Download the determination of single nucleotide polymorphisms in dna of

THE DETERMINATION OF SINGLE NUCLEOTIDE
POLYMORPHISMS IN DNA OF ARSENIC EXPOSED HUMANS
AND IT USE AS A BIOMARKER FOR CANCER PREDICTION
JAMES K. KEARNS
PhD. Candidate in Chemistry at the University of Massachusetts at Amherst
Under the Guidance of Dr. Ashok Kumar Giri at the Indian Institute of Chemical
Biology in Kolkata, India in affiliation with the Indo-US Science and Technology Forum
September - December 2009
ABSTRACT
Chronic arsenic toxicity through consumption of contaminated drinking water is a
major environmental health issue worldwide. It has previously been shown that chronic
arsenic exposure adversely affects the immune system and paves way for opportunistic
infections. Yet, only a fraction of individuals exposed to arsenic develop arsenic-induced
skin lesions, indicating that genetic composition of individuals might be responsible for
their preferential susceptibility. Hence, in this study, we wanted to determine single
nucleotide polymorphisms (SNP’s) of the immune response related genes in the exposed
individuals of West Bengal India. This study utilized the techniques of PCR (Polymerase
Chain Reaction) and the Sanger DNA Sequencing Method. SNP’s create changes in the
sequence of mRNA, which alter the amino acid sequence of the final protein, thereby
leading to subtle changes in the 3 dimensional conformations of the protein products,
consequently affecting their function. These genetic effects were cross verified with the
case histories of patients to further increase the knowledge of how arsenic susceptibility
can be modulated by subtle changes in the genome.
AKNOWLEGEMENTS
I would like to express my sincere gratitude and thanks to Dr. Ashok Kumar Giri,
research advisor of molecular biology and human genetics at the Indian Institute of
Chemical Biology who has been my guide during my time as a RISE Fellow. He
provided me with direction, a knowledge base, and acted as a true role model. Also a big
thanks goes out to the Nilanjana Banarjee my mentor who taught me the process of PCR
and the Sanger Sequencing method. Her ability to explain the process was exceptional. I
must also recognize the other members of Dr. Giri’s lab, Mayukh Banerjee, Udayan
Bhattacharya, Manjari Kundu, Sujay Nandy, and Pritha Ghosh thank you all for your
help.
CONTENTS
TITLE PAGE……………………………………………………………………………1
ABSTRACT……………………………………………………………………………..2
AKNOWLEDGEMENTS…..…………………………………………………………...3
1.1 INTODUCTION.……………………………………………….……………………4
1.1.1 Blood Collection and DNA Isolation………………………………………….......4
1.1.2 PCR and Amplification of Specific Gene/DNA Sequences…………………….....4
1.1.3 The Sanger Sequencing Method and the Interpretation of Data…………………...4
1.2 METHODS…………………………………………………………………………..6
1.2.1 Primers……………………………………………………………………………...6
1.2.2 Reaction Mixture (RM)…………………………………………………………......7
1.2.3 Conditions for the Reaction…………………………………………………………8
1.2.4 Photo of Gel……………………………………………………………………… ...8
1.2.5 Dilution of Stock Primers…………………………………………………………...8
1.2.6 Chemical methods of sequencing DNA……………………………………………..9
1.2.7 Electronic interpretation of sequencing……………………………………………..9
1.3 RESULTS AND DISCUSSION……………………………………………………..11
1.4 CONCLUSION………………………………………………………………………12
1.5 REFERENCES………………………………………………………………………13
1.1 INTODUCTION
Arsenic is recognized as a major environmental contaminant that causes severe
health problems in populations chronically exposed to arsenic contaminated drinking
water. In the region of West Bengal, India, groundwater in 9 of 18 districts is
contaminated with arsenic, far above the acceptable limit of 10 μg/L1,2. Chronic arsenic
exposure causes various skin manifestations that include hyperkeratosis on palms and
soles, hypopigmentation, characteristic raindrop pigmentations on chest, back, and legs,
and in extreme cases, in situ carcinoma or Bowen disease, Basal Cell Carcinoma and
Squamous Cell Carcinoma4. These skin lesions generally develop with a latency period
spanning more than 10 years from first exposure; however, the latency period may be as
short as 6 months, depending on the concentration of arsenic in drinking water, volume of
intake, and health and nutritional status5. In addition to skin lesions, other clinical
manifestations of chronic arsenicism include peripheral neuropathy, peripheral vascular
diseases, respiratory problems, conjunctivitis, reproductive abnormalities, and ultimately,
malignancies in a number of organs including skin, lung, and bladder6. Although it is
well known that arsenic can cause cellular toxicity and carcinogenicity, underlying
mechanism is yet undefined. Although more than 6 million individuals in West Bengal,
India, are endemically exposed to inorganic arsenic, only 300,000 people show arsenicinduced skin lesions, hallmarks of chronic arsenic exposure3. This fact clearly elucidates
that genetic variability plays a critical role in susceptibility toward arsenic toxicity.
Hence, in this study, we looked at some SNPs of some immune response genes, viz., IL1,
IL2 and TNF- genes that might be implicated in arsenic susceptibility.
1.2 METHODS
1.2.1 Site and Study Group
Murshidabad district is highly affected with arsenic contaminated ground water.
This study was conducted on 10 arsenic exposed skin lesion individuals and 10 arsenic
unexposed individuals (controls). Unexposed individuals were recruited from the districts
of West Midnapore, where arsenic level in drinking water ranges from 3 -10 µg/l i.e. well
within the permissible limits established by WHO. The arsenic exposed individuals were
chosen from Murshidabad, a highly affected district where arsenic content in drinking
water ranges from 50-1200 µg/l. The exposed individuals were chosen on the basis of the
arsenic content in water and urine samples and arsenic induced skin lesions, since skin
lesions are hallmarks of chronic arsenic toxicity. A blind interview was performed based
on a structured questionnaire that elicited information about demographic factors, lifestyle, occupation, diet, smoking, medical and residential histories. Detailed information
on current and lifetime and current smoking was obtained. Only non-smoker individuals
were selected as study participants to avoid confounding due to smoking. An expert
dermatologist/ with fifteen years of experience identified the characteristic arsenicinduced skin lesions / helped in the recruitment of exposed study participants. Samples
were collected only from those subjects who provided informed consent to participate
and fulfilled the inclusion criteria. Arsenic exposed skin lesion individuals and unexposed
individuals were matched with respect to age, sex and socio-economic status. Individuals
ranging from 15 to 65 years of age with at least 10 years of exposure were selected as
arsenic exposed study participants. Occupationally, the majority of the study participants
were farmers and household workers. Since arsenic-containing pesticides were not very
common in the area studied, and arsenic mining is not done in this region occupational
exposure to arsenic was ruled out. Therefore, drinking water is the principle source of
arsenic in this region. Water and urine samples were collected from the subjects on the
same day, which carried and marked with code numbers. Information from questionnairesourced data on the subjects was not revealed before arsenic analyses were completed.
This study was conducted in accord with the Helsinki II Declaration and approved by the
institutional ethics committee.
1.2.2 Blood Collection and DNA Isolation
Genomic DNA extraction from blood was carried out using standard protocols
(Sambrook1989). To amplify the exonic regions, polymerase chain reaction (PCR) was
performed in a 25-μL reaction volume using standard buffer, MgCl2 (1.5 μM),
deoxyribonucleotides (200 μM), and Taq polymerase supplied by Life Technologies,
Carlsbad, CA, USA) in an MJ Research PTL-225 thermocycler (GeneAmp-9700;
Applied Biosystems, Foster City, CA, USA). The sequences of flanking primers
(Clontec, Mountain View, CA, USA) The regions which were screened were the
promoter regions of the cytokine genes TNF-a and IL2 genes for the following
polymorphisms- rs1800629 (-308G>A) and rs2069762 (-714T>G), which were
associated previously with various forms of cancer. The sequences of flanking primers
were
as
follows-5’CTTGCTCTTGTCCACCACAA3’(F)and
5’ACCCCCAAAGACTGACTGAA3’(R)for
IL2
gene
promoter
and
5’GCCCCTCCCAGTTCTAGTTC3’(F) and 5’AAAGTTGGGGACACACAAGC3’(R)
for TNF-a gene promoter.
All PCR products were analyzed by agarose (1.5%) or polyacrylamide gel (6%)
electrophoresis, stained with ethidium bromide, and photographed under ultraviolet light.
Bidirectional sequencing was done in an ABI prism 3100 DNA sequencer (Applied
Biosystems), using Big Dye Terminator, pretreated with Exo-SAP (Amersham Life
Sciences,
Little
Chalfont,
Buckinghamshire,
UK).
Samples
with
ambiguous
chromatograms, as well as those containing SNPs observed in only a single sample, were
subjected to a second, independent round of amplification, followed by DNA sequencing.
The sequence chromatograms obtained were analyzed with Chromas 2.32 (Technelysium
Pty Ltd, Tewantin, Australia) and compared with the reference sequence for genotyping
of respective amplicons.
1.2.3 Reaction Mixture (RM) for PCR
The reaction mixture is a solution that allows for the conditions to amplify DNA of a
given region.
1. Water = 16.9 L * 10 = 169.0 L
2. Buffer = 2.5 L * 10 = 25 L
3. Mg = 2.5 L * 10 = 25 L
4. dNTP = 1L *10 = 10 L
5. FP = 0.5 L * 10 = 5 L
6. RP = 0.5 L * 10 = 5 L
7. Taq =0.1 L x10 = 1 L
1.2.4 Conditions for the Reaction
The reaction conditions were: 58  C; for the following cycles 30/30/30.
1.2.5 Photo of Gel showing that DNA has been successfully amplified.
1.2.6 Dilution of Stock Primers
Primers Main Stock = 100 pico moles
10xWorking Stock = 10 picomoles
Dilute Primers/DNA with TE (Tris EDTA)
1. DNA
2. Amplify by PCR
3. Amplified Product
4. Sanger Sequence
5. Read the Sequence
6. Identify SNP’s
7. Calculate Risk (Graph Pad Instat 3)
1.2.7 Chemical methods of sequencing DNA
1. Template
1.1 PCR Produc (~5-10 ng/100bp read) increase amount accordingly
1.2 Plasmid (~100-150ng)
2. Reaction Set Up
2.1 BDT RR Mix (2.5x) – 1 L
2.2 Sequence Buffer (5x) – 3.5 L
2.3 Primer -3-5 Pico mole
2.4 Template – Accordingly
3. Thermal Cycling Parameter
3.1 1 min. 95C
3.2 10 sec. 95C
3.3 5sec. 50C (Note: May Vary)
3.4 4 min. 60C
3.5 Steps 2-5: 25 cycles.
3.6 Hold at 4C.
Note: May vary
Tm  50 C  54C use 50C
55C  Tm  58C use 55C
Tm  58 C use two step cycle a.) 95C for 1 minute b.) 60C for 4 minutes
Consider using higher denaturation time if:
A.) Template rich in GC.
B.) Premature termination – i.e secondary
Make 96  C (3-5 minute)/95  C (20-30 sec.) DMSO or Betaine use 3-5% in
both steps
4. Precipitation
4.1 10-20 L of reaction volume
4.2 Add 2.5 L 125 mM EDTA + 30 L EtOH (RT) Mix by pipetting Incubate at
RT for 20-30 minutes (Temperature?)
4.3 Centrifuge at 10000-12000 g for 20 minutes (for plate 3050 g for 40 minutes)
4.4 Invert Spin (transfer to new container pulse spin at 100 g for 5 seconds so that
liquid remains down in tube)
4.5 Add 30 L 70% Ethanol
4.6 Centrifuge at 10000 (Mention rpm or g) for 10 minutes then @ 3050 g for 40
minutes
4.7 Invert Spin
4.8 Add 30 L 70% EtOH
4.9 Centrifuge at 10000 g for 10 minutes.
4.10 Invert spin
4.11 Air dry (5-10 minutes)
5. Load with 10 L of Hidi formaldihyde.
1.2.9 Electronic interpretation of sequencing
1. Open the word file “promoter” – IL gene sequencing “ATGC”
2. Use the “Chromas 3” Program to find the chromatogram of current sequence.
3. Match from Chromas 3 into word file promoter.
4. Matching from list
Figure 1: Chromatogram generated from the Sanger Sequencing Method using the
Chromas software program.
Figure 2: Chromatogram generated from the Sanger Sequencing Method using the
Chromas software program at the base sequence 162 a T-A heterozygous peak can be
seen.
10.3 RESULTS AND DISCUSSION
Molecular biology is a key element in predicting cancer formation in arsenic exposed
populations. Single nucleotide polymorphisms or SNPs are target in the genetic code for
locating susceptibility or resistance to cancer. SNPs in the promoter regions of IL2 and
TNF-a genes have been associated with changes in gene expression. These changes result
in changes in biological function of the inflammation pathways, which lead to cancer and
other disorders.
In this study, we used arsenic concentration in urine as a marker of arsenic
exposure and found that mean total arsenic concentration in urine from arsenic exposed
individuals was significantly higher compared to the unexposed individuals. This data
acted as a cross reference to understand the link between arsenic exposure and cancer
expression Molecular biology is a key tool in predicting cancer development propensity
in arsenic exposed individuals. Single nucleotide polymorphisms or SNP’s are target in
the genetic code for locating susceptibility or resistance to cancer and other disease
outcomes. SNP’s have been associated with changes in gene expression, which are
usually subtle, but might result in long term effects. Most often, a complex molecular
cross-talk, arising out of the specific genetic composition of an individual results in his
degree of susceptibility towards a toxicant, arsenic in this case. Thus, looking at different
SNPs of several candidate genes and the cumulative effect of their different possible
combinations is required to understand the molecular mechanism of development of
arsenicosis. In our case, we looked at the polymorphisms of a few candidate
inflammatory pathways genes which might ultimately result in changes in biological
function of the inflammation pathways, and subsequently lead to cancer and other
disorders via a compromised immune system.
1.4 CONCLUSION
The final analysis of our study our results demonstrate that chronic arsenic
exposure has a negative effect on the pro-inflammatory genes of the immune system IL1
(Interleukin 1), IL2 (Interleukin 2), and TNF- (Tumor Necrotic Factor – Alpha) of the
exposed individuals. These regions will continue to be investigated for the presence of
SNP’s. It is hypothesized that the up/down regulation of these proteins is directly
correlated with cancer formation and resistance in the arsenic exposed population.
Further investigations must be carried out to clarify our initial findings.
1.5 REFERENCES
1. Frost FJ, Muller T, Petersen HV, Thomson B, Tollestrup K. 2003. Identifying US
populations for the study of health effects related to drinking water arsenic. J Expo Anal
Environ. Epidemiol. 13: 231–239.
2. WHO. 2004. Chemical Fact Sheets, Arsenic. Guidelines for Drinking-Water Quality,
3rd ed. Vol 1. Geneva: World Health Organization, 306-308.
3. Chakraborti D, Rahman MM, Paul K, Chowdhury UK, Sengupta MK, Lodh D, et al.
2002. Arsenic calamity in the Indian subcontinent: what lessons have been learned?
Talanta 58:3–22.
4. Basu A, Ghosh P, Das JK, Banerjee A, Ray K, Giri AK. 2004.Micronuclei as
biomarkers of carcinogen exposure in populations exposed to arsenic through drinking
water in
West Bengal, India: a comparative study in three celltypes. Cancer Epidemiol
Biomarkers Prev 13:820–827.
5. Haque R, Mazumder DN, Samanta S, Ghosh N, Kalman D, Smith MM, et al. 2003.
Arsenic in drinking water and skin lesions: dose-response data from West Bengal, India.
Epidemiology 14:174–182.
6. IARC. 2004. Some Drinking Water Disinfectants and Contaminants, Including
Arsenic. IARC Monogr Eval Carcinog Risks Hum 84:1–477.