Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
THE DETERMINATION OF SINGLE NUCLEOTIDE POLYMORPHISMS IN DNA OF ARSENIC EXPOSED HUMANS AND IT USE AS A BIOMARKER FOR CANCER PREDICTION JAMES K. KEARNS PhD. Candidate in Chemistry at the University of Massachusetts at Amherst Under the Guidance of Dr. Ashok Kumar Giri at the Indian Institute of Chemical Biology in Kolkata, India in affiliation with the Indo-US Science and Technology Forum September - December 2009 ABSTRACT Chronic arsenic toxicity through consumption of contaminated drinking water is a major environmental health issue worldwide. It has previously been shown that chronic arsenic exposure adversely affects the immune system and paves way for opportunistic infections. Yet, only a fraction of individuals exposed to arsenic develop arsenic-induced skin lesions, indicating that genetic composition of individuals might be responsible for their preferential susceptibility. Hence, in this study, we wanted to determine single nucleotide polymorphisms (SNP’s) of the immune response related genes in the exposed individuals of West Bengal India. This study utilized the techniques of PCR (Polymerase Chain Reaction) and the Sanger DNA Sequencing Method. SNP’s create changes in the sequence of mRNA, which alter the amino acid sequence of the final protein, thereby leading to subtle changes in the 3 dimensional conformations of the protein products, consequently affecting their function. These genetic effects were cross verified with the case histories of patients to further increase the knowledge of how arsenic susceptibility can be modulated by subtle changes in the genome. AKNOWLEGEMENTS I would like to express my sincere gratitude and thanks to Dr. Ashok Kumar Giri, research advisor of molecular biology and human genetics at the Indian Institute of Chemical Biology who has been my guide during my time as a RISE Fellow. He provided me with direction, a knowledge base, and acted as a true role model. Also a big thanks goes out to the Nilanjana Banarjee my mentor who taught me the process of PCR and the Sanger Sequencing method. Her ability to explain the process was exceptional. I must also recognize the other members of Dr. Giri’s lab, Mayukh Banerjee, Udayan Bhattacharya, Manjari Kundu, Sujay Nandy, and Pritha Ghosh thank you all for your help. CONTENTS TITLE PAGE……………………………………………………………………………1 ABSTRACT……………………………………………………………………………..2 AKNOWLEDGEMENTS…..…………………………………………………………...3 1.1 INTODUCTION.……………………………………………….……………………4 1.1.1 Blood Collection and DNA Isolation………………………………………….......4 1.1.2 PCR and Amplification of Specific Gene/DNA Sequences…………………….....4 1.1.3 The Sanger Sequencing Method and the Interpretation of Data…………………...4 1.2 METHODS…………………………………………………………………………..6 1.2.1 Primers……………………………………………………………………………...6 1.2.2 Reaction Mixture (RM)…………………………………………………………......7 1.2.3 Conditions for the Reaction…………………………………………………………8 1.2.4 Photo of Gel……………………………………………………………………… ...8 1.2.5 Dilution of Stock Primers…………………………………………………………...8 1.2.6 Chemical methods of sequencing DNA……………………………………………..9 1.2.7 Electronic interpretation of sequencing……………………………………………..9 1.3 RESULTS AND DISCUSSION……………………………………………………..11 1.4 CONCLUSION………………………………………………………………………12 1.5 REFERENCES………………………………………………………………………13 1.1 INTODUCTION Arsenic is recognized as a major environmental contaminant that causes severe health problems in populations chronically exposed to arsenic contaminated drinking water. In the region of West Bengal, India, groundwater in 9 of 18 districts is contaminated with arsenic, far above the acceptable limit of 10 μg/L1,2. Chronic arsenic exposure causes various skin manifestations that include hyperkeratosis on palms and soles, hypopigmentation, characteristic raindrop pigmentations on chest, back, and legs, and in extreme cases, in situ carcinoma or Bowen disease, Basal Cell Carcinoma and Squamous Cell Carcinoma4. These skin lesions generally develop with a latency period spanning more than 10 years from first exposure; however, the latency period may be as short as 6 months, depending on the concentration of arsenic in drinking water, volume of intake, and health and nutritional status5. In addition to skin lesions, other clinical manifestations of chronic arsenicism include peripheral neuropathy, peripheral vascular diseases, respiratory problems, conjunctivitis, reproductive abnormalities, and ultimately, malignancies in a number of organs including skin, lung, and bladder6. Although it is well known that arsenic can cause cellular toxicity and carcinogenicity, underlying mechanism is yet undefined. Although more than 6 million individuals in West Bengal, India, are endemically exposed to inorganic arsenic, only 300,000 people show arsenicinduced skin lesions, hallmarks of chronic arsenic exposure3. This fact clearly elucidates that genetic variability plays a critical role in susceptibility toward arsenic toxicity. Hence, in this study, we looked at some SNPs of some immune response genes, viz., IL1, IL2 and TNF- genes that might be implicated in arsenic susceptibility. 1.2 METHODS 1.2.1 Site and Study Group Murshidabad district is highly affected with arsenic contaminated ground water. This study was conducted on 10 arsenic exposed skin lesion individuals and 10 arsenic unexposed individuals (controls). Unexposed individuals were recruited from the districts of West Midnapore, where arsenic level in drinking water ranges from 3 -10 µg/l i.e. well within the permissible limits established by WHO. The arsenic exposed individuals were chosen from Murshidabad, a highly affected district where arsenic content in drinking water ranges from 50-1200 µg/l. The exposed individuals were chosen on the basis of the arsenic content in water and urine samples and arsenic induced skin lesions, since skin lesions are hallmarks of chronic arsenic toxicity. A blind interview was performed based on a structured questionnaire that elicited information about demographic factors, lifestyle, occupation, diet, smoking, medical and residential histories. Detailed information on current and lifetime and current smoking was obtained. Only non-smoker individuals were selected as study participants to avoid confounding due to smoking. An expert dermatologist/ with fifteen years of experience identified the characteristic arsenicinduced skin lesions / helped in the recruitment of exposed study participants. Samples were collected only from those subjects who provided informed consent to participate and fulfilled the inclusion criteria. Arsenic exposed skin lesion individuals and unexposed individuals were matched with respect to age, sex and socio-economic status. Individuals ranging from 15 to 65 years of age with at least 10 years of exposure were selected as arsenic exposed study participants. Occupationally, the majority of the study participants were farmers and household workers. Since arsenic-containing pesticides were not very common in the area studied, and arsenic mining is not done in this region occupational exposure to arsenic was ruled out. Therefore, drinking water is the principle source of arsenic in this region. Water and urine samples were collected from the subjects on the same day, which carried and marked with code numbers. Information from questionnairesourced data on the subjects was not revealed before arsenic analyses were completed. This study was conducted in accord with the Helsinki II Declaration and approved by the institutional ethics committee. 1.2.2 Blood Collection and DNA Isolation Genomic DNA extraction from blood was carried out using standard protocols (Sambrook1989). To amplify the exonic regions, polymerase chain reaction (PCR) was performed in a 25-μL reaction volume using standard buffer, MgCl2 (1.5 μM), deoxyribonucleotides (200 μM), and Taq polymerase supplied by Life Technologies, Carlsbad, CA, USA) in an MJ Research PTL-225 thermocycler (GeneAmp-9700; Applied Biosystems, Foster City, CA, USA). The sequences of flanking primers (Clontec, Mountain View, CA, USA) The regions which were screened were the promoter regions of the cytokine genes TNF-a and IL2 genes for the following polymorphisms- rs1800629 (-308G>A) and rs2069762 (-714T>G), which were associated previously with various forms of cancer. The sequences of flanking primers were as follows-5’CTTGCTCTTGTCCACCACAA3’(F)and 5’ACCCCCAAAGACTGACTGAA3’(R)for IL2 gene promoter and 5’GCCCCTCCCAGTTCTAGTTC3’(F) and 5’AAAGTTGGGGACACACAAGC3’(R) for TNF-a gene promoter. All PCR products were analyzed by agarose (1.5%) or polyacrylamide gel (6%) electrophoresis, stained with ethidium bromide, and photographed under ultraviolet light. Bidirectional sequencing was done in an ABI prism 3100 DNA sequencer (Applied Biosystems), using Big Dye Terminator, pretreated with Exo-SAP (Amersham Life Sciences, Little Chalfont, Buckinghamshire, UK). Samples with ambiguous chromatograms, as well as those containing SNPs observed in only a single sample, were subjected to a second, independent round of amplification, followed by DNA sequencing. The sequence chromatograms obtained were analyzed with Chromas 2.32 (Technelysium Pty Ltd, Tewantin, Australia) and compared with the reference sequence for genotyping of respective amplicons. 1.2.3 Reaction Mixture (RM) for PCR The reaction mixture is a solution that allows for the conditions to amplify DNA of a given region. 1. Water = 16.9 L * 10 = 169.0 L 2. Buffer = 2.5 L * 10 = 25 L 3. Mg = 2.5 L * 10 = 25 L 4. dNTP = 1L *10 = 10 L 5. FP = 0.5 L * 10 = 5 L 6. RP = 0.5 L * 10 = 5 L 7. Taq =0.1 L x10 = 1 L 1.2.4 Conditions for the Reaction The reaction conditions were: 58 C; for the following cycles 30/30/30. 1.2.5 Photo of Gel showing that DNA has been successfully amplified. 1.2.6 Dilution of Stock Primers Primers Main Stock = 100 pico moles 10xWorking Stock = 10 picomoles Dilute Primers/DNA with TE (Tris EDTA) 1. DNA 2. Amplify by PCR 3. Amplified Product 4. Sanger Sequence 5. Read the Sequence 6. Identify SNP’s 7. Calculate Risk (Graph Pad Instat 3) 1.2.7 Chemical methods of sequencing DNA 1. Template 1.1 PCR Produc (~5-10 ng/100bp read) increase amount accordingly 1.2 Plasmid (~100-150ng) 2. Reaction Set Up 2.1 BDT RR Mix (2.5x) – 1 L 2.2 Sequence Buffer (5x) – 3.5 L 2.3 Primer -3-5 Pico mole 2.4 Template – Accordingly 3. Thermal Cycling Parameter 3.1 1 min. 95C 3.2 10 sec. 95C 3.3 5sec. 50C (Note: May Vary) 3.4 4 min. 60C 3.5 Steps 2-5: 25 cycles. 3.6 Hold at 4C. Note: May vary Tm 50 C 54C use 50C 55C Tm 58C use 55C Tm 58 C use two step cycle a.) 95C for 1 minute b.) 60C for 4 minutes Consider using higher denaturation time if: A.) Template rich in GC. B.) Premature termination – i.e secondary Make 96 C (3-5 minute)/95 C (20-30 sec.) DMSO or Betaine use 3-5% in both steps 4. Precipitation 4.1 10-20 L of reaction volume 4.2 Add 2.5 L 125 mM EDTA + 30 L EtOH (RT) Mix by pipetting Incubate at RT for 20-30 minutes (Temperature?) 4.3 Centrifuge at 10000-12000 g for 20 minutes (for plate 3050 g for 40 minutes) 4.4 Invert Spin (transfer to new container pulse spin at 100 g for 5 seconds so that liquid remains down in tube) 4.5 Add 30 L 70% Ethanol 4.6 Centrifuge at 10000 (Mention rpm or g) for 10 minutes then @ 3050 g for 40 minutes 4.7 Invert Spin 4.8 Add 30 L 70% EtOH 4.9 Centrifuge at 10000 g for 10 minutes. 4.10 Invert spin 4.11 Air dry (5-10 minutes) 5. Load with 10 L of Hidi formaldihyde. 1.2.9 Electronic interpretation of sequencing 1. Open the word file “promoter” – IL gene sequencing “ATGC” 2. Use the “Chromas 3” Program to find the chromatogram of current sequence. 3. Match from Chromas 3 into word file promoter. 4. Matching from list Figure 1: Chromatogram generated from the Sanger Sequencing Method using the Chromas software program. Figure 2: Chromatogram generated from the Sanger Sequencing Method using the Chromas software program at the base sequence 162 a T-A heterozygous peak can be seen. 10.3 RESULTS AND DISCUSSION Molecular biology is a key element in predicting cancer formation in arsenic exposed populations. Single nucleotide polymorphisms or SNPs are target in the genetic code for locating susceptibility or resistance to cancer. SNPs in the promoter regions of IL2 and TNF-a genes have been associated with changes in gene expression. These changes result in changes in biological function of the inflammation pathways, which lead to cancer and other disorders. In this study, we used arsenic concentration in urine as a marker of arsenic exposure and found that mean total arsenic concentration in urine from arsenic exposed individuals was significantly higher compared to the unexposed individuals. This data acted as a cross reference to understand the link between arsenic exposure and cancer expression Molecular biology is a key tool in predicting cancer development propensity in arsenic exposed individuals. Single nucleotide polymorphisms or SNP’s are target in the genetic code for locating susceptibility or resistance to cancer and other disease outcomes. SNP’s have been associated with changes in gene expression, which are usually subtle, but might result in long term effects. Most often, a complex molecular cross-talk, arising out of the specific genetic composition of an individual results in his degree of susceptibility towards a toxicant, arsenic in this case. Thus, looking at different SNPs of several candidate genes and the cumulative effect of their different possible combinations is required to understand the molecular mechanism of development of arsenicosis. In our case, we looked at the polymorphisms of a few candidate inflammatory pathways genes which might ultimately result in changes in biological function of the inflammation pathways, and subsequently lead to cancer and other disorders via a compromised immune system. 1.4 CONCLUSION The final analysis of our study our results demonstrate that chronic arsenic exposure has a negative effect on the pro-inflammatory genes of the immune system IL1 (Interleukin 1), IL2 (Interleukin 2), and TNF- (Tumor Necrotic Factor – Alpha) of the exposed individuals. These regions will continue to be investigated for the presence of SNP’s. It is hypothesized that the up/down regulation of these proteins is directly correlated with cancer formation and resistance in the arsenic exposed population. Further investigations must be carried out to clarify our initial findings. 1.5 REFERENCES 1. Frost FJ, Muller T, Petersen HV, Thomson B, Tollestrup K. 2003. Identifying US populations for the study of health effects related to drinking water arsenic. J Expo Anal Environ. Epidemiol. 13: 231–239. 2. WHO. 2004. Chemical Fact Sheets, Arsenic. Guidelines for Drinking-Water Quality, 3rd ed. Vol 1. Geneva: World Health Organization, 306-308. 3. Chakraborti D, Rahman MM, Paul K, Chowdhury UK, Sengupta MK, Lodh D, et al. 2002. Arsenic calamity in the Indian subcontinent: what lessons have been learned? Talanta 58:3–22. 4. Basu A, Ghosh P, Das JK, Banerjee A, Ray K, Giri AK. 2004.Micronuclei as biomarkers of carcinogen exposure in populations exposed to arsenic through drinking water in West Bengal, India: a comparative study in three celltypes. Cancer Epidemiol Biomarkers Prev 13:820–827. 5. Haque R, Mazumder DN, Samanta S, Ghosh N, Kalman D, Smith MM, et al. 2003. Arsenic in drinking water and skin lesions: dose-response data from West Bengal, India. Epidemiology 14:174–182. 6. IARC. 2004. Some Drinking Water Disinfectants and Contaminants, Including Arsenic. IARC Monogr Eval Carcinog Risks Hum 84:1–477.