Download Journal of Biological Education Fabry disease as a model for

Journal of Biological Education
Fabry disease as a model for: studying rare diseases, facing a new
pharmacological approach, training free programs and website resources
Giuseppina Andreottia§,…, MariaVittoria Cubellisb§
a Istituto di Chimica Biomolecolare – CNR, Pozzuoli 80078, Italy
b Dipartimento di Biologia, Università Federico II, Napoli 80126, Italy
§To whom correspondence should be addressed
Giuseppina Andreotti, Istituto di Chimica Biomolecolare, Consiglio Nazionale delle Ricerche,
Comprensorio Olivetti, Edificio 70, Via Campi Flegrei 34 I-80078 Pozzuoli (Napoli) Phone +39081-8675241 Fax 39-081-8675340; Email [email protected]
Maria Vittoria Cubellis, Dipartimento di Biologia, Complesso di Monte Sant'Angelo, VIA Cinthia
Napoli 80126; Tel.: +39 081-679118; Fax: +39 081-679233; Email: [email protected]
Fabry disease as a model for: studying rare diseases, facing a new
pharmacological approach, training free programs and website resources
Abstract
Recent advances in cell and molecular biology has been producing enormous amount of results in terms of
genetic analysis and profiling and a urgent demand for rapid and accurate tools for the analysis of the results
has been contemporarily raising. In the last two decades we recorded the development of large number of
websites, web-applications and databases expressly created by multidisciplinary experts. These are essential
tools for handling and analyzing biological data but a specific formation is needed and actually educational
materials and courses in the bioinformatics area have been continuously increasing.
On the other hand rare diseases have been catching increasing attention either from the scientific community
and from the common people.
The experience herein delineated is an interdisciplinary activity, designed for students in several fields
(biology, medicine, chemistry) and give the opportunity to face chemical, biological and medical issues at
molecular level, without wet-job, provided that these aspects are developed by others, in separate but
complementary contexts.
We think that it will be a valuable tool for biology students to increase their understanding of basic
bioinformatic concepts. It is essentially an exercise to practice modern technologies and some steps were
intentionally oversimplified.
The outcomes of such kind of experience may give useful and interesting scientific results, but the clinical
implications have to considered only an exercise and only professional subjects can utilize such results for
practical and diagnostic purposes.
Starting from a rare disease, Fabry disease, a journey through several and different websites, webapplications and databases can be realized mimicking an in silico scientific project, aiming at outlining a
molecular diagnosis of a illness, identifying new molecules for developing new drugs, choosing the best
therapeutic approach.
Keywords: bioinformatics education; bioinformatics tools; rare disease; pharmacological chaperone;
laboratory guide
Introduction
Fabry disease: a rare disease
A rare disease is any disease that has a low prevalence and affects a small percentage of the
population (with definitions ranging from 1/1000 to 1/200000 in the different regions in the world).
There are more than 6000 rare diseases. On the whole, rare diseases may affect 30 million European
Union citizens. 80% of rare diseases are of genetic origin, and are often chronic and lifethreatening.
Rare disease is an important field of interest for the translational research but also for the
application of personalized medicine approach. This approach is based on the integration of several
individual information: the genome variation, physiology and cellular phenotype, the interaction
with the personal environment and others (Palau 2012).
Fabry disease is X−linked and relatively frequent, 1−9 in 100000 (OMIM: 30150) (ref, METTEREI
UNA REVIEW RECENTE SUL FABRY DISEASE).
At molecular level, Fabry disease is characterized by mutations of the gene enconding lysosomal
alpha-galactosidase (AGAL) that causes low levels of this enzymatic activity leading to the
accumulation (within the lysosomes) of the unprocessed substrate (Gb3, globotriaosylceramide, and
its derivatives). It is one of the most common lysosomal storage diseases. Different mutations of the
gene encoding AGAL result in a wide phenotypic spectrum, with respect to age at onset, rate of
disease progression, severity of clinical manifestations. Patients with the late onset form of Fabry
disease retain some AGAL activity and are asymptomatic until adult age when they develop cardiac
and kidney problems. Since the age of onset can be late and its complications, cardiac
manifestations, stroke and chronic renal disease, are very similar to those of other very common
disorders, Fabry disease could have been under-diagnosed and an estimate as high as 1 in 3100 live
births has been put forward.
At present, the treatments of Fabry disease are symptomatic and life-long. So far the Enzymatic
Replacement Therapy (ERT) was the only approved therapy. This therapy requires intravenous
infusions of purified AGAL produced by genetically engineered cell lines every 2 weeks.
Pharmacological chaperone: a promising strategy for the treatment of some genetic diseases
The therapeutic approach with pharmacological chaperones (PCs) relies on small molecules that
bind and stabilize the enzyme, preventing its early degradation by intracellular machineries and
increasing its total intracellular levels.
It exploits small molecules which can be administered orally, can reach 'difficult' tissues such as the
brain and presumably have low cost. They act as life jackets or chaperones for enzymes that
become unstable and are degraded upon mutation, although they retain the essential residues needed
for their enzymatic activity. The same mutant proteins are able to comply their duty if they are
given the chance to survive long enough and to get to the site where they are needed.
At molecular level this therapeutic approach depends on the fact that the complex enzyme-ligand is
thermodynamically more stable than the enzyme alone. The ligand may be any kind of small
molecules provided that it binds to the enzyme, included competitive inhibitors (which occupies the
active site) but also allosteric ligands (which bind to sites other than the active one) (Ringe and
Petsko, 2009).
The treatment of metabolic diseases with competitive inhibitors as chemical chaperons at subinhibitory intracellular concentrations was first proposed by Fan et al in 1999. The approach is
getting known as pharmacological chaperone therapy and despite its novelty, it has produced a few
drugs which are in clinical trials or ready for the market.
Fabry disease is an example of disorders which can benefit from PC therapy. A large variability of
genotypes and phenotypes is observed and only a fraction of missense mutations respond to PC
therapy. The effects of missense mutations and hence their responsiveness to drugs, depends on the
site where they occur in the protein. Treatment with pharmacological chaperones, in particular 1deoxy-galactonojirimycin (DGJ, migalastat hydrochloride or AT1001) has already passed phase
three clinical trials (Markham 2016).
Learning objectives
Basically a student should gain familiarity with several websites and will see an important although
not exhaustive application of all of them.
More specifically, a student should be able to: (1) analyze a DNA/protein sequence (using BLAST);
(2) search for a protein with known structure (using PDB); (3) visualize a protein structure and
highlight specific aminoacid/region/ecc with RasMol; (4) search for properties of enzymes (using
BRENDA). Moreover the student will be introduced to the docking (with SwissDock) and with a
rare disease. Finally a student will be introduced to a quite novel usage of the term “chaperone”,
namely the pharmacological chaperone, that is so far poorly studied and mostly confused with the
most popular molecular chaperone.
Materials and methods
Requirements
It is an in silico experience so that only a computer with an internet connection is required.
In order to follow this exercise, students should have learned the basic biochemistry topics such as
proteins/enzymes (structure and function), DNA, carbohydrates, and also basic concepts of
thermodynamic and cell biology.
The experience
The experience will start from the results of a DNA analysis on a hypothetical patient. By utilizing
website resource (BLAST) the nucleotide sequence will be compared to control database and then
the encoded protein will be identified. Then the protein structure will be searched (PDB) and
visualized (RasMol). A public and comprehensive database for enzymes (BRENDA) will be
searched for the identification of specific molecules potentially able to bind to the above identified
protein and the efficacy of the binding will be checked (SwissDock). Eventually a web-application
designed to help clinicians to choose the best therapeutic approach will be considered
(FABRY_CEP).
Bioniformatic tools
Bioinformatics tools have the advantages of enabling fast, low-cost and reliable analysis of
biological data with user-friendly interfaces. These will be used for this experience:
BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi
PDB, http://www.rcsb.org/pdb/home/home.do (Berman et al. 2000)
RasMol, http://www.openrasmol.org/ (Bernstein 2000; Sayle and Milner-White 1995)
BRENDA, http://www.brenda-enzymes.org/index.php
SwissDock, http://www.swissdock.ch/
FABRY_CEP, http://www1.na.icb.cnr.it/project/fabry_cep/ (Cammisa et al. 2013)
Clinical case
Mister X was suspected to have a rare genetic disease and his doctor prescribed a genetic test to
check for Fabry disease, in order to provide a more informed and tailored drug prescription. The
sequence of the gene analyzed was the following (BISOGNEREBBE SPECIFICARE SU COSA E
STATA FATTA QUESTA SEQUENZA….):
atgcagctgaggaacccagaactacatctgggctgcgcgcttgcgcttcgcttcctggccctcgtttcctgggacatccctggggctagagcact
ggacaatggattggcaaggacgcctaccatgggctggctgcactgggagcgcttcatgtgcaaccttgactgccaggaagagccagattcctg
catcagtgagaagctcttcatggagatggcagagctcatggtctcagaaggctggaaggatgcaggttatgagtacctctgcattgatgactgttg
gatggctccccaaagagattcagaaggcagacttcaggcagaccctcagcgctttcctcatgggattcgccagctagctaattatgttcacagca
aaggactgaagctagggatttatgcagatgttggaaataaaacctgcgcaggcttccctgggagttttggatactacgacattgatgcccagacct
ttgctgactggggagtagatctgctaaaatttgatggttgttactgtgacagtttggaaaatttggcagatggttataagcacatgtccttggccctga
ataggactggcagaagcattgtgtactcctgtgagtggcctctttatatgtggccctttcaaaagcccaattatacagaaatccgacagtactgcaa
tcactggcgaaattttgctgacattgatgattcctggaaaagtataaagagtatcttgcactggacatcttttaaccaggagagaattgttgatgttgc
tggaccagggggttggaatgacccagatatgttagtgattggcaactttggcctcagctggaatcagcaagtaactcagatggccctctgggcta
tcatggctgctcctttattcatgtctaatgacctccgacacatcagccctcaagccaaagctctccttcaggataaggacgtaattgccatcaatcag
gaccccttgggcaagcaagggtaccagcttagacagggagacaactttgaagtgtgggaacgacctctctcaggcttagcctgggctgtagct
atgataaaccggcaggagattggtggacctcgctcttataccatcgcagttgcttccctgggtaaaggagtggcctgtaatcctgcctgcttcatca
cacagctcctccctgtgaaaaggaagctagggttctatgaatggacttcaaggttaagaagtcacataaatcccacaggcactgttttgcttcagct
agaaaatacaatgcagatgtcattaaaagacttactttaaaa
Results and discussion
Step 1. DNA analysis
In order to analyze the DNA sequence obtained the program blastn will be used (figure 1A).
1) Open the website and choose blastn (it searches nucleotide databases using a nucleotide
query).
2) Paste the given sequence into the Enter Query Sequence box.
3) Choose the Organism “Homo sapiens”.
4) Start the search.
The output is a list of all the significant alignments with DNA sequences (each sequence has been
determined within a specific scientific project then deposited by the authors in this bank, all the
details can be achieved by the Accession number) (figure 1B). In particular, all the sequence
producing significant alignments belong to human alpha-galactosidase. For each alignment many
parameters are shown. For the sake of simplicity, we can focus our attention on those alignments
for which the query sequence was totally considered (100% query cover), no gaps were introduced
(in order to match the sequences), and a high identity was recorded.
Looking at the alignment with “Homo sapiens galactosidase alpha (GLA), mRNA” it is possible to
observe that all the nucleotides matched except one: at position 730 of the query sequence (the
patient’s sequence) a C was identified instead of a G as in the control sequence (Homo sapiens
galactosidase alpha) (figure 1C).
Step 2. Looking for structural data
In order to understand the effect of this mutation on the encoded protein it is necessary to consider
the aminoacidic sequence since a change in one DNA base pair in the coding region may results in
the substitution of one aminoacid for another in the protein made by a gene (missense mutation) or
introduce a stop codon so that this type of mutation results in a shortened protein that may function
improperly or not at all (nonsense mutation).
We can search for the structure of human AGAL by using the program (figure 2A).
1) Choose blastx (it searches protein databases using a translated nucleotide query).
2) Paste the given sequence into the Enter Query Sequence box.
3) Choose the Organism “Homo sapiens”.
4) Choose the database Protein Data Bank proteins (pdb).
5) Start the search.
The output is a list of all the significant alignments with the relative accession number (figure 2B).
In this case the best score was obtained with “Chain A, Structure Of Human Alpha-galactosidase”.
In this specific case, the substitution G->C we noticed above, produce a missense mutation and the
protein sequence resulted modified in fat the coding triplet CAC introduce the residue Histidine
instead of the Aspartic acid found in control sequence (in the position 244).
So far we have verified that the patient has a mutated alpha-galactosidase and in particular the
mutation found was p.D244H.
But we need to know more about alpha-galactosidase structure. Was it already determined?
The output of blastx also indicate a Sequence ID: 1R46 (figure 2C).
It is now possible to find more information about this structure running a search for 1R46 in the
PDB (figure 3A).
1) Open the website.
2) Paste the given ID in the search box and Go.
We can learn (figure 3B) that: 1) this structure refers to the human alpha-galactosidase; 2) it is
designed as a hydrolase; 3) the structure was deposited in this bank in 2003; 4) the authors were
Garman and Garboczi; and 5) this structure was determined by X-ray diffraction. From the
published paper we can learn many other details for example “The catalytic mechanism of the
enzyme is revealed by the location of two aspartic acid residues (D170 and D231), which act as a
nucleophile and an acid/base, respectively” (Garman and Garboczi 2004).
Step 3. Structural analysis of the alpha-galactosidase
We can download and save the data (choosing the PDB Format, the dowloaded file will be saved as
1r46.pdb).
In order to visualize the three-dimensional structure it is necessary to use a specific program. One of
the simplest is RasMol, that is also free.
Having previously loaded RasWin (from the RasMol website), the Windows version of the
software RasMol, the file 1r46.pdb will be easily opened (figure 4A).
We can read all the details of this structure (total atoms, bonds, secondary structural elements and
so on).
We then: 1) select colours and then 2) select chain, we can see that AGAL has a quaternary
structure, in fact it is a homodimer, that means it is composed of two identical polypeptide chains
(blue and light blue in figure 2B). Moreover it is a glycoprotein bearing oligosaccharides (green)
linked on specific aminoacidic residues.
We can visualize the aminoacids responsible for the catalytic activity, namely residue 231 and 170
by writing “select 231 or 170” in the dialog box.
But where is located the mutated aminoacid? Does it belong to the catalytic site? Does it hamper the
enzymatic activity?
To address these questions we can write in the dialog box as follow: color green, spacefill, select
244, color red, spacefill (figure 4C).
In so doing we will highlight clearly (within each chain) the aminoacids responsible for the catalytic
activity (red) and the mutated aminoacid 244 (green) and we can realize that this aminoacid is
situated far from the active site suggesting that the mutation could not hinder the catalytic activity.
Actually it has been demonstrated that this mutation alter the protein stability but does not modify
the catalytic properties of AGAL.
This is one of those missense mutations amenable for treatment with PC (see step 5).
Step 4. How to develop a pharmacological chaperone
What is the function of AGAL in the cells?
We can find this and many other information within BRENDA by running a search for “alpha-GAL
EC 3.2.1.22” and selecting Homo sapiens in the appropriate dialog box. Looking at the menu on the
left, among Enzyme-Ligand interactions, Bibliography/Links/Disease, ecc, we can learn that an
AGAL deficiency cause the Fabry-Anderson disease (figure 5A). AGAL is a hydrolyse whose
natural substrate is the globotriaosylceramide (figure 5B).
We can notice that Gb3 contains a galactose moiety (figure 6) which is specifically recognized by
the enzyme (through the aminoacids lining its catalytic site).
It has been widely demonstrated that the binding of an inhibitor to an enzyme stabilizes the enzyme
so that it comes naturally to look for PC among competitive inhibitors of an enzyme. In this same
database we can see that 1-deoxy-galactonojirimycin (DGJ or migalastat) is an inhibitor of AGAL
(figure 5B). We can observe that it resembles the galactose moiety of the Gb3 (as shown in figure
6).
Does DGJ bind to AGAL? Is it possible to verify it? Where is the binding site? How strong is the
binding? In other words we need to run a molecular docking, that allow the prediction of the
preferred orientation of one molecule to a second when bound to each other to form a stable
complex.
For this purpose we can use SwissDock, and our target is 1R46 while our ligand is migalastat. We
also need to specify a Job name and an email address before starting the docking (figure 7A).
It will take several hours to obtain the results. The output shows the binding site and also the
calculated binding energy (a negative binding energy indicates a favorable thermodynamic
interaction) (figure 7B).
The obtained results clearly indicate that DGJ might bind strongly to AGAL so this molecule can
be considered a potential PC.
Indeed DGJ is a PC for Fabry disease. It took several years and hundreds of experiments to asses
this point. One of the first step in that direction was to test the molecule in vitro (having identified
the candidate molecule from a commercially available compounds it will be quite easy to pass to the
experimental test, otherwise it will be necessary to synthesize the molecule and this will require a
huge effort of preliminary experimental job). This experiments are outside the scope of this
exercise but in brief it is necessary to treat appropriate cells (for examples fibroblasts) with the
molecule and verify (by enzymatic assay and western blotting) that the treatment provoke an
increase of the intracellular level of the target protein (figure 8). Many other experiments allowed
the identification of DGJ as a candidate for clinical trials and recently has been approved for the
treatment of Fabry disease in the EU in patients with amenable mutations.
Step 5. How to identify the AGAL mutations amenable for PC therapy?
Up to now xx missense different mutation have been identified for AGAL. There is a wide
heterogeneity of genotypes but this explains only part of the heterogeneity observed in phenotypes
because clinical phenotype, age of onset and course of Fabry disease are highly variable, even
within the same family. At present the treatments of Fabry disease are symptomatic and life-long.
Enzyme replacement (ERT) has already been introduced into medical practice and is considered
“the clinical gold standard”. This therapy requires intravenous infusions of purified AGAL
produced by genetically engineered cell lines every 2 weeks.
In theory PCs represent a useful alternative to ERT because they do not cause adverse
immunological reactions and can be administered orally. In practice therapy with PCs is limited
because only some mutations can be rescued by these drugs. It has been observed that usually, but
not necessarily, late-onset forms, as well as mutations that do not occur in the catalytic domain of
AGAL, respond to 1-deoxy-galactonojirimycin. The decision to use it in therapy has to be taken on
a case-by-case basis after precise genotyping because DGJ is not effective on all alphagalactosidase (AGAL) mutants.
Fabry_CEP is a user-friendly web-application designed to help clinicians Choose Eligible Patients
for the therapy with pharmacological chaperones (figure 9). It provides a database and a predictive
tool to evaluate the responsiveness of lysosomal alpha-galactosidase mutants to a small molecule
drug, namely 1-Deoxy-galactonojirimycin. The user can introduce any missense/nonsense mutation
in the coding sequence (in the query data box the mutation both substitute nucleotide or substitute
aminoacid can be added), learn whether it is has been tested and gain access to appropriate
reference literature. In the absence of experimental data structural, functional and evolutionary
analysis provides a prediction and the probability that a given mutation is responsive to the drug. In
the analyzed case, p.D244H, we can read that the mutation does not occurred in the active site,
does not interfere with disulphide bridge formation and it has been sperimetally proved to be
responsive to the treatment with DGJ.
Acknowledgment
This work was supported by Telethon-Italy under Grant GGP12108.
References MANCA REVIEW RECENTE ED ESAUSTIVA X FABRY DISEASE
Berman H.M., Westbrook J., Feng Z., Gilliland G., Bhat T.N., Weissig H., Shindyalov I.N., Bourne
P.E. 2000. “The Protein Data Bank.” Nucleic Acids Research 28: 235-242.
Bernstein H.J. 2000. Recent changes to RasMol, recombining the variants. Trends in Biochemical
Sciences 25(9): 453-455.
Cammisa M., Correra A., Andreotti G., Cubellis M.V. 2013. “Fabry_CEP: a tool to identify Fabry
mutations responsive to pharmacological chaperones.” Orphanet Journal of Rare Diseases 8:111.
Fan J.Q., Ishii S., Asano N., Suzuki Y. 1999. “Accelerated transport and maturation of lysosomal
alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor.” Nature Medicine 5: 112-115.
Garman S.C. and Garboczi D.N. 2004. “The molecular defect leading to Fabry disease: structure of
human alpha-galactosidase.” Journal of Molecular Biology 337(2): 319-335.
Markam A. 2016. “Migalastat: First Global Approval.” Drugs 76(11): 1147-52.
Palau F. 2012. “Personalized medicine in rare diseases.” Personalized Medicine 9(2): 137-141.
Ringe D. and Petsko G.A. 2009. “Q&A: What are pharmacological chaperones and why are they
interesting?” Journal of Biology 8: 80.
Sayle R.A. and Milner-White E. J. 1995. “RasMol: Biomolecular graphics for all.” Trends in
Biochemical Sciences 20(9): 374-376.
Figure captions
Figure 1. DNA analysis by using bastn. Panel A, input data. Panel B, list of all
the significant alignments with DNA sequences. Panel C, DNA sequence
comparison between patient’s DNA and Homo sapiens galactosidase alpha.
Figure 2. DNA analysis by using bastx. Panel A, input data. Panel B, list of all
the significant alignments with protein sequences. Panel C, protein sequence
comparison between patient’s DNA and Homo sapiens galactosidase alpha.
Figure 3. Structural analysis of the alpha-galactosidase (1R46) by using PDB.
Panel A, input data. Panel B, output information.
Figure 4. Structural details of alpha-galactosidase (1R46) by using RasMol.
Panel A, global overview. Panel B, quaternary structure. Panel C, Catalytic
residues and localization of the mutation found in the patient.
Figure 5. Gaining info about AGAL by using BRENDA. Panel A, input data.
Panel B and C, selected output information showing details about : disease,
natural substrate, inhibitors.
Figure 6. Chemical formulas of: Gb3 (A), galactose (B), DGJ (C).
Figure 7. Molecular docking by using SwissDock. Panel A, input data. Panel B,
output information.
Figure 8. An illustrative scheme for testing in vitro potential pharmacological
chaperone.
Figure 9. Gaining info about specific mutations in AGAL by using Fabry_CEP.