Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Table S1. Primer pairs use for real-time quantitative RT-PCR Studies Gene symbol ABCG2 EpCAM Nestin CK7 CK14 CK19 CD44H CD56 CD90 CD117 CD133 CD34 VEGF PD-ECGF beta-actin Sequence 5’-3’ Amplicon size F:5'CACCTTATTGGCCTCAGGAA3' R:5'CCTGCTTGGAAGGCTCTATG3' F:5'TTCTCAATGCAGGGTCTA3' R:5'CCTTTATCTCAGCCTTCTC3' F:5'AGCCAGATCGCTCAGGTCC3' R:5'TGTTTGCAGCCGGGAGTT3' F:5'CATCGAGATCGCCACCTACC3' R:5'GCCACTGCTACTGCCACCA3' F:5'GATGCCGAGGAATGGTTC3' R:5'ATGCTGAGCTGGGACTGC3' F:5'CGCCAAGATCCTGAGTGA3' R:5'CAGTAACCTCGGACCTGCT3' F:5'AAAGGAGCAGCACTTCAGGA3' R:5'TGTGTCTTGGTCTCTGGTAGC3' F:5'AACATCAGCAGCGAAGAA3' R:5'AGGTACATGGACTGGGAGT3' F:5'TGAAGGTCCTCTACTTATCCG3' R:5'CACGAGGTGTTCTGAGCC3' F:5'CAGCCCCTATCCTGGAAT3' R:5'TTGCTTGAATGTTGGTCTTT3' F:5'CCGCAGGAGTGAATCTTT3' R:5'AGGACTCGTTGCTGGTGA3' F:5'GTCTACTGCTGGTCTTGGC3' R:5'AGTGCAATCAGGGTCTTTT3' F:5’CGCAAGAAATCCCGGTATAAGT3’ R:5’TGCTTTCTCCGCTCTGAGC3’ F:5'GGCTGCTGTATCGTGGGT3' R:5'TGAGAATGGAGGCTGTGATG3' F:5'TTGTTACAGGAAGTCCCTTGCC3' R:5'ATGCTATCACCTCCCCTGTGTG3' 206bp 1 136bp 120bp 118bp 152bp 158bp 128bp 161bp 169bp 157bp 133bp 157bp 116bp 118bp 101bp Table S2. Antibodies and TMA scoring criteria Antibody CK7 1 Manufacturer DAKO, Denmark CK19 1 DAKO, Denmark OV6 2 R&D , USA Nestin 3 Santa Cruz, USA CD133 4, 5 Abgent, USA CD44H 6 Bender medsystems ABCG2 7 CHEMIC, USA EPCAM 8 ABR CD34 9, 10 DAKO, Denmark VEGF11 Calbiochem, U.S.A PD-EGGF 12 Santa Cruz, USA Staining pattern Cytoplasmic and membrane Cytoplasmic and membrane Cytoplasmic And membrane Cytoplasmic and membrane Cytoplasmic and membrane Cytoplasmic and membrane Cytoplasmic and membrane Cytoplasmic and membrane cytoplasmic Cytoplasmic and membrane Cytoplasmic and membrane Dilution Time§ 1:100 Score† Species negative positive 1h <5% ≥5% Mouse monoclonal 1:100 1h <5% ≥5% Mouse monoclonal 1:100 Overnight <5% ≥5% Mouse monoclonal 1:100 Overnight <5% ≥5% Mouse monoclonal 1:50 Overnight ≤1% >1% Mouse monoclonal 1:100 Overnight ≤10% >10% Mouse monoclonal 1:40 Overnight ≤10% >10% Mouse monoclonal 1:40 Overnight <5% ≥5% Mouse monoclonal 1:100 Overnight ≤55.5 >55.5 ‡ Mouse monoclonal 1:100 Overnight <30% ≥30% Rabbit monoclonal 1:100 Overnight <5% ≥5% Mouse monoclonal Abbreviations: CK19, Cytokeratin 19; CK7, Cytokeratin 7; MVD, microvessel density; VEGF, vascular endothelial growth factor; PD-ECGF, platelet derived endothelial cell growth factor. § 1h was incubated at room temperature and overnight was at 4 ℃ † The staining intensity of positive tumor cell was moderate or strong. ‡ Any brownstained endothelial cell or endothelial cell cluster that was clearly separated from adjacent microvessels, tumor cells, and connective elements was counted as one microvessel, irrespective of the presence of a vessel lumen. MVD of each cylinder (0.785mm2/field) was examined. The cut-off value was the median MVD of whole population. 2 Reference 1 Durnez A, Verslype C, Nevens F, et al. The clinicopathological and prognostic relevance of cytokeratin 7 and 19 expression in hepatocellular carcinoma. A possible progenitor cell origin. Histopathology 2006;49:138-51. 2 Libbrecht L, Desmet V, Van Damme B, et al. The immunohistochemical phenotype of dysplastic foci in human liver: correlation with putative progenitor cells. J Hepatol 2000;33:76-84. 3 Ikota H, Kinjo S, Yokoo H, et al. Systematic immunohistochemical profiling of 378 brain tumors with 37 antibodies using tissue microarray technology. Acta Neuropathol 2006;111:475-82. 4 Ma S, Chan KW, Hu L, et al. Identification and characterization of tumorigenic liver cancer stem/progenitor cells. Gastroenterology 2007;132:2542-56. 5 Zeppernick F, Ahmadi R, Campos B, et al. Stem cell marker CD133 affects clinical outcome in glioma patients. Clin Cancer Res 2008;14:123-9. 6 Yang GH, Fan J, Xu Y, et al. Osteopontin combined with CD44, a novel prognostic biomarker for patients with hepatocellular carcinoma undergoing curative resection. Oncologist 2008;13:1155-65. 7 Yoh K, Ishii G, Yokose T, et al. Breast cancer resistance protein impacts clinical outcome in platinum-based chemotherapy for advanced non-small cell lung cancer. Clin Cancer Res 2004;10:1691-7. 8 Yamashita T, Forgues M, Wang W, et al. EpCAM and alpha-fetoprotein expression defines novel prognostic subtypes of hepatocellular carcinoma. Cancer Res 2008;68:1451-61. 9 Sun HC, Tang ZY, Li XM, et al. Microvessel density of hepatocellular carcinoma: its relationship with prognosis. J Cancer Res Clin Oncol 1999;125:419-26. 10 Poon RT, Ng IO, Lau C, et al. Tumor microvessel density as a predictor of recurrence after resection of hepatocellular carcinoma: a prospective study. J Clin Oncol 2002;20:1775-85. 11 Lee TK, Poon RT, Yuen AP, et al. Regulation of angiogenesis by Id-1 through hypoxia-inducible factor-1alpha-mediated vascular endothelial growth factor up-regulation in hepatocellular carcinoma. Clin Cancer Res 2006;12:6910-9. 12 Zhou J, Tang ZY, Fan J, et al. Capecitabine inhibits postoperative recurrence and metastasis after liver cancer resection in nude mice with relation to the expression of platelet-derived endothelial cell growth factor. Clin Cancer Res 2003;9:6030-7. 3 Table S3. Descriptive statistics of immunohistochemical variables in cohort 2 (n=314) Immunohistochemical variables CK19 CK7 ABCG2 CD133 Nestin CD44 OV6 EPCAM MVD VEGF PD-ECGF HSCs/HPCs profile predictive model The simplified model Number Percentage (%) Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive ≤55.5 >55.5 Negative Positive 274 40 251 63 247 67 233 81 226 88 223 91 174 140 264 50 157 157 118 196 87.26 12.74 79.94 20.06 78.66 21.34 74.20 25.80 71.97 28.03 71.02 28.98 55.41 44.59 84.08 15.92 50.00 50.00 37.60 62.40 Negative 112 35.67 Positive Low High Low risk Moderate risk High risk 202 163 151 75 138 101 64.33 51.91 48.09 23.89 43.95 32.16 Abbreviations: HSCs, hepatic stem cells; HPCs, hepatic progenitor cells; CK19, cytokeratin 19; CK7, cytokeratin 7; MVD, microvessel density; VEGF, vascular endothelial growth factor; PD-ECGF, platelet derived endothelial cell growth factor. 4 Table S4. Multivariate analyses of HSCs/HPCs clinicopathological characteristics in cohort 2(n=314) profile OS predictive model with RFS Variables Hazard ratio (95% CI) P value Hazard ratio (95% CI) P value GGT (>54 U/l vs.≤54 U/l) Tumor encapsulation (none vs. complete) Tumor differentiation (III-IV vs. I-II) Tumor size (>5 cm vs.≤5 cm) Tumor number (multiple vs.single) Vascular invasion (yes vs.no) HSCs/HPCs predictive model (HSCs/HPCshigh vs. HSCs/HPCslow) 1.96(1.45-2.66) <0.0001 1.68(1.23-2.30) 0.001 1.18(0.88-1.59) 0.263 n.a. 1.28(0.94-1.75) 1.42(1.06-1.92) 1.58(1.09-2.27) 1.66(1.14-2.40) 0.119 0.020 0.014 0.008 n.a. n.a. 1.52(1.02-2.27) 1.61(1.07-2.43) 0.038 0.023 2.09(1.55-2.82) <0.0001 2.39(1.75-3.27) <0.0001 Abbreviations: HSCs, hepatic stem cells; HPCs, hepatic progenitor cells; AFP, alpha-fetoprotein; GGT, serum gammaglutamyl transferase; RFS, Relapse-free survival; OS, overall survival; n.a., not applicable. Multivariate analysis, Cox proportional hazards regression model. Variables were adopted for their prognostic significance by univariate analysis. 5 Table S5. Correlation between HSCs/HPCs clinicopathological characteristics in cohort 2(n=314) Patients Age(y) † HBsAg HCV‡ Liver cirrhosis Child-Pugh score ‡ ALT(U/l) † GGT(U/l) † AFP(ng/ml) † Tumor encapsulation§ Tumor size (cm) Tumor number Vascular invasion TNM stage Tumor differentiation CLIP stage Prophylactic TACE VEGF PD-ECGF MVD† Recurrence time(m) Recurrence types model and HSCs/HPCs predictive model Variables Sex predictive Female Male Mean±SD Negative Positive Negative Positive No Yes A B Mean±SD Mean±SD Mean±SD complete no ≤5 >5 Single Multiple No Yes I II-III I-II III-IV 0+1 2+3+4 No Yes negative Positive negative Positive Mean±SD ≤24 >24 Type I low high 163 26 137 52.7±10.3 30 133 161 2 15 148 163 0 46.8±53.7 84.0±71.9 625.8±1183.5 95 66 85 78 141 22 137 26 119 44 120 43 128 35 95 68 72 91 63 100 78.0±89.2 34 35 46 151 22 129 52.0±11.6 25 126 148 3 11 140 149 2 46.9±58.6 75.2±80.4 512.47±1103.9 79 71 86 65 126 25 130 21 109 42 107 44 120 31 97 54 46 105 49 102 110.3±118.4 61 39 72 6 P value 0.709 0.616 0.667 0.674 0.538 0.230 0.987 0.304 0.382 0.26 0.393 0.448 0.612 0.871 0.585 0.838 0.279 0.012 0.252 0.007 0.131 0.660 Type II 9 13 Type III 14 15 Abbreviations: HSCs, hepatic stem cells; HPCs, hepatic progenitor cells; AFP, alpha-fetoprotein; ALT, alanine aminotransferase; GGT, gammaglutamyl transferase; TACE, transcatheter arterial chemoembolization; MVD, microvessel density; TNM, tumor-node-metastasis; CLIP, Cancer of Liver Italian Program. †Student’s t-test was used for comparison between groups. ‡Fisher’s exact tests; Chi-square tests for all the other analyses. § 3 cases without capsulation information were not calculated. 7 Table S6. The ROC analyses of Variables for Recurrence and Death Recurrence Variables Death AUC 95%CI AUC 95%CI Tumor size 0.507 0.451 to 0.562 0.550 0.494 to 0.606 Tumor number 0.53 0.491 to 0.569 0.564 0.527 to 0.600 Vascular invasion 0.517 0.478 to 0.557 0.550 0.513 to 0.588 Edmondson stage 0.527 0.477 to 0.576 0.562 0.514 to 0.611 Tumor encapsulation 0.474 0.419 to 0.530 0.542 0.485 to 0.598 TNM stage 0.556 0.507 to 0.605 0.600 0.553 to 0.646 Clip stage 0.516 0.471 to 0.561 0.547 0.503 to 0.591 GGT 0.55 0.495 to 0.605 0.620 0.565 to 0.675 AFP 0.492 0.436 to 0.547 0.511 0.454 to 0.568 Nestin 0.575 0.526 to 0.623 0.552 0.502 to 0.601 CD133 0.554 0.506 to 0.602 0.587 0.540 to 0.633 CD44 0.622 0.574 to 0.669 0.600 0.552 to 0.647 HPCs/HSCs profile 0.62 0.566 to 0.674 0.660 0.607 to 0.713 MVD 0.689 0.638 to 0.740 0.624 0.570 to 0.679 The simplified model 0.751 0.702 to 0.800 0.710 0.657 to 0.763 Abbreviations: ROC, receiver operating characteristic; AUC, area under the curve; 95% CI; 95% confidence interval; AFP, alpha-fetoprotein; GGT, gammaglutamyl transferase; MVD, microvessel density; TNM, tumor-node-metastasis; CLIP, Cancer of Liver Italian Program; HSCs, hepatic stem cells; HPCs, hepatic progenitor cells. 8 Table S7. Univariate analyses of factors associated with survival and recurrence in cohort 3 (n=73) OS Variables Sex (male vs. female) Age (>52y vs.≤52y) HBsAg (positive vs.negative) HCV (positive vs.negative) Child–Pugh score (B vs.A) Liver cirrhosis (yes vs.no) GGT (>54 U/l vs.≤54 U/l) ALT (>75 U/l vs.≤75 U/l) AFP (>20 ng/ml vs.≤20 ng/ml) Tumor differentiation (III-IV vs.I-II) Tumor encapsulation vs.complete) (none Tumor size (>5 cm vs.≤5 cm) Tumor number (multiple vs.single) Vascular invasion (yes vs.no) TNM stage (II+III vs.I) CLIP stage 2+3+4 vs 0+1 Prophylactic TACE(yes vs.no) CD44 (positive vs.negative) Nestin (positive vs.negative) RFS Hazard ratio P Hazard ratio (95% CI) value (95% CI) 1.45(0.19-10.8 6) 0.50(0.20-1.22 ) 0.94(0.31-2.80 ) 0.05(0-325175 .8) 8.73(1.94-39.3 2) 0.86(0.29-2.59 ) 4.61(1.54-13.8 1) 1.18(0.34-4.02 ) 4.67(1.37-15.9 6) 1.31(0.52-3.28 ) 1.54(0.64-3.72 ) 4.96(1.80-13.6 8) 0.91(0.31-2.74 ) 3.30(1.20-9.09 ) 3.09(1.03-9.25 ) 7.03(2.78-17.8 1) 0.82(0.34-1.97 ) 2.82(1.15-6.92 ) 2.06(0.82-5.15 0.71 5 0.12 8 0.90 8 0.70 6 0.00 5 0.79 5 0.00 6 0.79 5 0.01 4 0.56 8 0.33 7 0.00 2 0.87 3 0.02 1 0.04 4 0.00 0 9 0.66 0.02 3 0.12 1.70(0.23-12.67) 0.63(0.27-1.45) 1.01(0.34-3.00) 0.05(0.00-81724. 00) 4.41(0.57-34.11) 0.42(0.17-1.03) 1.66(0.71-3.90) 0.64(0.15-2.74) 2.95(1.09-8.03) 1.12(0.46-2.75) 0.85(0.37-2.00) 2.85(1.19-6.81) 0.56(0.17-1.91) 2.48(1.01-6.10) 2.85(1.05-7.73) 2.61(1.11-6.14) 1.29(0.55-3.01) 2.47(1.03-5.91) 2.28(0.96-5.45) P valu e 0.60 3 0.27 5 0.98 1 0.67 9 0.15 5 0.05 8 0.24 1 0.54 6 0.03 4 0.80 3 0.71 7 0.01 8 0.35 6 0.04 8 0.04 0 0.02 8 0.56 1 0.04 2 0.06 CD133 (positive vs.negative) MVD (>55.5 vs.≤55.5) ) 0.63(0.23-1.73 ) 2.68(0.97-7.38 ) The simplified model moderate risk vs. low risk high risk vs. low risk 2.02(0.41-10.0 3) 4.57(1.02-20.4 5) 5 0.37 0 0.05 6 0.06 6 0.38 8 0.04 7 2.14(0.93-4.94) 3.40(1.25-9.24) 1.76(0.34-9.09) 7.01(1.60-30.80) 3 0.07 5 0.01 7 0.00 3 0.49 8 0.01 0 Abbreviations: ALT, alanine aminotransferase; GGT, serum gammaglutamyl transferase; AFP, alpha-fetoprotein; CK19, cytokeratin 19; CK7, cytokeratin 7; MVD, microvessel density; VEGF, vascular endothelial growth factor; PD-ECGF, platelet derived endothelial cell growth factor; TNM, tumor-node-metastasis; CLIP, Cancer of Liver Italian Program; 95%CI, 95% confidence interval; RFS, Relapse-free survival; OS, overall survival. Univariate analysis, Cox proportional hazards regression model. 10