Download CCR-15-2448-Supplementary

Supplemental Information
c-Myc alteration determines the therapeutic response to FGFR
inhibitor
Hongyan Liu, Jing Ai, Aijun Shen, Yi Chen, Xinyi Wang, Xia Peng, Hui Chen,
Yanyan Shen, Min Huang, Jian Ding, Meiyu Geng
1
Supplementary materials and methods
Cell Cycle Analysis
Cells were seeded in 6-well plates at a density of 2×105 / mL. After 24 hours,
the cells were treated with drugs or vehicle (DMSO) for 24 hours. Both
adherent and floating cells were harvested and fixed in 70% ethanol over-night
at 4°C. Prior to FACS analysis, cells were washed twice with cold D-PBS and
re-suspended in D-PBS containing 200 μg/mL RNase, 50 μg/mL propidium
iodide，keep away from light and incubated for 30 minutes at room temperature.
Quantitation of the cell cycle distribution was performed on a Becton-Dickinson
FACS Calibur flow cytometer (Becton-Dickinson).
Immunoblotting
For immunoblotting, protein extracts were prepared by washing twice in cold
D-PBS followed by lysis with SDS-lysis buffer (50 mM Tris-HCl, pH7.4,
2%SDS). Lysates were boiled for 10 minutes and cleared by centrifugation at
12,000 × g for 15 minutes at 4°C. The supernatant was collected and
subjected to SDS-PAGE. Immunoblotting analysis were performed according
to the antibody manufacturer’s recommendations. Proteins were resolved
using the NuPAGER NovexR Midi Gel system on 8% to 15% Bis-Tris Gels.
Representative blots are shown from several experiments. Antibodies were
obtained from the following resources: Cell Signaling Technology :
p-FGFR(Tyr653/654),
FGFR1,
FGFR3,
2
FGFR4,
p-FRS2α(Tyr196),
p-FRS2α(Tyr436), PLCγ, STAT3, p-STAT3(Tyr705), p-AKT(Ser473), AKT,
p-ERK1/2(Thr202/Tyr204), ERK1/2, E2F1, FOXO1, CDK4, CDK6, CDK2 , RB,
P-RB(Ser780), cyclinD1, cyclinD2, cyclinD3, P18, P21, and P27; Santa Cruz:
FRS2α, cyclinE; Abcam: FGFR2, c-Myc, P16, GAPDH, and β-actin;
MerkMillipore: p-PLCγ(Tyr783); Calbiochem: Rabbit and Mouse IgG-HRP.
Cell Viability Assay
Cells were seeded in 96-well plates at a density of 3000-30000 cells in
triplicates. After 24 hours, the cells were treated with different concentrations
of the indicated inhibitors and incubated at 37oC. Then, cells were cultured for
3 days and the number of viable cells was measured by CCK-8 cell viability
assay (Dojindo).
Gene Silencing by siRNA
For siRNA experiments, cells were seeded in 6-well plates at a density of
1.5×105/mL. After 24 hours, cells were transfected with siRNAs with
Oligofectamine RNAimax reagent (Invitrogen) according to the manufacturer’s
instructions. After 72 hours, cells were harvested for cell cycle analysis or
subjected to immunoblotting analysis. Cell viability was determined using
Hemocytometer after 0.4% Trypan Blue staining for 10 minutes. The sequence
and catalog No. of the siRNAs in this study as follows:
c-Myc # 5'-(GGACUAUCCUGCUGCCAAGTT)-3'
PLCG1 # 5'-(AAGAAGTCGCAGCGACCCGAG)-3'
STAT3 # 5'-(GCAAAAAGUUUCCUACAAA) -3'
3
Dharmacon siRNA:
ON-Target plus Control pool Non-Targeting pool Human Cat # D-001810-05
ON-Target plus SMARTpool Human MYC Cat # L-003282-02
ON-Target plus SMARTpool Human PLCG1 Cat # L-003559-00
ON-Target plus SMARTpool Human STAT3 Cat # L-003533-00
Quantitative Real-Time PCR
Quantitative real-time PCR was performed using ABIPrism VIIA7 Real-Time
PCR System (Life Technologies, Carlsbad, CA). For detection of c-MYC
expression, total RNA was extracted with TRIzol reagent (Invitrogen, Grand
Island, NY) and subjected to reverse transcription with PrimeScript® RT
reagent Kit (Takara, Mountain View, CA). PCR reactions were performed with
SYBR® Premix Ex Taq™ kit (Takara). Primer for c- MYC were
5’-TCCCAA AGTACCCAAAGGC-3’(sense),
5’-ACTCCAGCCTTGACCCACTC-3’ (anti-sense)
4
Supplementary Table 1. List of PDX models with FGFR2 amplification in
our study (copy number higher than 5)
No.
Tumor
Models
Type
FGFR2 gene copy number
FGFR2 Amplification
FGFR2 mRNA
(SNP6)
(qPCR)
(RNAseq)
1
gastric
GA0033
14
yes
7.88231
2
gastric
GA1224
14
yes
7.74669
3
gastric
GA3055
14
yes
7.66415
5
Supplemental Figure and Figure lengends
Figure S1. FGFR inhibition induces G1 phase cell cycle arrest in
FGFR-addicted cancer cells. A, Dose response curves of BGJ398 and
AZD4547 against FGFR over-activated cancer cells were assessed using
CCK-8 assay. Bars, means ± SD. B, Cell-cycle distribution was analyzed upon
BGJ398 or AZD4547 treatment. Cancer cells were treated with BGJ398 or
AZD4547 at indicated concentrations for 24 hours. Cell cycle distribution was
analyzed using flow cytometry. Bars, means ± SD. *, p < 0.05, **, p < 0.01,
versus vehicle group, using unpaired two-tailed Student’s t test. C, DMS114
cell were treated with BGJ398 or AZD4547 at 0.5 μM for 2, 6, 12, 24, 48 hours
and subjected to immunoblotting.
Figure S2. c-Myc downregulation is essential for FGFR inhibition caused
growth arrest in FGFR-addicted cells. A, Immunoblotting of analysis.
NCI-H1581 and DMS114 cells were treated with BGJ398 at 0.5 μM. NCI-H520
cells and NCI-H2444 cells were treated with AZD4547 at 1 μM or 2 μM for
indicated time (2, 6, 12, 24 hours). B, KG1 cell treated with BGJ398 and
AZD4547 at 0.5 μM for indicated time (12, 24 hours), followed by
immunoblotting analysis. C, NCI-H1581 and KATOIII cells were treated with
scramble or c-Myc siRNAs for 24 hours, followed by AZD4547 treatment for 72
hours (0.5 μM for NCI-H1581, 0.1 μM for KATOIII) before immunobloting was
analyzed (parallel tests for Figure 2B and 2C, left panel). D, NCI-H1581 and
KATOIII cells were treated with scramble or c-Myc siRNAs for 72 hours,
6
followed by immunobloting analysis (parallel tests for Figure 2B and 2C, Right
panel). E, c-Myc was disrupted using (+)-JQ1 at 1 μM in DMS114 cells before
subject to immunoblotting. Cell viability was analyzed. Bars, means ± SD.
Figure S3. c-Myc alteration determines the response to FGFR2 inhibition
in FGFR2-addicted cancer cells. A and B, KATOIII (A) and MFM-223 (B)
cells were treated with BGJ398 and AZD4547 (0.1 μM for KATOIII, 0.5 μM for
MFM-223) for indicated time (2, 6, 12, 24 hours), followed by immunoblotting
analysis. C and D, SUM52PE (C), and NCI-H716 (D) cells treated with
BGJ398 and AZD4547 at 0.5 μM for indicated time (2, 6, 12 hours), followed
by immunoblotting analysis.
Figure S4. c-Myc downregulation determines the response to FGFR3
inhibition in FGFR3-addicted cancer cells. A and B, UMUC14 (A) and
RT112 (B) were treated with BGJ398 and AZD4547 at 0.5 μM for indicated
time (2, 6, 12 hours), followed by immunoblotting analysis. C, c-Myc was
disrupted using c-Myc siRNAs for 72 hours in UMUC14 cell, followed by cell
viability and immunoblotting analysis. Bars, means ± SD. *, p < 0.05, versus
scramble, using unpaired two-tailed Student’s t test
Figure S5. c-Myc downregulation determines the response to FGFR
inhibition of FGFR constitutively activated BaF3/TEL-FGFR cells. A, IC50s
values
of
BGJ398
and
AZD4547
against
BaF3/TEL-FGFR1,
BaF3/TEL-FGFR3 and BaF3/TEL-FGFR4 cells were assessed using CCK-8
assay. Bars, means ± SD. B, BaF3/TEL-FGFR constitutive activated cells
7
were treated with BGJ398, or AZD4547 (0.5 μM for BaF3/TEL-FGFR1 and
BaF3/TEL-FGFR3, 1 μM for BaF3/TEL-FGFR4) for 24 hours, then subjected to
immunoblotting with indicated antibodies.
Figure S6. FGFR inhibition facilitates c-Myc protein degradation in
FGFR-addicted cancer cells. A, NCI-H1581, KATOIII, MFM-223 and
UMUC14 cells were treated with BGJ398 or AZD4547 at 0.5 μM for indicated
time (2, 6, 12, 24 hours). c-Myc mRNA level was examined by RT-PCR and
normalized by that of vehicle control group. Bars, means ± SD. B, sensitivity
of SUM52PE cells stably transfected with MSCV-c-Myc or MSCV-c-MycT58A.
SUM52PE cells stably expressing wild type c-Myc or T58A mutant were
treated with AZD4547 at 0.5 μM for the indicated time, and then subjected to
immunoblotting. C, Dose response curve of BGJ398 and AZD4547 in
NCI-H1581 cells stably expressing c-Myc wild type or c-Myc T58A. Cell
viability was assessed using CCK-8 assay. D, NCI-H1581, KATOIII, NCI-H716,
and UMUC14 cells were treated with scramble or PLCγ siRNAs for 72 hours,
followed by immunoblotting analysis. E, KATOIII and SUM52PE cells were
treated with scramble or STAT3 siRNAs for 72 hours, followed by
immunoblotting analysis.
Figure S7. c-Myc indicates the therapeutic response to FGFR inhibition
in vivo. A, NCI-H1581 xenograft-bearing nude mice were treated with
AZD4547 at the indicated doses or vehicle for 3 or 10 consecutive days.
8
Tumor tissues resected after last dose were subjected to immunoblotting with
indicated antibodies. B and C, NCI-H716 xenograft-bearing nude mice were
received AZD4547 at the indicated doses or vehicle for 21 consecutive days (n
= 6 for treated group, n = 12 for vehicle group). Tumor volumes were
measured twice a week. The relative tumor volume was shown as mean ±
SEM.*, p < 0.05, **, p < 0.01, versus vehicle group, using unpaired two-tailed
Student’s t test (B). Tumor tissues resected after last dose were subjected to
immunoblotting with indicated antibodies. (C). D and E, GA3055 and GA1224
xenograft-bearing nude mice received BGJ398 at the indicated doses or
vehicle for 3 days. Tumor tissues resected after last dose were subjected to
immunoblotting with indicated antibodies.
9