA in each sample. Cells treated identically were harvested for BrdUrd incorporation. BrdUrd was added to the medium 3 h before harvesting. Cells were stained with anti-BrdUrd antibody with DAPI counterstaining, and BrdUrd-positive cells were counted as described under "Materials and Methods." 54 Figure 2.3 Tissue-specific and cell cycle-dependent expression of E2F8. 55 Figure 2.4 Regulation of E2F8 promoter. A, schematic representation of the E2F8 promoter region and that of the luciferase reporter constructs, SP and LP. Alternative first exons, 1a, 1b, and 1c, are shown, and their positions relative to each other are indicated. The two E2Fbinding DNA elements (a and b) are shown between the exons 1b and 1c and the mutations introduced therein are indicated. B, induction of luciferase activity of SP and LP constructs by transient transfection of 50 and 150 ng of E2F1 or the control vector in REF52 cells. Proliferating cells were transfected and brought to quiescence by serum starvation before harvesting for measuring luciferase activity as described under "Materials and Methods." TK promoter driven Renilla luciferase reporter construct was used as a control for transfection efficiencies. Each experiment was done in triplicates, and the results were reproduced at least three times. C, REF52 cells transiently transfected with SP or LP constructs were brought to quiescence and stimulated to grow by adding 15% FBS-containing medium. Cells were harvested 0 and 18 h after serum stimulation, and luciferase activity was measured. D, REF52 cells transiently transfected with SP or SP*b (SP with b elements mutated) construct were brought to quiescence, and luciferase activity measured. E, fold induction of luciferase activity by 150 or 1500 ng of E2F1 or the control vector was measured in lysates from REF52 cell transfected with SP or SP*ab (SP construct mutated for both the E2F-binding elements, a and b). 56 Figure 2.4 Regulation of E2F8 promoter. 57 Figure 2.5 Subcellular localization and DNA binding activity of E2F8. A, Western blot analysis of lysates from MEFs transiently transfected with Myc-tagged E2F8 or the control vector. Myc-8specific products are indicated by arrows. B, MEFs transiently transfected with Myc-tagged E2F8 or the control vector were stained with anti-Myc antibody and counterstained with DAPI, showing that Myc-tagged E2F8 is nuclearly localized. C, EMSA was performed with biotin-labeled adenoviral E2 promoter fragment and in vitro translated Myc-tagged E2F8 protein (Myc8, indicated by black arrows). In vitro translated luciferase was used as a negative control, and Myc-tagged E2F3a (Myc-3a) and DP1 (indicated by white arrows) were used as a positive control. The binding resulted in two new bands (indicated by a black or white arrow), which were supershifted using the antiMyc antibody or competed out using non-biotinylated "cold" competitor (cc). The cold competitor (cc*) point-mutated at the E2F-binding elements was unable to compete out the binding indicating sequence-specific interaction. D, in vitro translated E2F8 point-mutated at DBD1 (Myc-8-DBD1) or DBD2 (Myc-8DBD2) or DBD1 and DBD2 (Myc-8-DBD1–2) was unable to bind the biotin end-labeled E2 promoter fragment. In vitro translated Myc-tagged wild-type E2F8 (Myc-8) was used as a positive control, and luciferase was used as a negative control. E, structural model for DNA binding by E2F8. Left, the crystal structure of the E2F4/DP2 heterodimer with E2F4 (pink) and DP2 (teal) bound to an E2F DNA consensus sequence is shown (Protein Data Bank code 1CF7) (31). Right, our structural model based on homology modeling with the solved structure for the E2F4/DP2 heterodimer illustrating interactions between DBD1 (gold) and DBD2 (blue) during DNA binding by E2F8. Below, the boxed dimerization interfaces between DBDs 1 and 2 are enlarged to illustrate the protein regions that make conserved dimerization contacts. The amino acid side chains that were mutated for EMSA and co-immunoprecipitation experiments are highlighted in red and blue for DBD1 and DBD2, respectively. 58 Figure 2.5 Subcellular localization and DNA binding activity of E2F8. 59 Figure 2.6 E2F8 can homodimerize. A, lysates from 293 cells transfected with both HA-tagged E2F8 (HA-8) and FLAG-tagged E2F8 (Flag-8) were coimmunoprecipitated (IP) using anti-FLAG antibody and immunoblotted (IB) with anti-HA antibody or vice versa. Singly transfected 293 cell lysates with either FLAG-E2F8 or HA-E2F8 were used as negative control to rule out any nonspecific antibody interactions. B, Myc-8 and Flag-8 were co-transfected in 293 cells. Lysates were immunoprecipitated with anti-FLAG antibody and immunoblotted with anti-Myc antibody. This was repeated with lysates from Myc-E2F8 and FLAG-E2F8 with DNA-binding domains 1 and 2 mutated (Myc-8-DBD1–2 and Flag-8-DBD-1–2, respectively). Immunoprecipitation with normal mouse IgG (Calbiochem) was used as a negative control to rule out nonspecific interactions. 60 Figure 2.7 E2F8 overexpression inhibits cellular proliferation. A, primary MEFs infected with E2F8 overexpressing or control retrovirus were plated at a density of 4 x 104 cells/60-mm plate. Cells were grown in 15% FBS containing medium and were harvested every 24 h for 7 days and counted. B, real-time RTPCR for the E2F-target genes, cyclin A2 (cyc A2), polymerase (pol ), cdc6, cyclin E (cyc E1), dhfr, and E2F2 was performed on the cells infected with E2F8-overexpressing retrovirus or the control virus. Real-time RT-PCR for GAPDH was done as a control for the amount of cDNA in each sample. The values on the y axis represent fold induction. 61 Figure 2.7 E2F8 overexpression inhibits cellular proliferation. 62 CHAPTER 3 IDENTIFICATION AND CHARACTERIZATION OF E2F7, A NOVEL MAMMALIAN E2F FAMILY MEMBER CAPABLE OF BLOCKING CELLULAR PROLIFERATION 2 ABSTRACT The mammalian E2F family of transcription factors plays a crucial role in the regulation of cellular proliferation, apoptosis, and differentiation. Consistent with its biological role in a number of important cellular processes, E2F regulates the expression of genes involved in cell cycle, DNA replication, DNA repair, and mitosis. It has proven difficult, however, to determine the specific roles played by the various known family members in these cellular processes. The work presented here now extends the complexity of this family even further by the identification of a novel E2F family member, which we now term E2F7. Like the expression of the known E2F activators, E2F1, E2F2, and E2F3, the expression 2 Reproduced with permission from J Biol Chem. 2003 Oct 24;278(43):42041-9. Epub 2003 Jul 31, de Bruin A, Maiti B, Jakoi L, Timmers C, Buerki R, Leone G. © 2005 by The American Society for Biochemistry and Molecular Biology, Inc. All data pertaining to the Northern Blot assays showing E2F7 expression pattern, and in part the data from Luciferase reporter assays showing E2F7 promoter regulation and E2F7 mediated repression were generated by Maiti B, under the supervision of Leone G. 63 of E2F7 is growth-regulated, at least in part, through E2F binding elements on its promoter, and its protein product is localized to the nucleus and associates with DNA E2F recognition sites with high affinity. A number of salient features, however, make this member unique among the E2F family. First, the E2F7 gene encodes a protein that possesses two distinct DNA-binding domains and that lacks a dimerization domain as well as a transcriptional activation and a retinoblastoma-binding domain. In contrast to the E2F activators, E2F7 can block the E2F-dependent activation of a subset of E2F target genes as well as mitigate cellular proliferation of mouse embryo fibroblasts. These findings identify E2F7 as a novel member of the mammalian E2F transcription factor family that has properties of a transcriptional repressor capable of negatively influencing cellular proliferation. INTRODUCTION The retinoblastoma (Rb) gene was the first tumor suppressor identified in humans some 20 years ago. Studies using tissue culture and in vivo mouse models have led to the identification of the E2F transcription factor family as an important effector of Rb function impacting cell proliferation, apoptosis, and cellular differentiation. From these studies, a paradigm for Rb action in the control of cellular proliferation has emerged. In this view, cyclin-dependent kinase activation results in the phosphorylation of Rb and the release of E2F family 64 members from Rb-containing complexes, leading to E2F target activation and cell cycle progression (Dyson, 1998; Nevins, 1998; Trimarchi and Lees, 2002). The regulation of E2F activities is not solely due to the action of Rb but is also subject to control at multiple tiers involving new synthesis, localization, phosphorylation, acetylation, and degradation (Nevins, 1998; Trimarchi and Lees, 2002). The E2F proteins and their heterodimeric DP partners, encoded by eight distinct genes, contain an evolutionary conserved DNA-binding and dimerization domain and, at least for E2F1–5, a conserved transactivation and pocket proteinbinding domain. Although heterodimerization with DP proteins is required for E2F DNA binding activity, the specificity of the heterodimer complex is mediated by the E2F subunit (Dyson, 1998). Both structural and functional properties have separated the E2F family members into three subclasses. The expression of E2F1, E2F2, and E2F3a, which represent the first subclass, oscillates during the cell cycle, peaks late in G1, and coincides with the activation of G1/S-specific genes (Leone et al., 1998). During this period, E2F1–3a can be found transiently bound to many E2F target promoters (Cam et al., 2003). Consistent with an important role for these proteins in cellular proliferation, the combined disruption of E2F1, E2F2, and E2F3 in mouse embryonic fibroblasts (MEF) impedes E2Ftarget expression and cellular proliferation, indicating that these E2Fs may function as transcriptional activators (Wu et al., 2001). 65 In contrast to the E2F activators, the expression of the second E2F subclass composed of E2F3b, E2F4, and E2F5 appears relatively constant in relation to cell growth (Leone et al., 1998). Several studies have implicated the second E2F subclass in transcriptional repression by recruiting the pocket proteins Rb, p107, and p130 and their associated histone-modifying enzymes to E2F target gene promoters (Trimarchi and Lees, 2002). E2F6, the only member of the third subclass, contains domains for DNA binding and dimerization but lacks residues for pocket protein binding or transactivation. Instead, E2F6 is thought to mediate repression either through its direct binding to polycomb group proteins or through the formation of a large multimeric complex containing Mga and Max proteins (Ogawa et al., 2002; Trimarchi et al., 2001). The function of E2Fs in regulating cellular proliferation and differentiation has been also investigated in non-mammalian species. Of these, Drosophila melanogaster is the most extensively studied organism, containing at least two E2F genes (dE2F1–2) and one DP gene (dDP). In many ways, dE2F1 appears to be a homolog of the mammalian E2F activator subclass, whereas dE2F2 resembles members of the mammalian repressor subclass (Stevaux et al., 2002). E2F related activities have also been described in Caenorhabditis elegans and Xenopus laevis but have not been found in yeast (Ceol et al., 2001; Suzuki et al., 2000). It is noteworthy that the Arabidopsis thaliana genome contains six E2F genes (AtE2Fa–e) and two DP genes (AtDPa and AtDPb). Similar to their 66 mammalian E2F1–3 counterparts, AtE2Fa–c proteins can transactivate E2F targets and are equipped with conserved residues for DNA binding, dimerization, transactivation, and pocket protein binding (Mariconti et al., 2002; Kosugi et al., 2002). On the other hand, AtE2Fd–f diverge from the mammalian E2F3b-6 repressors, because they possess two DNA-binding domains (DBD) and lack any of the other conserved regions necessary for E2F-dependent repression (Mariconti et al., 2002; Kosugi et al., 2002). Comparative analysis of the protein sequences between the human, mouse, fly, nematode, and A. thaliana genomes revealed that the DBD of the E2F proteins is highly conserved. We therefore used the mouse E2F3 DNAbinding amino acid sequence as bait to identify additional putative E2F family members within the recently completed mouse and human genome. We identified a new putative mammalian E2F, which we now designate as E2F7. The salient feature of this member is that it contains two tandem DBDs that are highly related to the DBDs of all other E2Fs and thus has a similar structural organization as AtE2Fd–f from plants. In contrast to most known mammalian E2Fs, this novel member lacks the residues necessary for dimerization, transactivation, and pocket protein binding. We show that this protein can bind to E2F DNAbinding consensus sites, can act as a transcriptional repressor, and can inhibit cellular proliferation. 67 MATERIALS AND METHODS Serum Starvation and Serum Stimulation—Subconfluent MEFs were synchronized by incubation in Dulbecco’s modified Eagle’s medium with 0.2% FBS for 48 h and then stimulated to proliferate by the addition of Dulbecco’s modified Eagle’s medium supplemented with 12.5% FBS. The cells were collected at different time points after serum stimulation and were processed for BrdU incorporation assays, flow cytometry, and RNA isolation as previously described (Leone et al., 1998). For the BrdU incorporation assays, we counted at least twice 300 4,6-diamidino-2- phenylindole (DAPI) counter-stained nuclei for each time point. Northern Blot Analysis—Total RNA for Northern blot analysis was isolated using TRIzol (Invitrogen), and mRNA was subsequently purified using PolyATract mRNA isolation system as described by the manufacturer (Promega). Purified mRNA was separated on a 1% agarose gel containing 6% formaldehyde and transferred onto a Gene Screen membrane (PerkinElmer Life Sciences). The cDNA probe corresponding to the first 1200 bp of the E2F7 open reading frame was labeled using Prime-It RmT (Stratagene) with 50 μCi of [α-32P]dCTP. The cell cycle blot as well as a commercially purchased mouse tissue Northern blot (Origene) were hybridized overnight under high stringency conditions (5XSSPE, 50% formamide, 5X Denhardt’s solution, 1% SDS at 42 °C) and washed several times (0.2XSSC, 0.2% SDS at 65 °C) before autoradiography. 68 Reporter Assays—MEFs were grown in triplicate and transfected with the firefly luciferase expression vectors, together with either thymidine kinase (TK) Renilla luciferase or cytomegalovirus (CMV)- β- galactosidase as internal controls, as described previously (Sears et al., 1997). After transfection, the cells were brought to quiescence by serum starvation and then stimulated to grow by the addition of fresh medium with serum. The cells were harvested at various time points, and luciferase was detected by a dual luciferase reporter assay system (Promega). β -Galactosidase assays were performed as described previously (Sears et al., 1997). RESULTS Tissue-specific and Cell Cycle-dependent Expression of E2F7—To determine the patterns of E2F7 expression in adult mice, mRNA levels were measured by Northern blot analysis using an E2F7-specific probe containing the N-terminal 1200 bp of coding sequence. Two specific sized transcripts hybridized to this probe; however, at higher stringencies the slower 5.5-kb migrating transcript was the predominant species that could be detected (data not shown). As shown in Figure 3.1A, the highest levels of E2F7 expression were observed in the skin and thymus, with little or no expression in the brain, muscle, and stomach. 69 Previous studies have detailed the distinct pattern of expression of the various E2F family genes following mitogenic stimulation of cells. To determine whether E2F7 expression was responsive to growth stimuli, E2F7 expression was measured by semi-quantitative reverse transcriptase-PCR and Northern blot analysis in synchronized cell populations. To this end, mouse embryonic fibroblasts were starved in 0.2% FBS for 48 h and subsequently stimulated with 12.5% FBS, and the cells were harvested at different time points for RNA isolation. Cells similarly treated in parallel cultures were incubated with BrdU, fixed at the various time points post-stimulation, and processed for indirect immunofluorescence. This analysis indicated that serum stimulation of quiescent cells results in an increase of E2F7 expression similar to that of E2F1, E2F2, and E2F3 (18), with levels peaking during the S phase, suggesting that the regulation of E2F7 expression is cell growth-dependent (Figure 3.1B). Analysis of Promoter Sequence Controlling the Expression of the E2F7 Locus—The cell growth-dependent accumulation of E2F7 mRNA suggests that it may be transcriptionally regulated in response to growth stimuli, albeit that other transcriptional- independent mechanisms are also possible. Examination of sequences upstream of the predicted ATG start codon revealed the presence of a number of potential binding sites for a variety of transcription factors (Figure 3.2A). Notably, the putative E2F7 promoter contained three potential E2F-binding elements near the 5’ end of the predicted first exon, with Sp1 recognition sites very close to each of the E2F binding elements. 70 To explore the role of transcriptional regulation in the control of E2F7 expression, we isolated and cloned a 2-kb genomic DNA fragment containing the 5’ sequence flanking the first exon into a luciferase reporter construct (pr-E2F7). To first determine whether the growth-regulated accumulation of E2F7 mRNA could be accounted for a transcriptional mechanism, the activity of the prE2F7 reporter construct was measured in synchronized MEF populations. To this end, MEFs were transfected with the prE2F7 reporter construct along with a TK-driven Renilla luciferase plasmid as an internal control; the cells were then growtharrested by serum deprivation and subsequently stimulated to reenter the cell cycle by the addition of 12.5% serum. The cells were then harvested at various times after serum addition, and cell extracts were assayed for firefly and Renilla luciferase activity. As shown in Figure 3.2B, E2F7 promoter activity was low in quiescent cells and in early G1 cells but increased 8-fold by 24 h poststimulation, corresponding with the serum-dependent induction of E2F7 mRNA observed previously (Figure 3.1B). To investigate the role of the putative E2F recognition sites in regulating the growth-dependent activation of E2F7, the three E2F binding elements on its promoter were eliminated in combination (Figure 3.2A). MEFs were transfected with either the wild-type or each of the mutated E2F7 promoter constructs, as well as with a TK-Renilla luciferase plasmid as an internal control. Transfected cells were growth-arrested in low serum medium and then stimulated to reenter the cell cycle by the addition of 12.5% serum. The promoter with the three E2F 71 sites mutated exhibited a 5-fold increase in activity in quiescent cells (Figure 3.2B and Figure 3.2C), suggesting that these E2F-binding elements play a negative regulatory role on the regulation of its expression. In addition, mutation of the E2F-binding sites also resulted in higher E2F7 promoter activity when cells were restimulated with serum, as early as 6 h post-stimulation, indicating that E2F7 expression can also be regulated positively through E2F-binding siteindependent transcriptional mechanisms. The fact that wild-type and mutant E2F7 promoter constructs could be activated equally well by the overexpression of E2F1 (Figure 3.2D and Figure 3.2E), suggests that E2F activators can regulate the E2F7 promoter independently of these three E2F-binding elements. Together, these data suggest that E2F7 expression is subject to E2F-mediated negative and positive regulation by different mechanisms. E2F7 has Transcriptional Repression Function—We next examined the possible role of E2F7 in the transcriptional control of E2F-responsive genes. To this end, MEFs were transfected with luciferase reporter constructs carrying a variety of E2F-responsive promoters, including TK, E2F2, E2F3a, polymerase α, and Rb along with increasing amounts of a Myc-E2F7 expressing vector. Standardization with β-galactosidase activity as an internal control revealed that E2F7 expression in cycling population of cells led to a consistent decrease in some of the E2F target genes, with little or no effect in others (Figure 3.3A). The inability to activate transcription is consistent with the fact that E2F7 does not contain a transactivation domain. 72 The inhibition of E2F target genes was accentuated when synchronized population of cells was assayed instead. The prE2F2 reporter gene is activated in an E2F-dependent manner during the G1/S transition in cells induced to enter the cell cycle. To determine whether E2F7 can inhibit this G1/S-specific induction, MEFs were transfected with the Myc-E2F7 expression vector and an E2F-reporter construct (prE2F2) as before, but where subsequently arrested in G0 by serum deprivation, and then induced to enter the cell cycle by the addition of serum for 15 h. Expression of Myc-E2F7 inhibited the serum-induced activation of the prE2F2 reporter in a dose-dependent manner (Figure 3.3B), suggesting that E2F7 can block the ability of endogenous E2F complexes to activate this reporter. To determine whether the ability of E2F7 to repress E2F target gene expression is E2F-dependent, we asked whether Myc-E2F7 could inhibit the ability of E2Fs to transactivate E2F-responsive reporter constructs. In these experiments, MEFs were transiently transfected with E2F1 and the prE2F2 reporter construct and increasing amounts of E2F7. As previously shown, E2F1 expression resulted in the activation of reporter gene activity by ~6-fold (Figure 3.3C). This E2F1-mediated activation was effectively inhibited by Myc-E2F7 in a dose-dependent manner. These results suggest that E2F7 can act to inhibit E2Fmediated activation of target genes. 73 DISCUSSION E2F plays an important role in the control of cell proliferation in many different species, including mammals, flies, nematodes, amphibians, and plants. Comparative evaluation of amino acid sequences reveal that the DBD of E2Fs are evolutionary conserved and therefore represent an essential feature that serves to identify E2F family members. Herein we describe the cloning and characterization of a novel murine gene that contains this most conserved domain common to all known E2Fs. Functional studies confirm that this novel protein can bind to consensus E2F DNA recognition sequences, supporting its classification as a genuine member of the E2F family, and we have thus named it E2F7. Despite this designation, structural and functional data indicate that E2F7 functions in a different manner from the other E2F family members. The most notable feature of E2F7 is that it contains two DBDs and lacks the heterodimerization domain, suggesting that this protein recognizes E2F consensus sites independently of a DP partner. This novel E2F member most closely resembles the recently identified AtE2Fd–f subfamily members in A. thaliana. Kosugi and Ohashi (2002) speculate that the tandem repeat of the DBDs within the plant E2Fs might structurally mimic the DBD formed in E2F/DP heterodimers. This speculation was supported by the fact that deletion of either one of the two DBDs in AtE2Fd–f resulted in a complete loss of its ability to bind DNA. 74 Like E2F6, E2F7 also lacks the C-terminal domains necessary for transactivation and pocket protein binding, consistent with its inability to activate known E2F-responsive genes. Instead, E2F7 is able to block the endogenous E2F-dependent transcriptional activity as well as the transactivating activity of overexpressed E2F1. The mechanism of transcriptional repression is unclear but might involve competition between E2F7 and other E2Fs for the same DNA target sites. E2F6 has been shown to actively repress gene expression by interacting directly with polycomb group proteins through their association via its marked box domain (Trimarchi et al., 2001). Although E2F7 does not possess a similar marked box domain, it might contain a functionally related domain(s) that could potentially recruit co-repressors to E2F-regulated promoters. Interestingly, E2F7-mediated transcriptional repression appears to be target gene-dependent because only a subset of known E2F-regulated promoters can be efficiently repressed by E2F7 overexpression, indicating functional specificity for distinct E2F targets. Whether this specificity is dictated by the selectivity of binding to different E2F DNA recognition sites, by the recruitment of co-factors, or through other mechanisms is not known. The identification of E2F7 as a novel E2F family member adds a further level of complexity to the control of E2F-dependent gene expression. It is possible that by inhibiting the DNA binding capacity of the other known E2Fs during the cell cycle, it might modulate cell cycle progression or might provide cells with the ability to respond to additional external cues. In this respect, our 75 data show that the regulation of E2F7 expression is cell growth-dependent, suggesting that E2F7 may play an important role in counter balancing E2Finduced gene expression, as has been demonstrated for the antagonistic relationship between the Drosophila E2Fs (Stevaux et al., 2002). Although measurement of E2F7 expression by either Northern, reverse transcriptasePCR, or reporter assays indicate that its regulation is cell growth-dependent, analysis of the E2F7 gene product has yet to be carried out and must await the generation of E2F7- specific antibodies. In contrast to other E2Fs, E2F7 overexpression led to an inhibition of cellular growth in primary MEFs, accompanied by a moderate but reproducible accumulation of cells in the G2 phase. The E2F7-mediated accumulation of cells in the G2 phase may arise from a decrease in G2 progression, a delay in the exit of cells from G2, or an inability of cells to efficiently enter mitosis. Further investigation will be required to identify the exact mechanism of cell growth inhibition mediated by E2F7 and to identify the specific targets regulated by E2F7 that might mediate this effect. Because E2F7 overexpression has the capacity to slow down cellular growth, one could envision that E2F7 may function as a tumor suppressor gene and that mutations within this gene might result in cancer formation. Although we have yet to establish the true physiological function of E2F7, its broad expression pattern suggests that it may provide an important contribution to the regulation of E2F activities in multiple tissues during development and/or tumorigenesis. 76 Figure 3.1 Tissue-specific and cell cycle-dependent expression of E2F7. A, a mouse tissue blot from ORIGENE was either hybridized with an E2F7 specific probe or a -actin probe as a loading control. B and C, expression of E2F7 following serum stimulation of quiescent MEFs. The cells were brought to quiescent by serum starvation and stimulated to proliferate by the addition of fresh medium with 12.5% serum. The samples were taken at the indicated times post-stimulation, and Northern blot analysis (B) as described under "Experimental Procedures“. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (C) was measured and used as internal expression control. 77 B Figure 3.1 Tissue-specific and cell cycle-dependent expression of E2F7. 78 Figure 3.2 Cell cycle regulation of the E2F7 promoter. A, genomic organization of the E2F7 promoter. The genomic region including exons 1 and 2 is shown together with the DNA sequences immediately upstream of each exon. The E2F recognition sites within the E2F7 upstream regulatory sequences and the site where the 2-kb promoter fragment was fused to the firefly luciferase reporter is illustrated. The asterisks indicate the positions of the E2F-binding elements where mutagenesis was carried as outlined under "Experimental Procedures." B, analysis of the E2F7 wild-type promoter (wt prE2F7) and the E2F7 promoter containing mutated E2F binding elements (mut pr-E2F7) following mitogenic stimulation. MEFs were transfected with wt pr-E2F7-luciferase or mut pr-E2F7luciferase, together with a TK-Renilla luciferase vector as an internal control as described in the text. Asynchronous proliferating (P), density-arrested (D), and synchronized cell populations were analyzed. Firefly luciferase activity was normalized to Renilla luciferase activity. C, analysis of wt prE2F7 and mut pr-E2F7 during quiescence. The data represent the average and standard deviation from three independent experiments. D, the E2F7 promoter is activated by E2F1 and E2F3. MEFs were transfected with 2 µg of the wt pr-E2F7luciferase construct, together with 0.5 µg of either pCDNA3E2F1 (E2F1), pCDNA3-E2F3 (E2F3), or pCDNA3 control vector along with 2 µg of CMV- β-galactosidase and treated as described under "Experimental Procedures." The luciferase values were first normalized to β-galactosidase activity and reported as fold induction relative to the values obtained from transfections with a control expression vector. E, activation of the E2F7 promoter by E2F1 is independent of the three E2Fbinding elements. MEFS were transfected with either 2 µg of wt pr-E2F7 or mut pr-E2F7 and with either pCDNA3-E2F1 (E2F1) or control pCDNA3 vector and with 2 µg of CMV- galactosidase. The luciferase values were normalized to galactosidase activity and shown as fold induction relative to the values obtained with control vector. 79 Figure 3.2 Cell cycle regulation of the E2F7 promoter. 80 Figure 3.3 E2F7 has transcriptional repressor function. A, E2F7 can block the activation of multiple E2F-responsive promoters. MEFs were transiently transfected with 2 µg of the indicated E2F-responsive reporter constructs along with increasing amounts of pCDNA-MycE2F7 (myc-7) and 2 µg of CMV- -galactosidase. Extracts from transfected cells were prepared as already described, and the luciferase and galactosidase activities were measured. The normalized luciferase activities are presented as the average fold activation relative to the activity in extracts from cells transfected with the reporter construct alone. B, E2F7 overexpression inhibits the serum-induced activation of the E2F2 promoter. MEFs were transiently transfected with 2 µg of pr-E2F2 along with increasing amounts of pCDNA3-Myc-E2F7 or corresponding doses of the pcDNA3 control vector (con) and 2 µgofthe -galactosidase plasmid as an internal control. The cells were treated as described under "Results," and the extracts were prepared and assayed for luciferase and -galactosidase activities; the luciferase activity was normalized to the corresponding galactosidase activity. C, E2F7 inhibits the E2F1-induced activation of the E2F2 promoter. MEFs were transiently transfected with the 2 µg of the prE2F2 reporter construct and 0.2 µg of the pCDNA3-E2F1, along with either increasing amounts of pCDNA3-MycE2F7 or pcDNA3 control vector and 2 µg of the CMV- -galactosidase. The cells were brought to quiescence and then assayed for luciferase and -galactosidase activity. Luciferase activity was normalized to -galactosidase activity. 81 Figure 3.3 E2F7 has transcriptional repressor function. 82 CHAPTER 4 THE E2F1-3 TRANSCRIPTION FACTORS ARE ESSENTIAL FOR CELLULAR PROLIFERATION 3 ABSTRACT The retinoblastoma tumour suppressor (Rb) pathway is believed to have a critical role in the control of cellular proliferation by regulating E2F activities (Dyson, 1998; Nevins, 1998). E2F1, E2F2 and E2F3 belong to a subclass of E2F factors thought to act as transcriptional activators important for progression through the G1/S transition (DeGregory et al., 1997). Here we show, by taking a conditional gene targeting approach, that the combined loss of these three E2F factors severely affects E2F target expression and completely abolishes the ability of mouse embryonic fibroblasts to enter S phase, progress through mitosis and proliferate. Loss of E2F function results in an elevation of p21Cip1 protein, leading to a decrease in cyclin-dependent kinase activity and Rb Reproduced with permission from Nature. 2001 Nov 22; 414(6862): 457-62. Wu L, Timmers C, Maiti B, Saavedra HI, Sang L, Chong GT, Nuckolls F, Giangrande P, Wright FA, Field SJ, Greenberg ME, Orkin S, Nevins JR, Robinson ML, Leone G. © 2001 Macmillan Magazines Ltd. The data pertaining to the growth defect (using Flow cytometry), p21 upregulation (kinase assays and Western Blots) were generated by Maiti B, under the supervision of Leone G. 3 83 phosphorylation. These findings suggest a function for this subclass of E2F transcriptional activators in a positive feedback loop, through down-modulation of p21Cip1, that leads to the inactivation of Rb-dependent repression and S phase entry. By targeting the entire subclass of E2F transcriptional activators we provide direct genetic evidence for their essential role in cell cycle progression, proliferation and development. INTRODUCTION The delineation of a pathway controlling the progression of cells out of quiescence, through G1 and into S phase, has been established (Dyson, 1998; Nevins, 1998). Principal events in this pathway include the activation of cyclindependent kinases (CDKs), the coordinated phosphorylation of Rb and p130 by cyclin-CDK complexes, and the subsequent release and accumulation of E2F activities (Dyson, 1998; Nevins, 1998). Although E2F has an essential role in control of cell growth during Drosophila development (Duronio et al., 1995; Royzman et al., 1997), current knockout mouse models have failed to demonstrate a similar requirement for any E2F family member in mammals (Field et al., 1996; Humbert et al., 2000a; Humbert et al., 2000b; Leone et al., 2001; Lindeman et al., 1998; Rempel et al., 2000; Yamasaki et al., 1996). One interpretation of these observations is that under normal circumstances, loss of a 84 single E2F member can be functionally compensated by other related E2F activities. RESULTS AND DISCUSSION Of the six known E2F family members, E2F1, E2F2 and E2F3 can specifically interact with Rb, and their expression is cell-cycle regulated (Lees et al., 1993; Leone et al., 1998). To test for functional redundancy among this subclass of E2F family members, we generated and interbred E2F1, E2F2 and E2F3 mutant mice (Field et al., 1996; Leone et al., 2001) (Figure 4.1), and found that although E2F1-/-E2F2-/- mice were viable and developed to adulthood, E2F1-/-E2F3-/- and E2F2-/-E2F3-/- animals died early during embryonic development (Table 4.1), at or just before 9.5 embryonic days (E9.5), pointing to a central role for E2F3 in mouse development. To explore directly the potential role for this subclass of E2F transcription activators in cellular proliferation, we measured the ability of cells deficient for these E2F family members to proliferate. We introduced a conditional or floxed E2F3 allele (E2F3f/f; Figure 4.1) into E2F mutant backgrounds and obtained E2F1-/-E2F3f/f, E2F2-/-E2F3f /f andE2F1-/-E2F2-/-E2F3f /f embryos at the predicted frequencies (Table 4.1 and data not shown), confirming that the floxed 85 E2F3 allele did not have any adverse effect on the development of animals. Infection of mouse embryonic fibroblasts (MEFs), which were derived from these embryos, with a retrovirus expressing the Cre recombinase resulted in the specific deletion of the floxed exon 3 (Figure 4.1D). To determine whether the loss of E2F function would lead to an accumulation of cells in a specific phase of the cell cycle, TKO cells were analysed for DNA content by flow cytometry. As shown in Figure 4.2B, control virus-treated E2F1-/-E2F2-/-E2F3f/f cells, rendered quiescent by serum deprivation, accumulated a G1 content of DNA, and could be efficiently induced to enter the cell cycle after serum addition, as suggested by the timely accumulation of an S phase content of DNA. The similar profiles of control- and Cre-treated wild-type cells indicated that expression of Cre itself had little or no effect on the ability of cells to proliferate or progress through the cell cycle (Figure 4.2B). Unsynchronized TKO cell populations had a similar profile of DNA content as control cells, except that most of these cells were also negative for BrdU incorporation (Figure 4.2C, compare top and bottom samples; and data not shown). Moreover, TKO cells failed to accumulate aG1 content of DNA on serum deprivation and failed to respond to serum addition (Figure 4.2C). Together, these findings show that ablation of all three E2F family members arrests cell growth irrespective of cell cycle position, indicating a role for these E2Fs throughout the cell cycle. Recent work also suggests a continuing role for E2F during S phase that seems to be important for the regulation of mitotic regulators 86 and progression of cells through G2/M (Lukas et al., 1999). This view is consistent with recent genome-wide analyses of cell-cycle-regulated genes, where a large fraction of E2Fregulated gene targets were found to encode proteins known to be involved in the progression of cells into G2 and through mitosis (Ishida et al., 2001; Muller et al., 2001). To identify relevant downstream activities that might be responsible for mediating the growth arrest observed upon loss of E2F3, we assessed the status of various inhibitors of the cell cycle. Whereas p53 or p27Kip1 remained unchanged, p21Cip1 protein levels were markedly elevated in TKO cells (Figure 4.3A). This increase in p21Cip1 protein could be accounted for by a concomitant increase in its levels of messenger RNA (Figure 4.3B). Consistent with these findings, Cdk2-associated activities were markedly reduced and Rb was found to be predominantly in its hypophosphorylated state (Figure 4.3A, Figure 4.3C). Furthermore, cyclin-B-associated kinase activity was also significantly reduced in TKO cells, even though a large population of the cells possessed either an S phase or G2 content of DNA. These results might, at least in part, explain the apparent growth arrest that occurs through various phases of the cell cycle, namely in G1, S and G2/M of TKO cells. The fact that overexpression of cyclin E/Cdk2 could drive TKO cells into S phase (Figure 4.3D) suggests that the upregulation of p21Cip1 protein is probably a relevant consequence resulting from the ablation of E2F1, E2F2 and E2F3. 87 The status of Rb-E2F-associated DNA binding activities were also assessed in these cells. Consistent with previous studies, electrophoretic mobility shift assays (EMSA) of lysates from control- or Cre-treated E2F1-/-E2F2-/E2F3f/f cells synchronized by serum deprivation, revealed the characteristic Rbrelated p130-E2F4/5 protein complexes (Leone et al., 1998). These G0-specific complexes are thought to recruit histone deacetylase and remodelling activities, and are presumed to mediate transcriptional repression of E2F target (Brehm et al., 1998; Harbour et al., 2000; Luo et al., 1998; Magnaghi-Jaulin et al., 1998; Weintraub et al., 1992; Weintraub et al., 1995; Zhang et al., 1999). In contrast to control-treated MEFs, serum stimulation of TKO cells did not lead to the dissociation and disappearance of p130-E2F4/5 complexes nor to the appearance of the S-phase specific p107-E2F4 complex (Figure 4.3E). These findings are consistent with the observed increase in p21Cip1 protein and decrease in Cdk activity and Rb phosphorylation (Figure 4.3A, Figure 4.3C). We propose that E2F activators mediate cell cycle progression by two mechanisms: first, they can directly activate cell-cycle-dependent gene expression, and second, they can activate a positive feedback loop, through inhibition of p21Cip1 protein accumulation, that would promote Rb phosphorylation and complete derepression of Rb-E2F target genes. The decrease in E2F target gene expression observed in TKO cells could be viewed to result from both the continued Rb-mediated transcriptional repression and the absence of E2Fmediated transcription activation. Although our results establish the critical nature 88 of E2F1, E2F2 and E2F3 in the control of cellular proliferation, the relative importance of E2F-mediated transcriptional repression versus activation remains to be determined. The mechanism by which E2F family members regulate p21Cip1 expression and its in vivo consequences will be an important topic of future experimentation. Although a role for E2F in the regulation of the cell cycle and proliferation has been speculated for over a decade (Dyson, 1998; Nevins, 1998; Tsai et al., 1998; Yamasaki et al., 1998; Ziebold et al., 2001), the complexity of the E2F network has precluded previous loss-of-function mouse models from demonstrating the essentiality for individual E2F family members in mammalian cell proliferation. The ‘conditional' gene knockout strategy described here allowed us to circumvent detrimental consequences that arise from the inactivation of multiple E2F family members in mice. By making genetic modifications to the entire E2F activator subclass, as opposed to individual members, we provide direct genetic evidence suggesting that E2F activators are essential for cell cycle progression, proliferation and development. MATERIALS AND METHODS Retroviral infections Full-length complementary DNAs for Cre recombinase, Myc-tagged versions of mouse E2F3a and E2F3b and HA-tagged versions of human E2F1, 89 E2F2 and E2F3a were subcloned into the pBabe retroviral vector containing either a puromycin-(pBpuro), hygromycin-(pBhygro), or phleomycin-resistant gene (pBbleo). High-titre viruses were produced by transient transfection of retroviral constructs into the Phoenix-Eco packaging cell line as described previously (Pear et al., 1993). We infected MEFs with the retrovirus using standard methods. Infected cells were then selected for a total of five days in the presence of one or more antibiotics using the following concentrations: 2.5 mgml1 for puromycin, 400 mgml-1 for hygromycin and 25 mgml-1 for phleomycin. Serum starvation and serum stimulation Subconfluent MEFs were synchronized by incubation in DMEM with 0.2% FBS for either 60 h (for primary MEFs) or 72 h (for immortalized MEFs). Synchronized cells were then stimulated to proliferate by the addition of DMEM supplemented with 15% FBS. Cells were collected at different time points after serum stimulation and were processed for BrdU incorporation assays (Leone G et al., 1998), flow Cytometry (Leone G et al., 1998), histone H1 kinase assays (Leone G et al., 1998), EMSA (Nevins et al., 1997), western blots, or northern blots. For BrdU incorporation assays, we counted at least 300 4,6-diamidino-2phenylindole (DAPI) counter-stained nuclei for each time point. Western blot analyses 90 Cell protein lysates were separated in SDS acrylamide gels and blotted into polyvinylidene fluoride membranes. Blots were incubated in blotto buffer (5% skim milk in Tris-buffered saline) with antibodies specific for E2F3 (SC-878, Santa Cruz), phospho-Akt (Cell Signalling, no. 9271L), phospho-Erk (Cell Signalling, no. 9101S), p21Cip1 (M-19 and C-19, Santa Cruz), p27Kip1 (Transduction Laboratory), p53 (14461C, PharMingen and Ab-1, Oncogene), Rb (G3-245, PharMingen), c-Myc-epitope (C-33, Santa Cruz), HA epitope (Y-11, Santa Cruz), cyclin B1 (GNS1, Santa Cruz) and Cdk2 (M2, Santa Cruz). The primary antibodies were then detected using horseradish-peroxidase-conjugated secondary antibodies and ECL reagent as described by the manufacture (Amersham). 91 Figure 4.1 E2F3 conditional knock out strategy A, Two alternative splicing forms (E2F3a and E2F3b) with separate promoters (bent arrows) are encoded by the E2F3 locus15. The solid bar represents a SpeI–EcoRV fragment used as a Southern probe. loxP sites are indicated as solid triangles; thin arrows represent PCR primers. DT, diphtheria toxin; TK, thymidine kinase; RV, EcoRV. B, PCR analysis of mice with the indicated genotypes. M, DNA marker; C, negative control. 92 A B Figure 4.1 E2F3 conditional knock out strategy 93 A B C Figure 4.2 Growth defect in E2F3 single or combinatorial knock out MEFs A, BrdU incorporation assays of MEFs that were infected with a control (open boxes) or a Cre retrovirus. B, C, Cell cycle analysis by FACS for wild-type MEFs (C) or E2F1-/-E2F2-/-E2F3f/f MEFs (C) that were infected with a control (top panels (-)) or a Cre retrovirus (bottom panels (+)). In C, a fraction of cells had become tetraploid by the time the experiment was performed, as indicated by the appearance of two distinct peaks in serumstarved samples (0 h). Hatched areas indicate the percentage of cells (S) containing an S-phase content of DNA. 94 Figure 4.3 Loss of E2F3 activates checkpoint via p21 A, Western blots of control- or Cre-retrovirus-infected E2F1-/E2F2-/-E2F3f/f MEFs using antibodies against the indicated cell cycle regulators. Rb-PP, phosphorylated form of Rb. B, p21 Northern blot of E2F1-/-E2F2-/-E2F3f/f MEFs that were treated as in A. P, proliferating conditions. C, Kinase assays of E2F1-/E2F2-/-E2F3f/f MEFs treated as in A. Ig, rabbit immunoglobulinas controls. The graph represents the relative kinase activity. D, BrdU incorporation assays of E2F1-/-E2F2-/-E2F3f/f MEFs that were infected with a control (-) or a Cre retrovirus (+). Serumstarved cells were infected with adenoviruses expressing cyclin E and Cdk2 (E) or with a control adenovirus (C). Adenovirusinfected cells were incubated with BrdU in either 0.2% serum (-) or 15% serum (+) for 24 h, and processed for immunohistochemistry. E, E2F1-/-E2F2-/-E2F3f/f MEFs were treated as in A, and were assayed for E2F DNA-binding activity by EMSA using an E2F-specific 32P-labelled DNA probe. 95 D A B E C Figure 4.3 Loss of E2F3 activates checkpoint via p21 96 Table 4.1 Genotypic Analysis of E13.5 embryos derived from crosses of E2F mutant animals 97 CHAPTER 5 SURVIVIN IS ESSENTIAL FOR PROLIFERATION AND COLLABORATES WITH C-MYC AND H-RAS (V12) IN THE TRANSFORMATION OF MOUSE EMBRYONIC FIBROBLASTS. 4 ABSTRACT Survivin is an important molecular target in cancer, in part due to its predominant expression in cancer cells in comparison with normal differentiated cells. Current evidence suggests that survivin’s dual function as an anti-apoptotic protein and a chromosomal passenger protein makes it a factor favoring cancer progression. The role of survivin in cellular proliferation and transformation is not clearly understood. To this end, we made use of primary mouse embryonic fibroblasts (MEFs), conditionally deleted for survivin. Immunofluorescence studies revealed localization of endogenous survivin in the wild-type MEFs during mitosis, similar to previous observations in other cell types, in agreement with the role of survivin as a chromosomal passenger protein in these cells. When survivin was deleted by virally mediated Cre recombinase expression, we 4 All data were generated by Maiti B under the supervision of Altura RA, except where indicated otherwise. 98 observed severe proliferation defects, manifest as an increase in the number of polyploid cells and a massive increase in nuclear diameter likely secondary to a mitotic defect. In contrast to the cell death phenotype reported in other cell types following Survivin deletion, we did not detect any significant increase in cellular apoptosis or caspase activity. To gain an understanding of survivin’s role in transformation, wild-type primary MEFs were engineered to express known oncogenes (c-myc or H-rasV12) in combination with survivin. Our preliminary data suggest that survivin collaborates with c-myc and H-rasV12 to transform wild-type primary MEFs. This is the first report of a collaboration of survivin with another oncogene in transformation. The fact that survivin can potentiate the activity of other oncogenes is a novel finding and suggests a potential mechanism for this gene in tumor cell initiation and growth. In conclusion, these data largely support targeting a disruption of survivin in cancer therapy and uncover a novel role of survivin in the context of transformation. INTRODUCTION Survivin is an unusual protein with dual functions in mitosis and apoptosis (Wheatley et al., 2005). During mitosis, survivin acts as a chromosomal passenger protein forming a complex with Aurora-B kinase, inner centromere protein (INCENP) and Borealin/Dasra-B (Vader et al., 2005). Survivin is a crucial mediator that targets the chromosomal passenger complex in a spatial and 99 temporal manner, an essential process to maintain high fidelity chromosomal segregation during mitosis (Vader et al., 2005). The spindle assembly checkpoint is dependent on survivin, as evident by the significant reduction of BubR1 (which regulates kinetochore-microtubule attachments and is a part of the mitotic checkpoint complex, inhibiting anaphase promoting complex/cyclosome, APC/C) at the kinetochores in prometaphase (Lens et al., 2006). Targeting survivin by RNA interference in euploid human lung fibroblast cells (IMR-90) or a retinal pigment epithelial (RPE) cell line results in defects of both chromosomal segregation and cytokinesis but not enhancement of cell death (Yang et al., 2004). Targeting of embryonic stem cells by disrupting the survivin gene locus also results in a similar phenotype (Uren at al., 2000; Conway et al., 2002). In contrast, conditional targeting of survivin in normal neural stem cells results in massive apoptosis indicating a cell-type specific role for survivin as a mitotic regulator or anti-apoptotic protein in untransformed cells (Jiang et al., 2005). The expression pattern of survivin is under tight temporal and spatial control. It is abundantly expressed during embryogenesis, whereas it is undetectable in most terminally differentiated adult tissues (Altieri, 2006). Proliferating adult tissues that do express survivin include early hematopoietic cells, T-lymphocytes, gastric epithelium, vascular endothelium and spermatogonia (Li and Brattain, 2006). In addition, survivin is highly expressed in virtually every human cancer making it a highly explored molecular target for anticancer therapy (Altieri, 2006). 100 Targeting of survivin by RNA interference in a multitude of cancer cell lines leads to an increase in susceptibility to DNA-damage induced programmed cell death, such as by chemicals or radiation. This indicates that high levels of survivin mediate resistance to chemotherapy and radiation (Li and Ling, 2006). This is clinically significant in that patients harboring tumors expressing high survivin have poorer clinical outcomes (Li and Ling, 2006). Current evidence suggests that survivin plays an essential role in tumor maintenance by facilitating proliferation, angiogenesis, multi-drug resistance and by preventing apoptosis (Altieri, 2006). However, whether survivin plays a role in the initiation or establishment of tumors still remains unclear. Lines of evidence that support a role for survivin in this process include the following. High levels of expression of chromosomal passenger proteins (CPPs) such as Aurora-A, Aurora-B, survivin and INCENP in human tumors correlate with the degree of aneuploidy and genomic instability (Nguyen and Ravid, 2006). According to the ‘genomic instability theory of cancer’, chromosomal instability early in tumor formation leads to loss of tumor suppressor genes and/or gain of oncogenes, thus driving malignant transformation (Nguyen and Ravid, 2006). Experimentally, Tatsuka et al., (2005) showed that exogenous expression of Aurora-A (mammals have three aurora kinases – A, B and C) potentiated transformation induced by G12V mutated H-Ras expression in mouse 3T3 cells. The anti-apoptotic functions of the chromosomal passenger protein, survivin, combined with its potential to cause genomic instability when aberrantly expressed, led us to hypothesize a 101 role for survivin in tumor initiation. To enable the efficient targeting of survivin in cancer it is imperative to understand the interplay of survivin with other signaling pathways that co-exist in cancer cells. Typically, genetic analysis of a cancer cell reveals a gain of function (g-o-f) by mutation/amplification of oncogenic pathways and/or a loss of function (l-o-f) by mutation/silencing of tumor suppressor pathways. In the current study, I made use of two well-studied oncogenes c-Myc and H-Ras V12 to explore survivin’s potential collaborative role in cancer initiation. c-Myc is a nuclear transcription factor which is aberrantly expressed, via genetic or epigenetic means including amplification and translocation, in up to 50% of all human cancers (Arvanitis and Felsher, 2006). Physiologically, c-Myc, following dimerization with its partner Max, binds DNA and activates genes involved in proliferation, differentiation and apoptosis (Arvanitis and Felsher, 2006). c-Myc plays an indispensable role in cellular proliferation, as evidenced by a profound and stable growth defect of Rat1A fibroblasts, deficient in c-Myc (Berns et al., 2000). Members of the Ras gene family comprise the most frequently mutated genes found in any human cancer (Giehl, 2005). Point mutations in the Ras gene itself resulting in a constitutively active form (for example H-RasV12) of the Ras proteins, protein overexpression or dysregulation of growth factor receptor tyrosine kinase (RTK) pathways (upstream of Ras) result in activation of the Ras signaling in a vast majority of human cancers (Giehl, 2005; Cox and Der, 2002). Ras proteins, which are membrane bound 102 GTP-ases, cycle between an active GTP-bound and inactive GDP-bound state, acting as a molecular switch to modulate cellular proliferation, differentiation, apoptosis, motility and phagocytosis via a wide range of effector pathways that include Raf kinase, PI3K (phosphatidylinositol 3-kinases) and mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) kinase (Giehl, 2005). Although expression of Ras or Myc proteins by themselves lead to p53dependent premature senescence or apoptosis of wild type primary mouse embryonic fibroblasts respectively; when co-expressed, Ras and Myc collaborate to transform these cells (Land et al., 1983; Weinberg et al., 1997). Recent evidence suggests that survivin is upregulated by H-Ras G12V and survivin facilitates H-Ras G12V induced tranformation and foci formation in rat embryonic 3T3 cells (Sommer et al., 2003). To gain a better understanding of the role of survivin in tumor initiation and the interplay of co-existing oncogenic pathways with survivin in cancer, I used transformation assays using primary MEFs that concomitantly express survivin and another oncogene (H-RasV12 or c-Myc). Since it had not been characterized previously, I initially investigated the role of survivin in the proliferation and survival of primary MEFs, using MEFs conditionally deleted for survivin by a Cre-lox-P system. These data show that survivin is essential for the proliferation but not for the survival of primary MEFs. In addition, evidence is provided that survivin is essential for the maintenance of the Myc/Ras transformed phenotype. These preliminary data supports 103 collaboration between survivin and the oncogenes c-Myc and H-RasV12 in the initiation of transformation. MATERIALS AND METHODS Construction of the plasmids Survivin cDNA with myc-His tag at the 3’end was PCR amplified from the pcDNA4TM/TO/myc-His B (Invitrogen)- survivin construct described previously (Caldas et al., 2005) and subcloned in the SnaB1 site of retroviral pBabe vector containing a Hygromycin resistance cassette. c-Myc and H-RasV12 constructs in pBabe vectors with Hygromycin or puromycin resistance cassettes were generous gifts from Leone G. Generation of the Mouse embryonic fibroblasts and in vitro cell culture Mice containing a conditional floxed survivin (survivinlox/lox) allele have been described elsewhere (Xing et al., 2004). These mice were interbred to generate homozygous survivin f/f embryos. Primary mouse embryonic fibroblasts were isolated from E18.5 survivin f/f embryos using standard methods. For the experiments, the MEFs were grown in DMEM containing 15% FBS. If indicated, the MEFs were starved in 0.2% FBS 104 containing DMEM for 48 hours and restimulated using DMEM containing 15% FBS. MEFs were grown at 370C and 5.5% CO2. Viral infections High titer retrovirus was produced from the transient transfection of pBabe constructs in to Phoenix-Eco packaging cell lines as described elsewhere (Pear et al., 1993). Following infection, the MEFs were selected using the appropriate antibiotic(s) at the following concentrations - 2.5 μgml-1 for puromycin, 400 μgml-1 Hygromycin for a period of 48-72 hours. Adenovirus expressing cre recombinase (Ad-CMV-Cre) was purchased from Vector Biolabs. The adenoviral GFP (rAD.eGFP) was made by the viral vector core laboratory at the Columbus Children’s Research Institute and was a generous gift from Kaspar B. Both the virus were used at 40 MOI. Immunohistochemistry and confocal microscopy MEFs were grown on glass coverslips until harvested. Subsequently, they were fixed in 4% paraformaldehyde for 10 min at room temperature. The cells were then permeabilized in 0.5% Triron X-100 for 10 min at room temperature. Following permeabilization, the cells were washed with Phosphate buffered saline (PBS) and blocked with 5% normal goat serum for 1 hour at room temperature. Then the cells were incubated with primary antibody overnight at 40C. The primary antibodies used include polyclonal FL142 anti survivin antibody 105 from Santa Cruz Biotech and monoclonal alpha- tubulin from Sigma at the concentrations of 1μg/ml. Next, the cells were incubated with 1μg/ml of secondary antibodies goat anti-mouse-FITC (Santa Cruz Biotech) and goat antirabbit-Biotin (Santa Cruz Biotech) for one hour at room temperature. Then the cells were washed and further incubated with tertiary NeutrAvidin Texas Red (Molecular Probes) and Hoechst 33258 for nuclear staining. Finally, the cover slips were mounted using Vectashield (Vector Labs) and analyzed by confocal microscopy on Zeiss LSM 510 META using the Plan Apochromat 63/1.4 Oil/DIC objective. Cell proliferation assay The MEFs were plated in 6 well dishes at starting concentration of 15X103 cells/well, in triplicates. The cells were harvested and counted every 24 hours for 7 days (Jiang, Y). In vitro colony formation assay Following retroviral transduction and selection, cells were plated at a density of 30X103 cells/ 100mm tissue culture dish and allowed to grow in 15%FBS/DMEM for 7-10 days to let the colonies grow. After this period, they were harvested, fixed with 70% ethanol and stained with 5mg/ml crystal violet in 20% methanol. 106 Caspase assay The caspase-9 activity was measured from 50μg of protein extract of each cell type, in triplicates, using Caspase-Glo Assay kits (Promega, Madison, WI). BrdU/PI Flow cytometry The cells were pulsed for one hour with 10μM BrdU following which they were harvested, fixed in 70% ethanol and stained with 10μg/ml PI (Propidium Iodide)/RNAse (BD Biosciences) and 1μg/ml Anti-BrdU-FITC antibody using the manufacturer’s protocol (http://www.bdbiosciences.com/pharmingen/protocols/BrdU_Incorporation.shtml). Subsequently, the data was collected using BD FACSDiva and analyzed using BD FACSDiva software. RESULTS AND DISCUSSION Previous studies have shown that survivin has cell-type specific roles as an anti-apoptotic protein and/or mitotic regulator in vitro and in vivo ((Jiang et al., 2005; Yang et al., 2004). To determine the predominant function of survivin in primary MEFs, we used MEFs isolated from E18.5 embryos containing the homozygous floxed allele of survivin (Svnf/f). The knock out strategy and the position of the lox-P sites is outlined in Figure 5.1A. Using Cre recombinase that was delivered via retroviral or adenoviral infection, the survivin gene was deleted 107 between the lox-P sites, in the majority of the cell population, as evident by PCR using the primer set P1, P2 and P4 (Figure 5.1B). To determine if the deletion of survivin would have any effect on cellular proliferation, we performed growth curves over a seven-day period on MEFs transduced by cre or control virus. Results showed that MEFs infected with control virus grew exponentially under the experimental conditions, however MEFs lacking survivin following expression of cre-recombinase, failed to proliferate (Figure 5.2A, Jiang Y). To determine if the failure of cell growth (Figure 5.2A) was a consequence of increased cell death we performed caspase activity assays on the MEF cells. As shown in Figure 5.2B (Jiang Y), MEFs lacking survivin had a minimal increase in caspase activity and no increase in TUNEL positive cells when compared with the control MEFs (Jiang Y, data not shown). This data strongly argues against an anti-apoptotic role for survivin in the MEF cells. To understand the mechanism of the growth defect in the MEFs lacking survivin, we evaluated the subcellular localization pattern of survivin during mitosis, in the primary MEFs. Survivin localized to the kinetochore during prophase (Figure 5.4A) to the spindle midzone during anaphase (Figure 5.4B) and to the midbody during cytokinesis (Figure 5.4C) – a pattern consistent with its function as a chromosomal passenger protein in the survivin f/f cells. MEFs lacking survivin exhibited enlarged, irregular and multiple nuclei (Figure 5.4D, Figure 5.4E). Quantitative analysis revealed the maximum nuclear diameter of 108 the control survivin f/f MEFs to be 10 – 20μm with up to a four fold increase in the nuclear diameter of survivin -/- MEFs. Flow cytometric analysis performed following serum starvation and restimulation, showed that survivin -/- cells entered S-phase normally, as evident by >10 fold increase in BrdU incorporation at 20 hours post stimulation, similar to the control cells (Figure 5.5B and Figure 5.5C). However, in the survivin -/- cells, a polyploid (> 4N nuclear content) population of cells (Figure 5.5C and Figure 5.5D) accumulated at a high rate. The accumulation of large and multinucleated cells, in combination with polyploidy, suggests a proliferation defect, secondary to a failure in cytokinesis in the survivin deficient MEFs. Survivin is important in the maintenance of the human cancer cell transformed phenotype, as demonstrated by human tumor studies in vitro and in vivo. (Altieri, 2006; Li and Ling, 2006). We hypothesized that survivin would also prove to be essential for the maintenance of transformation in MEFs transformed by c-Myc and H-RasV12. Towards this end, the human oncogenes c-Myc and HRasV12 were co-expressed by retroviral transduction which resulted in the transformation of the survivin f/f primary MEFs (Land et al., 1983; Weinberg et al., 1997). Subsequently, I deleted the mouse survivin gene using adenoviral expression of Cre recombinase (Ad-Cre). Twenty-four hours following infection of Ad-cre or Ad-GFP as a control, the cells were plated for colony formation in 100 mm tissue culture dishes at a concentration of 30X103 cells/plate. 7-10 days after plating, the colonies were harvested and stained for visualization (see materials 109 and methods). While the myc/Ras transformed cells infected with Ad-GFP gave rise to abundant colonies with a transformed morphology, this colony formation was about eight-fold reduced in the cells treated with Ad-cre (Figure 5.5 A and Figure 5.5 B). These data suggests an absolute requirement of survivin for the maintenance of the myc/ras transformed phenotype. To determine if survivin plays a role in the initiation of transformation, I coexpressed (using retroviral transduction method) human survivin with either cMyc or H-Ras V12 human oncogenes in primary MEFs and subjected them to similar in vitro colony formation assays as described above. While cells transduced with control virus or survivin alone did not give rise to transformed colonies, those cells co-expressing survivin and c-Myc, or survivin and H-RasV12 (used as positive control) gave abundant transformed looking colonies implying an important role of survivin in cancer initiation (Figure 5.6). In summary, from these data we can conclude that survivin is essential for the proliferation of the primary MEFs but does not play a role in their survival. Survivin is also required for the maintenance of a transformed phenotype in MEFs transformed with c-Myc and H-RasV12. Furthermore, these preliminary results suggest that survivin plays a role in the initiation of tumor formation. Confirmatory experiments, including soft agar colony formation assay and tumor assays in nude mice are currently underway to further characterize the transformed phenotype of MEFs co-expressing survivin and c-Myc or survivin and H-RasV12. 110 These data, demonstrating the oncogenic potential of survivin is novel and has far reaching implications with respect to therapeutic targeting of survivin in cancer cells. It also supports a cautious approach to the proposed use of survivin as an anti-apoptotic therapeutic agent in the treatment of human degenerative diseases. 111 Figure 5.1 Conditional knockout strategy of Survivin in primary mouse embryonic fibroblasts A, The genomic locus of mouse survivin is shown with the exons represented by blue boxes. The positions of the two lox-P sites are indicated as well as the primers used to amplify the floxed or deleted allelle. B, A representative PCR illustrating the products of predicted sizes obtained after conditional deletion of survivin. The floxed allele gives a 560 bp product while the deleted allele gives a 425 bp product. 112 A B Svn f/f MEFs Virus: none Control Cre Figure 5.1 Conditional knockout strategy of Survivin in primary mouse embryonic fibroblasts 113 Figure 5.2 Survivin is essential for proliferation but not for survival of primary MEFs A, Growth curve of Svn f/f primary MEFs infected with control (blue) or cre (pink) retrovirus. The y-axis represents the number of cells while the x-axis represents days. B, Caspase 9 activity assay in the same MEFs described in A. The y-axis represents luminescence detected in a spectrophotometer using the Caspase-glo assay kit (Promega).The cells lacking survivin exhibit a minimal increase in caspase 9 activity. 114 A Growth Curves 200000 Cell number control 150000 Cre 100000 50000 0 0 1 2 3 4 5 6 7 Days B Luminescence Caspase Activity 14000 12000 10000 8000 6000 4000 2000 0 Control virus (survivin f/f) Cre virus (survivin -/-) Figure 5.2 Survivin is essential for proliferation but not for survival of primary MEFs 115 Figure 5.3 Primary MEFs lacking survivin display an abnormal nuclear morphology A,B and C, Survivin (Texas Red) localization relative to DNA (Hoechst 33258, the blue color has been changed to white for better visualization) α-tubulin (FITC) in control cells at prophase (survivin localized to kinetochore), anaphase (survivin at spindle midzone) and cytokinesis (survivin at midbody). The survivin localization is marked by white arrow(s) and 5 μm scale is shown. D and E, Aberrantly enlarged nuclear morphology survivin deficient primary MEFs. F, a control cell in interphase shown as a reference. G, Quantification of the maximum nuclear diameter in control and cre infected MEFs measured using Zeiss LSM image browser. The y-axis represents nuclear diameter in μm. 116 A B C Figure 5.3 Primary MEFs lacking survivin display an abnormal nuclear morphology 117 Figure 5.3 (contd.) D E F 118 Figure 5.3 (contd.) G Maximum nuclear diameter in μ m 90 80 70 60 50 control Svn f/f Cre Svn f/f 40 30 20 10 0 119 Figure 5.4 Loss of Survivin results in polyploidy BrdU (FITC)/ PI flow cytometric analysis in control viral (A) or cre viral infected cells (C) serum starved for 48 hours and control virus (B) or cre virus infected cells (D) 20 hours after restimulation (B). P2 indicates BrdU positive cells in S-phase, P3 includes cells with 2N ploidy, P4 shows cells with 4N DNA content and P5 has cells with ploidy of 8N and above . The percentages of cells in P5 is indicated. 120 survivin f/f A survivin f/f 0 hours post stimulation 20 hours post stimulation 4.8% 8.6% P5 P5 survivin -/C B survivin -/- D 0 hours post stimulation 20 hours post stimulation 13.1% 20.6% P5 P5 Figure 5.4 Loss of Survivin results in polyploidy 121 Figure 5.5 Survivin is essential for the maintenance of the myc/ras transformed phenotype in MEFs A, In vitro colony formation assay (see materials and methods) on Ad-GFP and Ad-cre infected MEFs which have been transformed by c-Myc and H-RasV12. The colony formation is severely compromised when survivin is deleted by Ad-cre, B, Quantification of colonies showing about seven fold decrease in survivin deleted cells 122 c-Myc+H-Ras(V12) transformed MEFs Ad-GFP infected Ad-Cre infected Figure 5.5 Survivin is essential for the maintenance of the myc/ras transformed phenotype in MEFs 123 c-Myc + H-Ras(V12) Survivin Control Survivin + Survivin + c-Myc H-Ras(V12) Figure 5.6 Survivin collaborates with c-Myc and H-RasV12 in transforming wt primary MEFs In vitro colony formation assay (see materials and methods) on primary MEFs transduced by retrovirus as indicated. No transformed colonies grew from cells infected with control virus or survivin alone. Abundant transformed colonies grew from cells co-expressing Survivin+c-Myc, survivin+H-RasV12 or c-Myc+HRasV12 indicating survivin can collaborate with other oncogenes in initiating transformation 124 CHAPTER 6 DISCUSSION E2F7 and E2F8 form unique sub-class in the murine E2F family The E2F family of transcription factors is conserved from plants to mammals with the exception of yeast. The E2F family increases in complexity along the evolutionary ladder as exemplified by the fact that Drosophila has only two E2F family members – one activator and one repressor, whereas the mammalian E2Fs to date have at least ten E2F transcripts arising from eight distinct genomic loci. E2F7 and E2F8 are two unique family members based on the presence of duplicated highly conserved DNA binding domains and an absence of any other domain conserved across the E2Fs 1-6. Structural analysis suggests that the presence of two DNA binding domains in tandem abrogates the requirement for dimerization with DP for DNA binding. This is also supported by the fact that the integrity of both DNA binding domains is required for DNA 125 binding by E2F7 and E2F8. The expression of E2F7 and E2F8 are cell cycle regulated at least in part via E2F mediated auto-regulation. The tissue expression patterns of E2F7 and E2F8 overlap in adult mouse indicating a common functional theme for these last two identified murine E2F family members. When overexpressed in mouse embryonic fibroblasts (MEFs), E2F7 and E2F8 inhibit cellular proliferation, with concomitant downregulation of various E2F target genes, suggesting a potential tumor suppressor function of these proteins. Future studies will give mechanistic insights in to E2F7-8 mediated repression as well as their roles in development, differentiation and tumorigenesis. Survivin is essential for the proliferation and transformation of MEFs Survivin is an E2F transcriptional target and an essential gene in murine development. During cell division, survivin ensures high fidelity chromosomal segregation and cytokinesis. MEFs conditionally deleted for survivin exhibit a severe proliferation defect with increased polyploidy suggesting a defect in cytokinesis. Survivin also plays an anti-apoptotic role in various normal and malignant tissues, but this function is not apparent in the MEFs since there is no increased caspase activity or apoptosis evident after conditional deletion of survivin. Survivin is abundantly and ubiquitously expressed during embryogenesis, but is absent in the terminally differentiated adult tissue. 126 However, survivin is highly expressed in virtually every human cancer making it an important molecular target in cancer therapy. Conditional deletion of survivin in MEFs transformed by overexpression of c-Myc and H-RasV12, reveal a requirement for this gene in the maintenance of a transformed phenotype in these cells. This is consistent with what has been observed in several different human cancer cells after disruption of survivin with RNA interference. The requirement for proliferation and transformation of MEFs support current efforts and clinical trials through targeting of survivin in human tumors. In addition, preliminary evidence presented here, suggests a novel role for survivin in initiating transformation in MEFs. Soft agar colony formation assay and in vivo tumor formation in nude mice are currently ongoing to rigorously test the oncogenic potential of survivin. These data strongly advocate a cautious approach in the proposed use of survivin gene therapy for human degenerative diseases. 127 LIST OF REFERENCES Altieri DC. (2003) Survivin, versatile modulation of cell division and apoptosis in cancer. Oncogene. Nov 24;22(53):8581-9. Altieri DC. (2004) Molecular circuits of apoptosis regulation and cell division control: the survivin paradigm.J Cell Biochem. Jul 1;92(4):656-63. Altieri DC. (2006) Targeted therapy by disabling crossroad signaling networks: the survivin paradigm. Mol Cancer Ther. Mar;5(3):478-82. Review. Altura RA, Olshefski RS, Jiang Y, Boue DR. (2003) Nuclear expression of Survivin in paediatric ependymomas and choroid plexus tumours correlates with morphologic tumour grade. Br J Cancer. Nov 3;89(9):17439 Arvanitis C, Felsher DW. (2006 ) Conditional transgenic models define how MYC initiates and maintains tumorigenesis. Semin Cancer Biol. Aug;16(4):3137. Beaudoing, E., Freier, S., Wyatt, J. R., Claverie, J.-M., and Gautheret, D. (2000) Genome Res. 10, 1001–1010 Berns K, Hijmans EM, Koh E, Daley GQ, Bernards R. (2000) A genetic screen to identify genes that rescue the slow growth phenotype of c-myc null fibroblasts.Oncogene. Jul 6;19(29):3330-4. Blanc-Brude OP, Mesri M, Wall NR, Plescia J, Dohi T, Altieri DC. Therapeutic targeting of the survivin pathway in cancer: initiation of mitochondrial 128 apoptosis and suppression of tumor-associated angiogenesis. Clin Cancer Res. 2003 Jul;9(7):2683-92. Brehm, A. et al. (1998) Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391, 597-601. Brehm, A., Miska, E. A., McCance, D. J., Reid, J. L., Bannister, A. J., and Kouzarides, T. (1998) Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391, 597–601 Caldas H, Jiang Y, Holloway MP, Fangusaro J, Mahotka C, Conway EM, Altura RA.( 2005) Survivin splice variants regulate the balance between proliferation and cell death.Oncogene. Mar 17;24 (12):1994-2007 Caldas H, Jiang Y, Holloway MP, Fangusaro J, Mahotka C, Conway EM, Altura RA. (2005) Survivin splice variants regulate the balance between proliferation and cell death.Oncogene. Mar 17;24(12):1994-2007. Cam, H., and Dynlacht, B. D. (2003) Emerging roles for E2F: Beyond the G1/S transition and DNA replication Cancer Cell 3, 311–316 Ceol, C. J., and Horvitz, H. R. (2001) dpl-1 DP and efl-1 E2F Act with lin-35 Rb to Antagonize Ras Signaling in C. elegans Vulval Development Mol. Cell 7, 461–473 Christensen J, Cloos P, Toftegaard U, Klinkenberg D, Bracken AP, Trinh E, Heeran M, Di Stefano L, Helin K. (2005) Characterization of E2F8, a novel E2F-like cell-cycle regulated repressor of E2F-activated transcription. Nucleic Acids Res Sep 22;33(17):5458-70. Colnaghi R, Connell CM, Barrett RM, Wheatley SP. (2006) Separating the antiapoptotic and mitotic roles of survivin. J Biol Chem. Nov 3;281(44):334506. Conway EM, Pollefeyt S, Steiner-Mosonyi M, Luo W, Devriese A, Lupu F, Bono F, Leducq N, Dol F, Schaeffer P, Collen D, Herbert JM. (2002) Deficiency of survivin in transgenic mice exacerbates Fas-induced apoptosis via mitochondrial pathways. Gastroenterology. Aug;123(2):619-31. Cox AD, Der CJ. (2002) Ras family signaling: therapeutic targeting. Cancer Biol Ther. Nov-Dec;1(6):599-606. de Bruin A, Maiti B, Jakoi L, Timmers C, Buerki R, Leone G. Identification and characterization of E2F7, a novel mammalian E2F family member capable 129 of blocking cellular proliferation. J Biol Chem. 2003 Oct 24;278(43):420419. Epub 2003 Jul 31. Deb-Basu D, Aleem E, Kaldis P, Felsher DW. (2006) CDK2 is required by MYC to induce apoptosis. Cell Cycle. Jun;5(12):1342-7. DeGregori J, Johnson DG. (2006) Distinct and Overlapping Roles for E2F Family Members in Transcription, Proliferation and Apoptosis. Curr Mol Med. Nov;6(7):739-48. DeGregori, J., Leone, G., Miron, A., Jakoi, L.and Nevins, J. R. (1997) Distinct roles for E2F proteins in cell growth control and apoptosis. Proc. Natl Acad. Sci. USA 94, 7245-7250. Di Stefano L, Jensen MR, Helin K. (2003) E2F7, a novel E2F featuring DPindependent repression of a subset of E2F-regulated genes. EMBO J. Dec 1;22(23):6289-98. Dohi T, Beltrami E, Wall NR, Plescia J, Altieri DC. (2004) Mitochondrial survivin inhibits apoptosis and promotes tumorigenesis. J Clin Invest;114: 1117– 27. Duronio,R. J., O'Farrell, P. H., Xie, J E., Brook, A.and Dyson, N. (1995). The transcription factor E2F is required for S phase during Drosophila embryogenesis. Genes Dev. 9, 1445-1455 Dyson, N. (1998) The regulation of E2F by pRB-family proteins. Genes Dev. 12, 2245–2262 Eckelman BP, Salvesen GS, Scott FL. (2006) Human inhibitor of apoptosis proteins: why XIAP is the black sheep of the family. EMBO Rep. Oct;7(10):988-94. Fangusaro JR, Caldas H, Jiang Y, Altura RA. (2006) Survivin: an inhibitor of apoptosis in pediatric cancer.Pediatr Blood Cancer. Jul;47(1):4-13. Ferreira, R., Magnaghi-Jaulin, L., Robin, P., Harel-Bellan, A., and Trouche, D. (1998) The three members of the pocket proteins family share the ability to repress E2F activity through recruitment of a histone deacetylase. Proc. Natl. Acad. Sci. U. S. A. 95, 10493–10498 Field, S. J. et al. (1996). E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell 85, 549-561 130 Flemington, E. K., Speck, S. H., and Kaelin, W. G., Jr. (1993) E2F-1-mediated transactivation is inhibited by complex formation with the retinoblastoma susceptibility gene product. Proc. Natl. Acad. Sci. U. S. A. 90, 6914–6918 Fukuda S, Pelus LM. (2006) Survivin, a cancer target with an emerging role in normal adult tissues. Mol Cancer Ther. May;5(5):1087-98. Giehl K. (2005) Oncogenic Ras in tumour progression and metastasis. Biol Chem. Mar;386(3):193-205. Harbour, J. W. & Dean, D. C. (2000) Chromatin remodeling and Rb activity. Curr. Opin. Cell Biol. 12, 685-689. Helin, K., Harlow, E., and Fattaey, A. (1993) Inhibition of E2F-1 transactivation by direct binding of the retinoblastoma protein. Mol. Cell. Biol. 13, 6501–6508 Hoffman WH, Biade S, Zilfou JT, Chen J, Murphy M. (2002) Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J Biol Chem. Feb 1;277(5):3247-57. Humbert, P. O. et al. (2000a).E2F4 is essential for normal erythrocyte maturation and neonatal viability. Mol. Cell 6, 281-291 Humbert, P. O. et al. (2000b). E2f3 is critical for normal cellular proliferation. Genes Dev. 14, 690-703 Ishida, S. et al. (2001) Role for E2F in control of both DNAreplication and mitotic functions as revealed from DNA microarray analysis. Mol. Cell. Biol. 21, 4684-4699. J. W., and Dean, D. C. (2000) Exit from G1 and S phase of the cell cycle is regulated by repressor complexes containing HDAC-Rb-hSWI/SNF and Rb-hSWI/SNF. Cell 101, 79–89 Jiang Y, de Bruin A, Caldas H, Fangusaro J, Hayes J, Conway EM, Robinson ML,Altura RA. (2005) Essential role for survivin in early brain development.J Neurosci. Jul 27;25(30):6962-70. Jiang Y, Saavedra HI, Holloway MP, Leone G, Altura RA. (2004) Aberrant regulation of survivin by the RB/E2F family of proteins. J Biol Chem. Sep 24;279(39):40511-20. Johnson DG, Degregori J. (2006) Putting the Oncogenic and Tumor Suppressive Activities of E2F into Context. Curr Mol Med. Nov;6(7):731-8. 131 Johnson, D. G., Schwarz, J. K., Cress, W. D., and Nevins, J. R. (1993) Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature 365, 349–352 Kanda N, Seno H, Konda Y, et al. (2004) STAT3 is constitutively activated and supports cell survival in association with survivin expression in gastric cancer cells. Oncogene;23:4921–9. Kent, W. J. (2002) BLAT 656–664 The BLAST-Like Alignment Tool. Genome Res. 12, Kosugi, S., and Ohashi, Y. (2002) E2Ls, E2F-like Repressors of Arabidopsis That Bind to E2F Sites in a Monomeric Form. J. Biol. Chem. 277, 16553–16558 Kovesdi, I., Reichel, R., and Nevins, J. R. (1987) Role of an Adenovirus E2 Promoter Binding Factor in E1A-Mediated Coordinate Gene Control Proc. Natl. Acad. Sci. U. S. A. 84, 2180–2184 Land, H., L. F. Parada, R. A. Weinberg. (1983). Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature 304:596 Lees, J. A. et al. (1993) The retinoblastoma protein binds to a family of E2F transcription factors. Mol. Cell. Biol. 13, 7813-7825. Lens SM, Medema RH. (2003) The survivin/Aurora B complex: its role in coordinating tension and attachment. Cell CycleNov-Dec;2(6):507-10. Lens SM, Vader G, Medema RH. (2006) The case for Survivin as mitotic regulator. Curr Opin Cell Biol. Dec;18(6):616-22. Lens SM, Wolthuis RM, Klompmaker R, Kauw J, Agami R, Brummelkamp T, Kops G, Medema RH. (2003) Survivin is required for a sustained spindle checkpoint arrest in response to lack of tension. EMBO J. Jun 16;22(12):2934-47 Leone, G. et al. (1998) E2F3 activity is regulated during the cell cycle and is required for the induction of S phase. Genes Dev. 12, 2120-2130. Leone, G. et al. (2000) Identification of a novel E2F3 product suggests a mechanism for determining specificity of repression by Rb proteins. Mol. Cell. Biol. 20, 3626-3632. Leone, G. et al. (2001) Myc requires distinct E2F activities to induce S phase and apoptosis. Mol. Cell 8, 105-113 132 Leone, G., DeGregori, J., Yan, Z., Jakoi, L., Ishida, S., Williams, R. S., and Nevins, J. R. (1998) E2F3 activity is regulated during the cell cycle and is required for the induction of S phase Genes Dev. 12, 2120–2130 Leone, G., Nuckolls, F., Ishida, S., Adams, M., Sears, R., Jakoi, L., Miron, A., and Nevins, J. R. (2000) Identification of a Novel E2F3 Product Suggests a Mechanism for Determining Specificity of Repression by Rb Proteins. Mol. Cell. Biol. 20, 3626–3632 Li F, Brattain MG. (2006) Role of the Survivin gene in pathophysiology. Am J Pathol. Jul;169(1):1-11. Li F, Ling X. (2006) Survivin study: an update of "what is the next wave"? J Cell Physiol. Sep;208(3):476-86. Li F, Yang J, Ramnath N, Javle MM, Tan D. (2005) Nuclear or cytoplasmic expression of survivin: what is the significance? Int J Cancer. Apr 20;114(4):509-12. Lin, W.C., Lin, F.T. and Nevins, J.R. (2001) Selective induction of E2F1 in response to DNA damage, mediated by ATM-dependent phosphorylation. Genes Dev., 15, 1833-1844. Lindeman, G. J. et al. (1998) A specific, nonproliferative role for E2F-5 in choroid plexus function revealed by gene targeting. Genes Dev. 12, 1092-1098. Liu T, Brouha B, Grossman D. (2004). Rapid induction of mitochondrial events and caspase-independent apoptosis in Survivin-targeted melanoma cells. Oncogene 23(1):39–48. Logan N, Graham A, Zhao X, Fisher R, Maiti B, Leone G, La Thangue NB. E2F8: an E2F family member with a similar organization of DNA-binding domains to E2F-7. Oncogene. 2005 Jul 21;24(31):5000-4. Logan, N., Delavaine, L., Graham, A., Reilly, C., Wilson, J., Brummelkamp,T. R., Hijmans, E. M., Bernards, R., and La Thangue, N. B. (2004) E2F-7: a distinctive E2F family member with an unusual organization of DNAbinding domains. Oncogene 23, 5138–5150 Lukas, C. et al. (1999) Accumulation of cyclin B1 requires E2F and cyclin-Adependent rearrangement of the anaphase-promoting complex. Nature 401, 815-881. Luo, R. X., Postigo, A. A. & Dean, D. C. (1998) Rb interacts with histone deacetylase to repress transcription. Cell 92, 463-473. 133 Luo, R. X., Postigo, A. A., and Dean, D. C. (1998) Rb interacts with histone deacetylase to repress transcription. Cell 92, 463–473 Magnaghi-Jaulin, L. et al. (1998) Retinoblastoma protein represses transcription by recruiting a histone deacetylase. Nature 391, 601-605. Maiti B, Li J, de Bruin A, Gordon F, Timmers C, Opavsky R, Patil K, Tuttle J, Cleghorn W, Leone G.( 2005) Cloning and characterization of mouse E2F8, a novel mammalian E2F family member capable of blocking cellular proliferation. J Biol Chem. May 6;280 (18):18211-20. Mariconti, L., Pellegrini, B., Cantoni, R., Stevens, R., Bergounioux, C., Cella, R., and Albani, D. (2002) The E2F Family of Transcription Factors from Arabidopsis thaliana J. Biol. Chem. 277, 9911–9919 Muller, H. et al. (2001) E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis. Genes Dev. 15, 267-285. Nevins, J. R. (1998) Toward an Understanding of the Functional Complexity of the E2F and Retinoblastoma Families. Cell Growth & Differ. 9, 585–593 Nevins, J. R., DeGregori, J., Jakoi, L. & Leone, G. (Academic, San Diego, 1997) in Methods in Enzymology (ed. Dunphy,W. G.) 678. Nevins, J. R., DeGregori, J., Jakoi, L., and Leone, G. (1997) E2F3 activity is regulated during the cell cycle and is required for the induction of S phase. Methods Enzymol. 283, 205–219 Nguyen HG, Ravid K. (2006) Tetraploidy/aneuploidy and stem cells in cancer promotion: The role of chromosome passenger proteins. J Cell Physiol. Jul;208(1):12-22. Ogawa, H., Ishiguro, K., Gaubatz, S., Livingston, D. M., and Nakatani, Y. (2002) A Complex with Chromatin Modifiers That Occupies E2F- and MycResponsive Genes in G0 Cells. Science 296, 1132–1136 Okada H, Bakal C, Shahinian A, Elia A, Wakeham A, Suh WK, Duncan GS, Ciofani M, Rottapel R, Zuniga-Pflucker JC, Mak TW. (2004) Survivin loss in thymocytes triggers p53-mediated growth arrest and p53-independent cell death.J Exp Med. Feb 2;199(3):399-410. Pear, W. S., Nolan, G. P., Scott, M. L., and Baltimore, D. (1993) Production of High-Titer Helper-Free Retroviruses by Transient Transfection. Proc. Natl. Acad. Sci. U. S. A. 90, 8392–8396 134 Pear,W. S., Nolan, G. P., Scott, M. L. and Baltimore, D. (1993) Production of high-titer helper-free retroviruses by transient transfection. Proc. Natl Acad. Sci. USA 90, 8392-8396. Powers, J.T., Hong, S., Mayhew, C.N., Rogers, P.M., Knudsen, E.S. and Johnson, D.G. (2004) E2F1 uses the ATM signaling pathway to induce p53 and Chk2 phosphorylation and apoptosis.Mol. Cancer Res., 2, 20314. Rempel, R. E. et al. (2000) Loss of E2F4 activity leads to abnormal development of multiple cellular lineages. Mol. Cell. 6, 293-306. Ren, B., Cam, H., Takahashi, Y., Volkert T., Terragni, J., Young, R. A., and Dynlacht, B. D. (2002) E2F integrates cell cycle progression with DNA repair, replication, and G2/M checkpoints Genes Dev. 16, 245–256 Rogoff, H.A., Pickering, M.T., Frame, F.M., Debatis, M.E., Sanchez, Y., Jones, S. and Kowalik, T.F. (2004) Apoptosis associated with deregulated E2F activity is dependent on E2F1 and Atm/Nbs1/Chk2. Mol. Cell. Biol. , 24, 2968-77. Royzman, I., Whittaker, A. J. and Orr-Weaver, T. L. (1997). Mutations in Drosophila DP and E2F distinguish G1-S progression from an associated transcriptional program. Genes Dev. 11, 1999-2011 Saavedra HI, Maiti B, Timmers C, Altura R, Tokuyama Y, Fukasawa K, Leone G. (2003) Inactivation of E2F3 results in centrosome amplification. Cancer Cell. Apr;3(4):333-46. Schwede, T., Kopp, J., Guex, N., and Peitsch, M. C. (2003) SWISS-MODEL: an automated protein homology-modeling server Nucleic Acids Res. 31, 3381–3385 Sears, R., Ohtani, K., and Nevins, J. R. (1997) Identification of positively and negatively acting elements regulating expression of the E2F2 gene in response to cell growth signals. Mol. Cell. Biol. 17, 5227–5235 Sellers, W. R., Rodgers, J. W., Kaelin, and W. G., Jr. (1995) A potent transrepression domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F sites. Proc. Natl. Acad. Sci. U. S. A. 92, 11544– 11548 Sommer KW, Schamberger CJ, Schmidt GE, Sasgary S, Cerni C. (2003) Inhibitor of apoptosis protein (IAP) survivin is upregulated by oncogenic cH-Ras. Oncogene. Jul 3;22(27):4266-80 135 Stevaux, O., Dimova, D., Frolov, M. V., Taylor-Harding, B., Morris, E., and Dyson, N. (2002) Distinct mechanisms of E2F regulation by Drosophila RBF1 and RBF2. EMBO J. 21, 4927–4937 Stevens, C., Smith, L. and La Thangue, N.B. (2003) Chk2 activates E2F-1 in response to DNA damage. Nat. Cell Biol., 5, 401-9 Suzuki, A., and Hemmati-Brivanlou, A. (2000) Xenopus Embryonic E2F Is Required for the Formation of Ventral and Posterior Cell Fates during Early Embryogenesis. Mol. Cell 5, 217–229 Takahashi, Y., Rayman, J. B., and Dynlacht, B. D. (2000) Analysis of promoter binding by the E2F and pRB families in vivo: distinct E2F proteins mediate activation and repression Genes Dev. 14, 804–816 Tatsuka M, Sato S, Kitajima S, Suto S, Kawai H, Miyauchi M, Ogawa I, Maeda M, Ota T, Takata T. (2005) Overexpression of Aurora-A potentiates HRAS-mediated oncogenic transformation and is implicated in oral carcinogenesis. Oncogene. Feb 3;24(6):1122-7. Timmers C, Sharma N, Opavsky R, Maiti B, Wu L, Wu J, Orringer D, Trikha P, Saavedra HI, Leone G. (2007) E2f1, E2f2, and E2f3 control E2F target expression and cellular proliferation via a p53-dependent negative feedback loop. Mol Cell Biol. Jan;27(1):65-78. Trimarchi, J. M., and Lees, J. A. (2002) Sibling rivalry in the E2F family. Nat. Rev. Mol. Cell. Biol. 3, 11–20 Trimarchi, J. M., Fairchild, B., Wen, J., and Lees, J. A. (2001) The E2F6 transcription factor is a component of the mammalian Bmi1-containing polycomb complex Proc. Natl. Acad. Sci. U. S. A. 98, 1519–1524 Trouche, D., Le Chalony, C., Muchardt, C., Yaniv, M., and Kouzarides, T.(1997) RB and hbrm cooperate to repress the activation functions of E2F1. Proc. Natl. Acad. Sci. U. S. A. 94, 11268–11273 Tsai, K. Y. et al. (1998) Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and extends survival of Rb-deficient mouse embryos. Mol. Cell 2, 293-304. Tsantoulis PK, Gorgoulis VG. (2005) Involvement of E2F transcription factor family in cancer. Eur J Cancer.Nov;41(16):2403-14. Uren AG, Wong L, Pakusch M, Fowler KJ, Burrows FJ, Vaux DL, Choo KH. (2000) Survivin and the inner centromere protein INCENP show similar 136 cell-cycle localization and gene knockout phenotype. Curr Biol. Nov 2;10(21):1319-28. Vader G, Kauw JJ, Medema RH, Lens SM. (2006a) Survivin mediates targeting of the chromosomal passenger complex to the centromere and midbody. EMBO Rep. Jan;7(1):85-92. Vader G, Medema RH, Lens SM. (2006b) The chromosomal passenger complex: guiding Aurora-B through mitosis. J Cell Biol. Jun 19;173(6):833-7. Vandel, L., Nicolas, E., Vaute, O., Ferreira, R., Ait-Si-Ali, S., and Trouche, D. (2001) Transcriptional repression by the retinoblastoma protein through the recruitment of a histone methyltransferase. Mol. Cell. Biol. 21, 6484– 6494 Vong QP, Cao K, Li HY, Iglesias PA, Zheng Y. (2005) Chromosome alignment and segregation regulated by ubiquitination of survivin. Science. Dec 2;310(5753):1499-504. Wang, Z.M., Yang, H. and Livingston, D.M. (1998) Endogenous E2F-1 promotes timely G0 exit of resting mouse embryo fibroblasts. Proc. Natl. Acad. Sci. USA, 95, 15583-6. Weinberg, R. A. (1997). The cat and mouse games that genes, viruses, and cells play. Cell 88:573 Weintraub, S. J. et al. (1995) Mechanism of active transcriptional repression by the retinoblastoma protein. Nature 375, 812-815. Weintraub, S. J., Prater, C. A.& Dean,D. C. (1992) Retinoblastoma protein switches the E2F site from positive to negative element. Nature 358, 259261. Wheatley SP, McNeish IA. (2005) Survivin: a protein with dual roles in mitosis and apoptosis. Int Rev Cytol.;247:35-88. Wu, L., Timmers, C., Maiti, B., Saavedra, H. I., Sang, L., Chong, G. T., Nuckolls, F., Giangrande, P., Wright, F. A., Field, S. J., Greenberg, M. E., Orkin, S., Nevins, J. R., Robinson, M. L., and Leone, G. (2001) The E2F1-3 transcription factors are essential for cellular proliferation. Nature 414, 457–462 Xing Z, Conway EM, Kang C, Winoto A. (2004) Essential role of survivin, an inhibitor of apoptosis protein, in T cell development, maturation, and homeostasis. J Exp Med. Jan 5;199(1):69-80. 137 Yamasaki, L. et al. (1996) Tumor induction and tissue atrophy in mice lacking E2F-1. Cell 85, 537-548. Yamasaki, L. et al. (1998) Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rb1(+/-) mice. Nature Genet. 18, 360-364. Yang D, Welm A, Bishop JM. (2004) Cell division and cell survival in the absence of survivin.Proc Natl Acad Sci U S A. Oct 19;101(42):15100-5. Zangemeister-Wittke U, Simon HU. (2004) An IAP in action: the multiple roles of survivin in differentiation, immunity and malignancy. Cell Cycle. Sep;3(9):1121-3. Zhang T, Otevrel T, Gao Z, Ehrlich SM, Fields JZ, Boman BM. (2001) Evidence that APC regulates survivin expression: a possible mechanism contributing to the stem cell origin of colon cancer. Cancer Res ;61:8664– 7. Zhang, H. S., Gavin, M., Dahiya, A., Postigo, A. A., Ma, D., Luo, R. X., Harbour, JW, Dean DC. (2000) Exit from G1 and S phase of the cell cycle is regulated by repressor complexes containing HDAC-Rb-hSWI/SNF and Rb-hSWI/SNF. Cell. Mar 31;101(1):79-89. Zhang, H. S., Postigo, A. A. & Dean, D. C. (1999) Active transcriptional repression by the Rb-E2F complex mediates G1 arrest triggered by p16INK4a, TGFb, and contact inhibition. Cell 97, 53-61. Zheng, N., Fraenkel, E., Pabo, C. O., and Pavletich, N. P. (1999) Genes Dev. 13,666–674 Ziebold,U., Reza, T., Caron, A. and Lees, J. A. (2001) E2F3 contributes both the inappropriate proliferation and to the apoptosis arising in Rb mutant embryos. Genes Dev. 15, 386-391. 138
